WO2017153593A1

WO2017153593A1 - Ph-responsive poly-nucleic acid complexes

Info

Publication number: WO2017153593A1
Application number: PCT/EP2017/055739
Authority: WO
Inventors: Jean-Louis Mergny; Oscar MENDOZA POMAR; Yan Fu
Original assignee: Institut National De La Sante Et De La Recherche Medicale (Inserm); Universite de Bordeaux; Tianjin University
Priority date: 2016-03-11
Filing date: 2017-03-10
Publication date: 2017-09-14
Also published as: WO2017153570A3; WO2017153570A2

Abstract

This invention relates to the field of small size pH-responsive tools, especially for measuring a pH value in biological media. I-motif DNA structures have been extensively used in the art for the fabrication of nanodevices; however, it is still a challenge to assist the folding of multi-stranded i-motif, especially at physiological pH. The inventors have conceived a multi- stranded i-motif-based pH-responsive tool, which comprises a poly-nucleic acid complex, instead of the mono-nucleic acid complexes which were known in the art. The poly-nucleic acid complex according to the invention is far easier to design, and may be easily adapted depending on the pH- range of interest to be measured. The poly-nucleic complexes of the invention are useful for designing a variety of pH-responsive devices, and especially pH biosensors and pH-sensitive delivery systems, particularly in the pharmaceutical field.

Description

TITLE OF THE INVENTION

pH-responsive poly-nucleic acid complexes

FIELD OF THE INVENTION

The present invention relates to the field of small size pH-responsive tools

BACKGROUND OF THE INVENTION

Beyond the iconic Watson-Crick duplex, DNA can self-assemble into i-motif alternative structures. These non-canonical structures are formed by non- Watson-Crick interactions further stabilized by the presence of protons.

I-motif DNA structures have been extensively used in the fabrication of nanodevices, biosensors and delivery systems, taking advantage of their exquisite pH-sensitivity. However, this dependency becomes a drawback when i-motif formation is desirable at physiological pH.

The DNA i-motif has unique characteristics making it attractive for a number of applications. Under slightly acidic conditions, cytosine rich DNA sequences can fold into a C quadruplex, the i-motif, which actually corresponds to a "double duplex" in which two parallel duplexes are oriented in a head to tail orientation through the intercalation of hemi-protonated cytosine-cytosine (C-C⁺) base pairs (Gehring, K.; Leroy, J. L.; Gueron, M. Nature 1993, 363, 561— 565; Gueron, M.; Leroy, J. L. Curr. Opin. Struct. Biol. 2000, 10, 326-331). Due to pH-modulated conformational transitions, C-rich oligonucleotides have attracted considerable attention in nanotechnology, such as the exploration of nanomachines (Wang, Z. G.; Elbaz, J.; Willner, I. Nano Lett. 2011, 11, 304-309), pH sensors (Nesterova, I. V.; Nesterov, E. E. J. Am. Chem. Soc. 2014, 136, 8843-8846), logic circuit gates (Li, T.; Lohmann, F.; Famulok, M. Nat. Commun. 2014, 5, 4940), delivery systems (Kim, J.; Lee, Y. M.; Kang, Y.; Kim, W. J. ACS Nano 2014, 8, 9358- 9367.Li, W.; Wang, J.; Ren, J.; Qu, X. Angew Chem. Int. Ed. 2013, 52, 6726-6730), as well as switchable nanostructures (Guo, W.; Lu, C. H.; Orbach, R.; Wang, F.; Qi, X. J.; Cecconello, A.; Seliktar, D.; Willner, I. Adv. Mater. 2015, 27, 73-78. Yatsunyk, L. A.; Mendoza, O.; Mergny, J. L. Acc. Chem. Res. 2014, 47, 1836-1844).

Since the pKa of cytosine is between 4 and 5 (its exact value within a DNA or RNA strand depends on ionic strength because of polyelectrolyte effects (Mergny et al, JACS 1995 117: 8887), most i-motif nanostructures have been reported to be stable only under mildly acidic conditions: as half the cytosines are protonated in C C base pairs, optimal stability is obtained around pKa. Owing to the requirement of nano-objects operated at physiological pH, it is highly desirable to modulate the intrinsic pH transitions of i-motif structures. i-motif structures are formed by one, two, or four C-rich strands. Thermal stability of i- motif is influenced by several factors including number of C-C⁺ pairs, loop composition and length (Mergny et al, J. Am. Chem. Soc. 1995 117: 8887; Fujii, T.; Sugimoto, N. Chem. Chem. Phys. 2015, 17, 16719-16722). To date, several conditions have been discovered to facilitate the formation of intramolecular i-motif at near-neutral pH, such as molecular crowding or negative supercoiling (Rajendran, A.; Nakano, S.; Sugimoto, N. Chem. Commun. 2010, 46, 1299-1301. Sun, D.; Hurley, L. H. J. Med. Chem. 2009, 52, 2863-2874). Besides, introducing chemical modifications or incorporating stem-loop hairpins can tune the transitional midpoints of intramolecular i-motif to a small extent (Lannes, L.; Haider, S.; Krishnan, Y.; Schwalbe, H. ChemBioChem 2015, 16, 1647-1656. Nesterova, I. V.; Briscoe, J. R.; Nesterov, E. E. J. Am. Chem. Soc. 2015, 137, 11234-11237). Unlike the relatively fast kinetics in the folding of intramolecular i- motif (Mergny et al, J. Am. Chem. Soc. 1995 117: 8887; Lieblein, A. L.; Buck, J.; Schlepckow, K.; Furtig, B.; Schwalbe, H. Angew. Chem. Int. Ed. 2012, 51, 250-253), the formation pathway of tetramolecular i-motif involves several tetramers differing by the number of intercalated OC⁺ base pairs. Several weeks can be required to achieve the structural transition from incompletely intercalated tetramers to a fully intercalated one (Leroy, J. L. Nucleic Acids Res. 2009, 37, 12, 4127-4134).

Therefore, it is still a challenge to assist the folding of multi-stranded i-motif at physiological pH. There is a need for pH-sensitive compounds, including for i-motif-containing compounds, which are alternative or improved as compared with those which are known in the art.

SUMMARY OF THE INVENTION

The present invention relates to a poly-nucleic acid complex comprising four distinct C-rich polynucleotides, wherein:

- each C-rich polynucleotide comprises (i) a core region consisting of two or more cytosine- bearing nucleotides, or cytosine analog-bearing nucleotides, and (ii) two oligonucleotide side regions located at the 5'-end and at the 3'-end of the said core region, respectively, and - a given side region of a said C-rich polynucleotide forms a duplex structure with a given side region of a distinct C-rich polynucleotide of the said complex, so as to allow formation of a four-stranded structure between cytosine-bearing nucleotides or cytosine analog-bearing nucleotides.

In some embodiments, the poly-nucleic acid complex comprises four nucleic acids, each nucleic acid comprising one C-rich polynucleotide. In some embodiments of the poly-nucleic acid complex, the core region of a C-rich polynucleotide comprises a number of cytosine-bearing or cytosine analog-bearing nucleotides ranging from 2 to 10.

In some embodiments of the poly-nucleic acid complex, the said complex comprises four nucleic acids, each nucleic acid comprising one C-rich polynucleotide.

In some embodiments, the poly-nucleic acid complex comprises the following four distinct polynucleotides :

- [5 OLIGOI ]-[CYT]_w-[3 OLIGOI], of formula (OLIGOI),

- [5'0LIG02]-[CYT]_X-[3'0LIG02], of formula (OLIGO 2),

- [5'0LIG03]-[CYT]_y-[3'0LIG03], of formula (OLIGO 3), and

- [5'0LIG04]-[CYT]_Z-[3'0LIG04], of formula (OLIGO 4),

wherein:

- [CYT] means a cytosine-bearing nucleotide or a cytosine analog bearing nucleotide and each of w, x, y and z is, one independently from each other, means an integer ranging from 2 to 10, - [5'OLIGO] is an oligonucleotide side region located at the 5'-end of a [CYT] region of a polynucleotide selected in the group consisting of (OLIGOI), (OLIG02), (OLIG03) and (OLIG04X

- [3 OLIGO] is an oligonucleotide side region located at the 3 '-end of [CYT] region of a polynucleotide selected in the group consisting of (OLIGOI), (OLIG02), (OLIG03) and (OLIG04)_,

and

- each of [5'OLIGO] of a polynucleotide selected in the group consisting of (OLIGOI), (OLIG02), (OLIG03) and (OLIG04) has a sequence complementary to a [3 OLIGO] of another polynucleotide selected in the group consisting of (OLIGOI), (OLIG02), (OLIG03) and (OLIG04).

In some embodiments of the poly-nucleic acid complex, one or more of the nucleic acids contained therein is labeled with a detectable molecule.

In some embodiments, the poly-nucleic acid forms quadruplexes between the cytosine-bearing nucleotides of the oligonucleotides comprised in the group of [CYT]_W, [CYT]_X; [CYT]_yand [CYT]_Z at a known pH value, and wherein the said known pH value is predetermined by the value of each of the integers selected in the group consisting of w, x, y and z.

This invention also pertains to a pH-responsive device, or a pH-sensitive device comprising one or more poly-nucleic acid complexes as defined above.

This invention also concerns a method of measuring the pH value of a sample comprising the steps of: a) bringing one or more nucleic acid complexes according to any one of claims 1 to 13 with a sample, and

b) detecting a signal indicative of the formation, of quadruplexes between the cytosine-b earing nucleotides of the oligonucleotides comprised in the group of [CYT]_W, [CYT]_X; [CYT]_{y wi} [CYT]_Z.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Schematic illustration of i-motif-forming systems constructed in this study. The four Watson-Crick duplex parts are shown here of identical length, but embodiments allow combining motifs containing very distinct numbers of base pairs. The left part of Figure 1 illustrates four separate C-rich polynucleotides, each comprising a (i) core consisting of cytosine- bearing nucleotides or cytosine analog-bearing nucleotides and (ii) a 5 'end side region and a 3 'end side region. The middle part of Figure 1 illustrates the same C-rich polynucleotides wherein duplex structures are formed between the side regions, thus forming a poly-nucleic acid complex, wherein the cytosine-bearing nucleotides or the cytosine analog-bearing nucleotides are not associated. The right part of Figure 1 illustrates a poly-nucleic acid complex wherein stabilization occurs through the formation of a C-quadruplex structure between the cytosine-bearing nucleotides or the cytosine analog-nearing nucleotides comprised in the core region.

Figure 2. Normalized chromatograms of single strand A-C5-Dp of C5, two partly complementary strands (A-C5-Dp + B-C5-Ap) of C5, three partly complementary strands (A-C5- Dp + B-C5-Ap + C-C5-Bp) of C5, and fully assembled C5, C4, C3 and C2, respectively. Ordinate : absorbance normalized signal, as expressed in Arbitrary Units (AU). Abscissa : elution volume, as expressed in mL. In the figure, with an increasing elution volume, the successive peaks correspond to C5, C4, C3, C2, A-C5-Dp + B-C5-Ap + C-C5-Bp, A-C5-Dp + B-C5-Ap and A-C5-Dp, successively.

Figure 3. (Figure 3a) CD spectra of C5 system at different pH values at 15 °C. Lower embedded graph : CD spectrum of C5 at pH 7.08 subtracted by the spectrum obtained at pH 8.00. Ordinate : Circular Dichroism value, as expressed in mdeg. Abscissa : wavelength, as expressed in nanometers. In the main graph, the curves at pH 5.10 and at pH 8.00 are indicated. The intermediate curves consist of the curves generated at the intermediate pH values. {Figure 3b) Comparison of the pH melting curves of five systems derived from the CD intensities at 288 nm, over the pH range of 5.1-8.0.■ : C5; · : C4;▲ : C3; T : C2.5; : C2. Ordinate : fraction folded. Abscissa : pH values.

Figure 4. CD spectra of d(TC₅) at different pHs. Ordinate : Circular Dichroism value, as expressed in mdeg. Abscissa : wavelength, as expressed in nanometers. Curves are specifically labelled. Intermediate curves Lower embedded graph : The folded fractions derived from the CD intensities at 288 nm. This system has a pH^T of 5.7.

Figure 5: CD spectra of C4 (a), C3 (b), C2.5 (c) and C2 (d) at different pHs, respectively. Ordinate : Circular Dichroism value, as expressed in mdeg. Abscissa : wavelength, as expressed in nanometers. Lower embedded graph : CD spectra of C4 at pH 6.79 (a), C3 at pH 6.51 (b), C2.5 at pH 6.37 (c) and C2 at pH 6.15 (d) subtracted by the corresponding spectra obtained at pH 8.00. Ordinate : Circular Dichroism value, as expressed in mdeg. Abscissa : wavelength, as expressed in nanometers. The distinction between the curves at distinct pH values is not easily readable in the main part of Figures 5(a) to 5(d) but the corresponding information was not intended to be precisely discussed herein.

Figure 6. Time courses of pH-induced transitions of C5 between 7 and 8, monitored by CD spectroscopy at 288 nm. Ordinate : Circular Dichroism value, as expressed in mdeg. Abscissa : time, as expressed in minutes.

Figure 7. UV melting curves monitored at 260 nm for MutT5 (a), MutTC (b) and C5 (c) at pH 7.40. Ordinate : Normalized absorbance at the wavelength of 260 nanometers. Abscissa : temperature, as expressed in Celsius.

Figure 8 TDS spectra of C5, MutT5 and MutTC at pH 7.40. (b) TDS spectra of C5 at pH 7.40, C4 at pH 7.08, C3 at pH 6.79, C2.5 at pH 6.37 and C2 at pH 6.15, respectively. Ordinate : Difference in Absorbance. Abscissa : wavelength, as expressed in nanometers.

Figure 9 (a) UV melting curves for C5 at 7.40, C4 at 7.08, C3 at 6.79, C2.5 at 6.37 and C2 at 6.15, respectively. Abscissa : Normalized absorbance at the wavelength of 260 nanometers. Ordinate : temperature, as expressed in Celsius, (b) The T_m values of five systems each measured at 4-5 different pHs.■ : C5 at pH 7.40; · : C4 at pH 7.08;▲ : C3 at pH 6.79; T : C2.5 at pH 6.37; : C2 at pH 6.15. Ordinate : temperature, as expressed in Celsius. Abscissa : pH values.

Figure 10. UV melting curves monitored at 295 nm for MutT5 (a) and MutTC (b) at pH 7.40. Ordinate : Normalized absorbance at the wavelength of 260 nanometers. Abscissa : temperature, as expressed in Celsius.

Figure 11. ^lH NMR spectra from the thermal denaturation process of C5 at pH 5.80. Figure 12. Fluorescence signal of berberine in the presence of C5, C4, C3, C2.5 and

C2 at different pHs. Ordinate : Normalized absorbance at the wavelength of 260 nanometers. Abscissa : pH values.

Figure 13. Fluorescence emission of berberine in the absence and presence of duplex DNA at different pH. Abscissa : pH values. Ordinate : Fluorescence, as expressed in Arbitrary Units (AU). Ordinate : pH values. Figure 14. Fluorescence signal of berberine in the presence of C7 and C9 at different pHs. Ordinate : Normalized absorbance at the wavelength of 260 nanometers. Abscissa : pH values. DETAILED DESCRIPTION OF THE INVENTION

The present invention provides for a poly-nucleic acid complex comprising stretches of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides, the specific features of which allow the formation of a quadruplex structure involving cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides, at defined pH conditions.

To achieve this goal, the inventors guided the formation of a tetramolecular i-motif using Watson-Crick duplexes as scaffolding templates, confining four C-rich stretches in a nanoscale region.

The inventors have shown that transitional midpoints of nucleic acid complexes comprising guided i-motif structures may be easily tuned by changing the length of C-rich stretches, with a pH of mid-transition as high as 7.5, or even more in certain embodiments.

It is also shown herein that the i-motif-forming structures according to the present invention exhibit pH-responsive recognition to berberine, an anticancer drug.

According to the inventors knowledge, it is described herein for the first time that nucleic acid constructs containing C-quadruplex structures can be stable at a physiological pH, which offers new perspective for the design of DNA-based pH-responsive material acting in a physiological pH range, which includes pH-responsive nano-sensors as well as pH-driven controlled release compositions.

As it is disclosed herein, the specific design of the poly-nucleic acid complexes facilitate the formation of C-quadruplexes at physiological pH, of which the key is the utilization of Watson-Crick duplexes to confine four C-rich stretches in a nanoscale region. This is, to the best of the inventors knowledge, the first time that a tetramolecular i-motif structure having a pH of mid- transition above 7 is disclosed.

More precisely, it is provided herein a poly-nucleic acid complex comprising four polynucleotides, each of these four polynucleotides comprising a C-rich stretch, wherein the four resulting C-rich stretches comprised in the said complex are positioned so as to allow the formation of C-quadruplexes in selected pH conditions.

As it will be detailed herein, the specific pH conditions in which C-quadruplexes are formed within a poly-nucleic acid complex of the invention may be determined by providing a specific length of the C-rich stretch in each of the four polynucleotides comprised therein. Thus, by appropriately defining the length of the C-rich stretches comprised in a poly-nucleic acid complex as described herein, the one skilled in the art may easily control at which pH value the said C-rich stretches associate so as to form a C-quadruplex assembly.

As it is shown herein, the pH values at which C-quadruplexes are formed depend on the length of the C-rich stretches comprised in each of the C-rich polynucleotides comprised in a poly-nucleic acid complex according to the invention.

According to the experimental data obtained by the inventors, it is believed that the duplex structures formed between the side regions of the C-rich polynucleotides allow an appropriate location of the C-rich stretches so as to permit formation of two sets of parallel paired duplexes containing stretches of cytosine residues, or cytosine analog residues, to form a C- quadruplex in the appropriate pH conditions. Under appropriate pH conditions, the two sets of parallel duplexes are stabilized by hemi-protonated non-canonical "cytosine-cytosine" base pairs (or cytosine analog-cytosine base pairs, or also cytosine analog-cytosine analog base pairs) in which a protonated cytosine residue is situated opposite to an unprotonated cytosine residue with parallel chain orientation of the phosphodiester backbone. These two duplexes are associated in an antiparallel way by base-pair intercalation forming a C-tetraplex.

According to the experimental data that they have obtained, the inventors believe that the said duplex structures and sequences formed between the side regions of the C-rich polynucleotides, which are located at 3 'end and 5 'end of the C-streches respectively, have a marginal impact, or even have no impact, on the pH value at which the C-quadruplexes are formed, as long as these duplexes are stable at a temperature of interest.

The present invention relates to a poly-nucleic acid complex comprising four distinct C-rich polynucleotides, wherein

- each C-rich polynucleotide comprises (i) a core region consisting of two or more cytosine- bearing nucleotides, or cytosine analog-bearing nucleotides, and (ii) two oligonucleotide side regions located at the 5'-end and at the 3'-end of the said core region, respectively, and

- a given side region of a said C-rich polynucleotide forms a duplex structure with a given side region of a distinct C-rich polynucleotide of the said complex, so as to allow formation of a four-stranded structure between cytosine-bearing nucleotides or cytosine analog-bearing nucleotides.

As used herein, the terms "nucleic acid", "polynucleotide" and "oligonucleotide" refer to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D- ribose), and to any other type of polynucleotide which is a C or N glycoside of a purine or pyrimidine base, modified purine or pyrimidine base or any other heterocycle. The sugar moiety is not limited to D- or L-ribose; other sugars known to men skilled in the art are also encompassed. Also, the phosphodiester linkage can be modified. Typical examples are the phosphorothioates. There is no intended distinction of the chain length between the terms "nucleic acid" and "oligonucleotide", and these terms may be used interchangeably as regard their chain length. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded nucleic acids as well as more complex structures such as triplexes, quadruplexes and higher assemblies are included.

Generally, in a nucleic acid, the naturally occurring sugar phosphate backbone of nucleic acids containing either ribonucleoside subunits (RNA), deoxyribonucleoside subunits (DNA), peptide nucleic acid subunits (PNA), acyclic subunits or oligosaccharide subunits. Therefore, in a preferred embodiment, the backbone comprises phosphodiester linkages and ribose. In recent years, there have been reports of nucleic acids that have similar properties to oligonucleotides, but differ in the structure of their backbone, which have structures formed from any and all means of chemically linking nucleotides, e.g. hexopyranose, 3-deoxy-erythro- pentofuranosyl moiety, as an alternative to the natural occurring phosphodiester ribose backbone.

In a preferred embodiment, the sugar configuration is selected from the group consisting of the alpha-D-, beta-D-, alpha-L- and beta-L-configurations.

In a "nucleic acid", "polynucleotide" or "oligonucleotide", the nucleobases are attached to the backbone and take part in base pairing to other nucleic acid binding compounds via hydrogen bonding and/or base stacking. This may include structures formed from any and all means of chemically linking nucleotides, e.g. the natural occurring phosphodiester ribose backbone or unnatural linkages, e.g. phosphorothioates, methyl phosphonates, phosphoramidates and phosphotriesters. Peptide nucleic acids have unnatural linkages.

Therefore, a "nucleic acid", "polynucleotide" or "oligonucleotide" as used herein includes modifications to the chemical linkage between nucleotides as described above, as well as other modifications that may be used to enhance stability and affinity, such as modifications to the sugar structure. For example an alpha-anomer of deoxyribose may be used, where the base is inverted with respect to the natural beta-anomer. In an embodiment, the 2'-OH of the sugar group may be altered to 2'-0-alkyl or 2'-Fluor, which provides resistance to degradation without comprising affinity.

In some embodiments of a nucleic acid as described herein, the said nucleic acid may contain DNA, RNA, PNA or LNA.

In some embodiments of a poly-nucleic acid complex as described herein, the nucleic acids contained therein are selected from a group comprising DNA or RNA and wherein some or all of the nucleotides may be substituted by LNA, PNA, 2'OMe, Phosphorothioate, or any base, sugar or phosphate modification which does not prevent duplex formation. In some embodiments of a nucleic acid, the sugar is in a locked conformation. LNA (Locked Nucleic Acid) is a class of nucleic acid analog. LNA oligomers that obey the Watson- Crick base pairing rules and hybridize to complementary oligonucleotides. However, when compared to DNA and other nucleic acid derivatives, LNA provides vastly improved hybridization performance. LNA/DNA or LNA/RNA duplexes are much more thermally stable than the similar duplexes formed by DNA or RNA. LNA has the highest affinity towards complementary DNA and RNA.

In some embodiments of a nucleic acid, the said nucleic acid is a peptide nucleic acid (also termed PNA). Thus, in some embodiments, a nucleic acid may comprise or consist of analog or derivative nucleic acids, such as peptide nucleic acids (PNA) and others exemplified in U.S. Patent Nos. US 4,469,863; US 5,536,821; US 5,541,306; US 5,637,683; US 5,637,684; US 5,700,922; US 5,717,083; US 5,719,262; US 5,739,308; US 5,773,601; US 5,886,165; US 5,929,226; US 5,977,296; US 6,140,482; PCT applications Nos. WO 00/56746 and WO 01/14398. Methods for synthesizing oligonucleotides comprising such analogs or derivatives are disclosed, for example, in the patent publications cited above, in U.S. Patent Nos. US 5,614,622; US 5,739,31 ; US 5,955,599; US 5,962,674; US 6,117,992; in PCT application No. WO 00/75372.

As used herein, a "poly-nucleic acid" structure means a structure that comprises more than one nucleic acid molecule. Typically herein, a poly-nucleic acid structure comprises two, three or four nucleic acid molecules.

As used herein, a poly-nucleic acid "complex" means that two nucleic acid molecules comprised in the complex are associated through base pairing between complementary regions located in each of the said two nucleic acid molecules, respectively. Thus, a poly-nucleic acid complex comprises duplex structures between two nucleic acid molecules comprised therein. Typically, in a poly-nucleic acid complex according to the invention, two distinct nucleic acid molecules comprised therein are "complexed", one with the other, through duplex structures formed by base pairing, e.g. Watson-Crick base pairing.

As used in the context of the present invention, a "C-rich polynucleotide" consists of a nucleic acid comprising a stretch of two or more cytosine-bearing nucleotides, or cytosine analog- bearing nucleotides. The said stretch of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides, forms a "core region" of the said C-rich polynucleotide, the said core region being bordered by two oligonucleotides at its 5'-end and 3'-end, respectively, and wherein each of these 5'-end oligonucleotide and 3'-end oligonucleotide is termed a "side region" comprised in the said C-rich polynucleotide. As used in the context of the present invention, a "core region" consists of nucleic acid comprising a stretch of two or more cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides as specified above.

As used herein, a "cytosine-bearing" nucleotide means a molecule consisting of a backbone, which encompasses a cyclic backbone, generally a sugar backbone, and most preferably a deoxyribose backbone to which a cytosine is covalently linked, the said cytosine-bearing nucleotide being most preferably a cytidine.

As used herein, a "cytosine analog-bearing" nucleotide means a molecule consisting of a cyclic backbone, generally a sugar backbone, and most preferably a deoxyribose backbone to which a cytosine analog is covalently linked. Cytosine analogs encompass 5-methyl cytosine, 5- hydroxymethyl cytosine, and any other base having donors and acceptors of H-bonds with the same geometry as the Watson-Crick face of cytosine.

As used sometimes herein, the expression relating to a structure, e.g. a core region, comprising "cytosine residues or cytosine analog residues", does not mean that the said structure, e.g. the said core region, is restricted to the structures comprising only cytosine residues or only cytosine analog residues. Instead, this expression also encompasses structures, e.g. core regions, comprising combinations of both cytosine residues and cytosine analog residues.

As used in the context of the present invention, a "side region" or "oligonucleotide side region" consists of an oligonucleotide located at the 5'-end or at the 3'-end of a core region comprised in a C-rich polynucleotide of a poly-nucleic acid complex described herein.

In a poly-nucleic acid complex according to the invention, each of the four C-rich polynucleotides have structural features such that the general conformation of the said complex brings the four core regions in close proximity, so that the four core regions may associate and form a four-stranded structure in appropriate pH conditions. The said four-stranded structure is also termed "C-quadruplex" herein. The said four-stranded structure consists of two intercalated parallel duplexes containing hemi-protonated C*C⁺ pairs, wherein (i) "C" means a cytosine, or a cytosine analog, and wherein "C " means a protonated cytosine, a protonated cytosine analog or a base analog mimicking protonation of cytosine at the N3 position.

In a poly-nucleic acid complex as described herein :

- the said poly-nucleic acid complex comprises two or more nucleic acids,

- the said poly-nucleic acid complex comprises four distinct C-rich polynucleotides,

- each C-rich polynucleotide comprises a core region bordered by (i) a 5 '-end side region and (ii) a 3 '-end side region, - a given side region located in a first nucleic acid of the poly-nucleic acid complex has a sequence complementary to another side region located in a second nucleic acid of the poly- nucleic acid complex, and

- a given side region located in a first nucleic acid of the poly-nucleic acid complex cannot form a stable duplex structure with another side region located in the said first nucleic acid of the poly-nucleic acid complex (i.e. no complementary sequences able to form a duplex assembly in a given nucleic acid comprised in a poly-nucleic acid complex of the invention).

As it is shown in the examples herein, the pH value at which a poly-nucleic acid complex stabilizes by forming a four-stranded structure (i.e. a C-quadruplex structure) varies with the number of cytosine residues involved in the said four-stranded structure. Notably, the pH value at which a poly-nucleic acid complex stabilizes varies with the number of cytosine-bearing nucleotides (or cytosine analog-bearing nucleotides) comprised in the core region included in each of the four C-rich polynucleotides. Further, the pH value at which a poly-nucleic acid complex stabilizes is easily determined by detection of the conformational change of the said complex, for example by using well known methods such as circular dichroism (CD), NMR spectrometry or also U.V. absorbance or fluorescence spectroscopy.

As it is illustrated in the examples, a poly-nucleic acid complex as described herein wherein each of the four C-rich polynucleotides comprises a core region consisting of a stretch of two cytosine-bearing nucleotides stabilizes at a pH of 6.15.

As it is also illustrated in the examples, a poly-nucleic acid complex as described herein wherein each of the four C-rich polynucleotides comprises a core region consisting of a stretch of three cytosine-bearing nucleotides stabilizes at a pH of 6.79.

As it is further illustrated in the examples, a poly-nucleic acid complex as described herein wherein each of the four C-rich polynucleotides comprises a core region consisting of a stretch of four cytosine-bearing nucleotides stabilizes at a pH of 7.08.

As it is yet further illustrated in the examples herein, a poly-nucleic acid complex as described herein wherein each of the four C-rich polynucleotides comprises a core region consisting of a stretch of five cytosine-bearing nucleotides stabilizes at a pH of 7.40.

According to the inventors knowledge, it is disclosed for the first time herein nucleic acids comprising C-rich regions and having the ability of forming a cytosine four stranded structure (i.e. C-quadruplex structure), which nucleic acids possess the properties of stabilizing at a pH value of 7.0 or more.

In some embodiments of a poly-nucleic acid complex as described herein, a core region comprised in a C-rich polynucleotide comprises a number of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides, ranging from 2 to 10. Thus, a core region may comprise 2, 3, 4, 5, 6, 7, 8, 9 or 10 cytosine-bearing nucleotides, or cytosine analog- bearing nucleotides.

In some embodiments, all core regions comprise the same number of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides.

In some other embodiments, the core regions may comprise different numbers of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides. According to these other embodiments, the four core regions are preferably paired, so that (i) two of the four core regions comprise a given identical number of cytosine-bearing nucleotides or cytosine analog-bearing nucleotides and (ii) the two other core regions comprise another identical number of cytosine- bearing nucleotides or cytosine analog-bearing nucleotides. Most preferably, the number of cytosine-bearing nucleotides or cytosine analog-bearing nucleotides between two distinct core regions differ only by one cytosine-bearing nucleotide or one cytosine analog-bearing nucleotide, so as to maintain the ability of a poly-nucleic acid complex to stabilize by the formation of structures comprising paired cytosine residues or cytosine analog residues.

Thus, such other embodiments encompass poly-nucleic acid complexes wherein :

- the core region comprised in two of the four C-rich polynucleotides comprise two cytosine- bearing nucleotides or cytosine analog-bearing nucleotides, and

- the core region comprised in the two other C-rich polynucleotides comprise three cytosine- bearing nucleotides or cytosine analog-bearing nucleotides.

Other illustrative examples of these other embodiments encompass those wherein the number of cytosine-bearing nucleotides or cytosine analog-bearing nucleotides comprised in the core region of (i) a first set of two C-rich polynucleotides and of (ii) the remaining set of two C- rich polynucleotides is of : (i) 3 and (ii) 4, (i) 4 and (ii) 5, (i) 5 and (ii) 6, (i) 6 and (ii) 7, (i) 7 and (ii) 8, (i) 8 and (ii) 9, (i) 9 and (ii) 10, (i) 2 and (ii) 4; (i) 3 and (ii) 5; (i) 4 and (ii) 6; (i) 5 and (ii) 7; (i) 6 and (ii) 8; (i) 7 and (ii) 9; or (i) 8 and (ii) 10; respectively.

A poly-nucleic acid complex as described herein comprises two or more distinct nucleic acids that form a complex through association of side regions by base pairing of complementary sequences, provided that a given nucleic acid comprised in the said poly-nucleic acid complex does not self-assemble into a duplex structure through base-pairing.

Generally, a poly-nucleic acid complex as described herein comprises the following four distinct polynucleotides :

- [5'0LIG01]-[CYT]_W-[3'0LIG01], of formula (OLIGOl),

- [5'0LIG02]-[CYT]_X-[3'0LIG02], of formula (OLIGO 2),

- [5'0LIG03]-[CYT]_y-[3'0LIG03], of formula (OLIGO 3), and

- [5'0LIG04]-[CYT]_Z-[3'0LIG04], of formula (OLIGO 4), wherein :

- [CYT] means a cytosine-bearing nucleotide or a cytosine analog bearing nucleotide and each of w, x, y and z is, one independently from each other, means an integer ranging from 2 to 10,

- [5'OLIGO] is an oligonucleotide side region located at the 5'-end of a [CYT] region of a polynucleotide selected in the group consisting of (OLIGOl), (OLIG02), (OLIG03) and

(OLIG04X

- [3'OLIGO] is an oligonucleotide side region located at the 3 '-end of [CYT] region of a polynucleotide selected in the group consisting of (OLIGOl), (OLIG02), (OLIG03) and (OLIG04X

and

- each of [5'OLIGO] of a polynucleotide selected in the group consisting of (OLIGOl), (OLIG02), (OLIG03) and (OLIG04) has a sequence complementary to a [3'OLIGO] of another polynucleotide selected in the group consisting of (OLIGOl), (OLIG02), (OLIG03) and (OLIG04).

As already previously specified herein, according to some embodiments, the number of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides, is the same for all core regions comprised in the four C-rich polynucleotides, which means that the integers w, x, y and z have an identical value, the said value ranging from 2 to 10.

According to some other embodiments, the number of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides, are not identical in distinct core regions, although there is preferably a close number of cytosine-bearing nucleotides or cytosine analog-bearing nucleotides in the core region of the four C-rich polynucleotides. According to these other embodiments, the C- rich polynucleotides are preferably paired so that the poly-nucleic acid complex comprises (i) a first set of two C-rich polynucleotides comprising in the core region a first given number of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides, and (ii) a second set of two C-rich polynucleotides comprising in the core region a second given number of cytosine-bearing nucleotides, or cytosine analog-bearing nucleotides, and wherein, most preferably, the numerical difference between the first given number and the second given number is not more than two and is most preferably one. Thus, according to these other embodiments, two integers selected in the group consisting of w, x, y and z have an identical first value and the two other integers in the said group have an identical second value, with a difference between the first and second value being of 2 or less, and most preferably the difference between the first and second value being of 1.

The side regions selected in the group comprising [5 OLIGOl], [3 OLIGOl], [5OLIG02], [3OLIG02], [5OLIG03], [3OLIG03], [5OLIG04] and [3OLIG04] have a nucleotide length of 5 nucleotides or more, which encompasses a nucleotide length of 10 nucleotides or more. It shall be understood that the minimal length of a side region of a first C-rich polynucleotide is the minimal length of the nucleotide sequence comprised therein that is complementary to a side region of a second C-rich polynucleotide which allows the formation of a duplex structure suitable for contributing to place the poly-nucleic complex in a conformation wherein the four core regions comprised therein are neighboring and may associate together to form a quadruplex structure (i.e. a C-quadruplex structure), in the appropriate pH conditions.

Indeed, a side region of a C-rich polynucleotide may have a nucleotide length that is higher than the minimal nucleotide length required for a duplex structure formation between the respective side regions of two distinct C-rich polynucleotides.

In some embodiments a first side region of a first C-rich polynucleotide comprises a sequence complementary to a second side region of a second C-rich polynucleotide that is longer than the minimal complementary sequence required for a duplex structure formation between the said first and second side regions.

In some embodiments, a side region of a C-rich polynucleotide does only comprise a sequence complementary to a side region of another C-rich polynucleotide, but has a higher length and thus also comprises sequence(s) that is(are) not complementary to a side region of another C- rich polynucleotide, such as a tail sequence allowing the covalent binding or the non-covalent binding of a detectable molecule (e.g. a fluorophore) or of an active agent (e.g. a pharmaceutical active ingredient).

Consequently, a side region selected in the group comprising [5'OLIGOl],

[3'OLIGOl], [5OLIG02], [3OLIG02], [5OLIG03], [3OLIG03], [5OLIG04] and [3OLIG04] has a minimal nucleotide length of 5 nucleotides, which encompasses a minimal nucleotide length of 10 nucleotides, and may have a nucleotide length of 20 nucleotides or more.

Generally, a side region selected in the group comprising [5'OLIGOl], [3'OLIGOl], [5OLIG02], [3OLIG02], [5OLIG03], [3OLIG03], [5OLIG04] and [3OLIG04] has a nucleotide length of less than 1,000 nucleotides.

Thus, generally, a side region selected in the group comprising [5'OLIGOl], [3'OLIGOl], [5OLIG02], [3OLIG02], [5OLIG03], [3OLIG03], [5OLIG04] and [3OLIG04] has a nucleotide length selected in a group comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, or at least 990, and up to 1000 nucleotides in length. In some embodiments, the side regions [5'OLIGOl], [3'OLIGOl], [5OLIG02], [3OLIG02], [5OLIG03], [3OLIG03], [5OLIG04] have all the same nucleotide length.

In some other embodiments, the side regions [5'OLIGOl], [3'OLIGOl], [5OLIG02], [3OLIG02], [5OLIG03], [3OLIG03], [5OLIG04] have not all the same nucleotide length. According to these other embodiments; two or more side regions selected in the group comprising [5'OLIGOl], [3'OLIGOl], [5OLIG02], [3OLIG02], [5OLIG03], [3OLIG03], [5OLIG04] may have the same nucleotide length.

In some embodiments of a poly-nucleic acid complex as described herein,

- [5'OLIGOl] has a sequence complementary to a sequence of [3OLIG02]

- [3'OLIGOl] has a sequence complementary to a sequence of [5OLIG04],

- [5OLIG02] has a sequence complementary to a sequence of [3OLIG03], and

- [5OLIG03] has a sequence complementary to a sequence of [3OLIG04],

Illustratively, a [5'OLIGOl] which has a sequence complementary to a sequence of [3OLIG02] encompasses (i) embodiments wherein the sequence of [5'OLIGOl] comprises only a sequence complementary to the sequence consisting of [3OLIG02], (ii) embodiments wherein the sequence of [5'OLIGOl] comprises only a sequence complementary to a sequence comprised in the sequence of [3OLIG02], (iii) embodiments wherein the sequence of [5'OLIGOl] comprises a sequence complementary to the sequence consisting of [3OLIG02] and wherein [5'OLIGOl] also comprises additional sequence(s) not complementary to a sequence of [3OLIG02], and (iv) embodiments wherein the sequence of [5'OLIGOl] comprises a sequence complementary to a sequence comprised in the sequence of [3OLIG02] and wherein [5'OLIGOl] also comprises additional sequence(s) not complementary to a sequence of [3OLIG02]. The same construing applies identically regarding [3'OLIGOl] and [5OLIG04], [5OLIG02] and [3OLIG03], as well as [5OLIG03] and [3OLIG04] above.

In some embodiments of a poly-nucleic acid complex as described herein the C-rich polynucleotides selected in a group comprising (OLIGOl), (OLIG02), (OLIG03) and (OLIG04) are all comprised in four distinct nucleic acids. In these embodiments, a poly-nucleic acid complex comprises four separate nucleic acids that are associated together through base pairing of the complementary sequences comprised in each of the side regions of the group comprising [5'OLIGOl], [3'OLIGOl], [5OLIG02], [3OLIG02], [5OLIG03], [3OLIG03], [5OLIG04]. In certain aspects of these embodiments, each of the four nucleic acids comprises exclusively a C- rich polynucleotide selected in a group comprising (OLIGOl), (OLIG02), (OLIG03) and (OLIG04). In other aspects of these embodiments, one or more of the said four nucleic acids comprise nucleotide sequence(s) additional to the sequence of a C-rich polynucleotide selected in a group comprising (OLIGOl), (OLIG02), (OLIG03) and (OLIG04). In some other embodiments, a poly-nucleic acid complex as described herein comprises at least two nucleic acids and less than four nucleic acids, which means that one or more nucleic acids comprise at least two C-rich polynucleotides selected in a group comprising (OLIGOl), (OLIG02), (OLIG03) and (OLIG04). Thus, in certain embodiments, a poly-nucleic acid comprises three nucleic acids, with one nucleic acid comprising two C-rich polynucleotides and two nucleic acids comprising one C-rich polynucleotide. In certain other embodiments, a poly- nucleic acid complex comprises two nucleic acids, (i) with each nucleic acid comprising two C-rich polynucleotides or (ii) with one nucleic acid comprising one C-rich polynucleotide and the other nucleic acid comprising three C-rich polynucleotides.

These various embodiments of a poly-nucleic acid complex are detailed further in the present specification.

Poly-nucleic acid complexes comprising four nucleic acids

In some embodiments of a poly-nucleic acid complex described herein, the said complex comprises four nucleic acids, each nucleic acid comprising a C-rich polynucleotide, i.e. a C-rich polynucleotide comprising a core region bordered at each of its 5'end and at its 3 'end by a side region, respectively. Accordingly, the two side regions comprised in a given C-rich polynucleotide of the poly-nucleic acid complex are unable to self-assemble through base-pairing.

According to these embodiments, a poly-nucleic acid complex comprises four nucleic acids, each nucleic acid comprising one C-rich polynucleotide, wherein each C-rich polynucleotide comprises a core region bordered by a 5 'end-side region and a 3 'end-side region, and (i) wherein the 3 'end side region of a first C-rich polynucleotide has a sequence complementary to a 5'end side region of a second C-rich polynucleotide and (ii) wherein the 5'end side region of the said first C- rich polynucleotide has a sequence complementary to a 3 'end side region of a third C-rich polynucleotide, so as each C-rich polynucleotide of the poly-nucleic acid complex has its 5'end side region and its 3 'end side region engaged in an antiparallel duplex structure with the 3 'end side region and the 5'end side region, respectively, of other C-rich polynucleotides, which antiparallel duplex structures locate the respective core regions in proximity one to the others. Thus, in such a poly-nucleic acid complex, a given C-rich polynucleotide is associated through antiparallel duplexes with two other C-rich polynucleotides among the set of four C-rich polynucleotides comprised in the said complex. As it is easily understood, the spatial neighboring of the four core regions within the poly-nucleic acid complex permits the formation of a four-stranded structure between the cytosine-bearing nucleotides (i.e. the formation of a C-quadruplex structure in appropriate pH conditions. An embodiment of such a poly-nucleic complex is represented in Figure 1. In some embodiments, a poly-nucleic acid complex as described herein, the said poly- nucleic acid complex forms quadraplexes between the cytosine-bearing nucleotides (or cytosine analog-bearing nucleotides) of the oligonucleotides comprised in the group of [CYT]_W, [CYT]_X; [CYT]_y and [CYT]_Z at a known pH value, and wherein the said known pH value is predetermined by the value of each of the integers selected in the group consisting of w, x, y and z.

In some embodiments, a poly-nucleic acid complex as described herein forms quadraplexes between the cytosine-bearing nucleotides (or the cytosine analog-bearing nucleotides) of the oligonucleotides comprised in the group of [CYT]_W, [CYT]_X; [CYT]_{y and} [CYT]_Z at a pH value of 6.5 or more, and, in certain embodiments thereof, at a pH value of 7.0 or more.

In some embodiments of a poly-nucleic acid complex comprising four nucleic acids, the said poly-nucleic acid may be selected in a group comprising :

a) a poly-nucleic acid complex comprising the polynucleotides below, wherein the core region comprises five cytosine-bearing nucleotides :

TATGCACACGCGATCCCCCTATTTGCTAGCGCA [SEQ ID NO. 1],

TCTGGTACGGCTTTCCCCCTTCGCGTGTGCATA [SEQ ID NO. 2],

TCGATGCTCGCGATCCCCCTAAGCCGTACCAGA [SEQ ID NO. 3], and

TGCGCTAGCAAATTCCCCCTTCGCGAGCATCGA [SEQ ID NO. 4], b) a poly-nucleic acid complex comprising the polynucleotides below, wherein the core region comprises four cytosine-bearing nucleotides :

TATGCACACGCGATCCCCTATTTGCTAGCGCA [SEQ ID NO. 5],

TCTGGTACGGCTTTCCCCTTCGCGTGTGCATA [SEQ ID NO. 6],

TCGATGCTCGCGATCCCCTAAGCCGTACCAGA [SEQ ID NO. 7], and

TGCGCTAGCAAATTCCCCTTCGCGAGCATCGA [SEQ ID NO. 8], c) a poly-nucleic acid complex comprising the polynucleotides below, wherein the core region comprises three cytosine-bearing nucleotides :

TATGCACACGCGATCCCTATTTGCTAGCGCA [SEQ ID NO. 9],

TCTGGTACGGCTTTCCCTTCGCGTGTGCATA [SEQ ID NO. 10],

TCGATGCTCGCGATCCCTAAGCCGTACCAGA [SEQ ID NO. 11 ], and

TGCGCTAGCAAATTCCCTTCGCGAGCATCGA [SEQ ID NO. 12], d) a poly-nucleic acid complex comprising the polynucleotides below, wherein the core region comprises two cytosine-bearing nucleotides :

TATGCACACGCGATCCTATTTGCTAGCGCA [SEQ ID NO. 13], TCTGGTACGGCTTTCCTTCGCGTGTGCATA [SEQ ID NO. 14],

TCGATGCTCGCGATCCTAAGCCGTACCAGA [SEQ ID NO. 15], and

TGCGCTAGCAAATTCCTTCGCGAGCATCGA [SEQ ID NO. 16], e) a poly-nucleic acid complex comprising the polynucleotides below, wherein the core region comprises seven cytosine-bearing nucleotides :

TATGCACACGCGATCCCCCCCTATTTGCTAGCGCA [SEQ ID NO. 17],

TCTGGTACGGCTTTCCCCCCCTTCGCGTGTGCATA [SEQ ID NO. 18],

TCGATGCTCGCGATCCCCCCCTAAGCCGTACCAGA [SEQ ID NO. 19], and

TGCGCTAGCAAATTCCCCCCCTTCGCGAGCATCGA [SEQ ID NO. 20], f) a poly-nucleic acid complex comprising the polynucleotides below, wherein the core region comprises nine cytosine-bearing nucleotides :

TATGCACACGCGATCCCCCCCCCTATTTGCTAGCGCA [SEQ ID NO. 21],

TCTGGTACGGCTTTCCCCCCCCCTTCGCGTGTGCATA [SEQ ID NO. 22],

TCGATGCTCGCGATCCCCCCCCCTAAGCCGTACCAGA [SEQ ID NO. 23], and

TGCGCTAGCAAATTCCCCCCCCCTTCGCGAGCATCGA [SEQ ID NO. 24], g) a poly-nucleic acid complex comprising the polynucleotides below, wherein the core region of a first set of two polynucleotides comprises two cytosine-bearing nucleotides and the core region of a second set of two polynucleotides comprises three cytosine-bearing nucleotides:

TATGCACACGCGATCCTATTTGCTAGCGCA [SEQ ID NO. 13],

TCTGGTACGGCTTTCCCTTCGCGTGTGCATA [SEQ ID NO. 10],

TCGATGCTCGCGATCCTAAGCCGTACCAGA [SEQ ID NO. 15], and

TGCGCTAGCAAATTCCCTTCGCGAGCATCGA [SEQ ID NO. 12], and

h) a poly-nucleic acid complex comprising the polynucleotides below, wherein the core region comprises five cytosine-bearing nucleotides :

GCACACGCGATCCCCCTATTTGCTAGC [SEQ ID NO. 25],

GGTACGGCTTTCCCCCTTCGCGTGTGC [SEQ ID NO. 26],

ATGCTCGCGATCCCCCTAAGCCGTACC [SEQ ID NO. 27], and

GCTAGCAAATTCCCCCTTCGCGAGCAT [SEQ ID NO. 28]. Poly-nucleic acid complexes comprising three nucleic acids In those embodiments, a poly-nucleic acid complex comprises (i) one nucleic acid comprising two C-rich polynucleotides selected in a group comprising (OLIGOl), (OLIG02), (OLIG03) and (OLIG04) and (ii) two nucleic acids each comprising another C-rich polynucleotide selected in a group comprising (OLIGOl), (OLIG02), (OLIG03) and (OLIG04), so as the resulting poly-nucleic acid complex comprises one exemplary of each of the C-rich polynucleotides selected in a group comprising (OLIGOl), (OLIG02), (OLIG03) and (OLIG04).

In those embodiments also, none of the nucleic acids comprised in the poly-nucleic acid complex does contain any self-complementary nucleotide sequences.

An illustration of such a poly-nucleic acid complex is a poly-nucleic acid complex wherein :

- a first nucleic acid comprises the two C-rich polynucleotides (OLIGOl) and (OLIG02),

- a second nucleic acid comprises the C-rich polynucleotide (OLIG03), and

- a third nucleic acid comprises the C-rich polynucleotide (OLIG04).

According to this illustration, (OLIGOl) and (OLIG02) are both comprised in the first nucleic acid and are separated by a "spacer" nucleotide sequence of a length sufficient for ensuring a flexible positioning of OLIGOl and OLIG02 within the resulting poly-nucleic acid complex. The said spacer nucleotide sequence has advantageously a nucleotide length of 4 nucleotides or more, and preferably a nucleotide length of 20 nucleotides or more.

In these embodiments, the first nucleic acid may be a nucleic of the following formula :

(OLIG02)-[SPAC]-(OLIG04), wherein :

- OLIG02 means [5'0LIG02]-[CYT]_X-[3'0LIG02],

- OLIG04 means [5'0LIG04]-[CYT]_Z-[3'0LIG04]

with

- [5OLIG02], [CYT]_X, [3OLIG02], [5OLIG04], [CYT]_Z, [3OLIG04] having the same meaning as specified elsewhere in the present specification, and

- [SPAC] means a nucleotide sequence having a nucleotide length of 4 nucleotides or more, preferably of 20 nucleotides or more.

In these embodiments, the resulting poly-nucleic acid complex comprises : - a first nucleic acid of the formula

[5 ' OLIG02] - [CYT]_X- [3 ' OLIG02] - [SPAC] - [5 OLIG04] - [CYT]_Z- [3 OLIG04] , with

- [SPAC] means a nucleotide sequence having a nucleotide length of 10 nucleotides or more, preferably of 20 nucleotides or more, - a second nucleic acid of the formula [5 OLIGOI ]-[CYT]_w-[3 OLIGOI],

with [5 OLIGOI], [CYT]_W and [3 OLIGOI] having the same meaning as specified elsewhere in the present specification,

- a third nucleic acid of the formula [5'0LIG03]-[CYT]_y-[3'0LIG03]

with [5OLIG03], [CYT]_y and [3OLIG03] having the same meaning as specified elsewhere in the present specification,

and wherein :

- [5 OLIGOI] comprises a sequence complementary to a sequence comprised in [3OLIG02],

- [3 OLIGOI] comprises a sequence complementary to a sequence comprised in [5OLIG04], - [5OLIG03] comprises a sequence complementary to a sequence comprised in [3OLIG04], and

- [3OLIG03] comprises a sequence complementary to a sequence comprised in [5OLIG02]

Poly-nucleic acid complexes comprising two nucleic acids

In those embodiments, a poly-nucleic acid complex comprises two nucleic acids each comprising two C-rich polynucleotides selected in a group comprising (OLIGOI), (OLIG02), (OLIG03) and (OLIG04), so as the resulting poly-nucleic acid complex comprises one exemplary of each of the C-rich polynucleotides selected in a group comprising (OLIGOI), (OLIG02), (OLIG03) and (OLIG04).

- a first nucleic acid comprises the two C-rich polynucleotides (OLIG02) and (OLIG04), and - a second nucleic acid comprises the two C-rich polynucleotides (OLIG03) and (OLIGOI).

According to this illustration, (OLIG02) and (OLIG04) are both comprised in the first nucleic acid and are separated by a spacer nucleotide sequence of a length sufficient for ensuring a flexible positioning of (OLIG02) and (OLIG04) within the resulting poly-nucleic acid complex. Similarly, (OLIG03) and (OLIGOI) are both comprised in the first nucleic acid and are separated by a spacer nucleotide sequence of a length sufficient for ensuring a flexible positioning of (OLIG03) and (OLIGOI) within the resulting poly-nucleic acid complex. The said spacer nucleotide sequence has advantageously a nucleotide length of 4 nucleotides or more, and preferably a nucleotide length of 20 nucleotides or more.

In these embodiments, the resulting poly-nucleic acid complex comprises : - a first nucleic acid of the formula [5 ' OLIG02] - [CYT]_X- [3 ' OLIG02] - [SPAC] - [5 OLIG04] - [CYT]_Z- [3 OLIG04] , with

- [SPAC] means a nucleotide sequence having a nucleotide length of 4 nucleotides or more, which encompasses of 20 nucleotides or more,

- a second nucleic acid of the formula

[5 ' OLIG03 ] - [CYT]_y- [3 'OLIG03 ] - [SPAC] - [5 ' OLIGO 1 ] - [CYT] _w- [3 'OLIGO 1 ] , with

- [5OLIG03], [CYT]_y, [3OLIG03], [5'OLIGOl], [CYT]_W, [3'OLIGOl] having the same meaning as specified elsewhere in the present specification, and

- [SPAC] means a nucleotide sequence having a nucleotide length of 4 nucleotides or more, preferably of 20 nucleotides or more,

and wherein :

- [5 OLIGO 1] comprises a sequence complementary to a sequence comprised in [3OLIG02],

- [3 OLIGO 1] comprises a sequence complementary to a sequence comprised in [5OLIG04], - [5OLIG03] comprises a sequence complementary to a sequence comprised in [3OLIG04], and

The ability of the cytosine (or cytosine analog)-containing core regions of a nucleic acid complex to associate and dissociate at controlled pH values may be used for a large number of technical applications, some of them being illustrated hereunder.

Detectable pH-responsive poly-nucleic acid complex

A conformational change of a poly-nucleic acid complex as described herein may be determined by a variety of methods well known in the art. These methods include, but are not limited to, circular dichroism (CD), UV absorbance spectroscopy, Nuclear Magnetic Resonance spectroscopy (NMR), microcalorimetry (ITC or DSC), Surface Plasmon resonance (SPR) and fluorescence measurement.

In some embodiments, a poly-nucleic acid complex according to the invention may be labeled by a detectable substance, which includes reporter groups, irrespective of whether these reporter groups (i) are part of the nucleic acid, such as fluorescent nucleobase analogs, e.g. fluorescent guanine residues, (ii) are covalently linked to a nucleic acid comprised in the said poly- nucleic acid complex or whether (iii) these reporter groups are simply associated through a non- covalent linkage to the said poly-nucleic acid. In some embodiments of a poly-nucleic acid complex as described herein, the said complex is further complexed with a detectable molecule. In certain of these embodiments, the said detectable molecule is a specific i-motif ligand.

In some embodiments of a poly-nucleic acid complex as described herein, one or more of the nucleic acids contained therein is labeled with a detectable molecule.

In some embodiments of a poly-nucleic acid complex as described herein, one or more of the nucleic acids contained therein is fluorescently labeled.

As used herein, "reporter groups" encompass groups that make a nucleic acid distinguishable from the remainder of a liquid, i.e. the sample (nucleic acids having attached a reporter group can also be termed labelled nucleic acids). The term "reporter group" and the specific embodiments preferably include a linker which is used to connect the moiety to the reporter group. The linker will provide flexibility such that the presence of one or more reporter groups in a poly-nucleic acid complex according to the invention does not affect the folding properties of the core regions of the C-rich polynucleotides comprised therein. Linkers, especially those that are not hydrophobic, for example based on consecutive ethylenoxy units, are known to person skilled in the art.

As used herein, the term "fluorescent nucleobase analogs" intended to mean a nucleobase analog that is fluorescent. While it is possible that the fluorescent nucleobase analog participate in nucleobase pairing, such participation is not required.

Thus, any of the numerous fluorescent nucleobase analogs known in the art to be useful in duplex, triplex or quadruplex structures can be used in a nucleic acid comprised in a poly- nucleic acid complex of the invention.

Examples of such fluorescent nucleobases include pyrene, 2-amino purine, and pteridine derivatives. On particularly preferred fluorescent nucleobase is 6-methyl-8-(2-deoxy-p-D- ribofuranosyl) isoxanthopterin ("6MI"), commercially available form TRI-LINK, San Diego, CA. Examples of further fluorescent nucleobases will be apparent to those of skill in the art.

Thus, in some embodiments, one or more of the nucleic acids comprised in a poly- nucleic acid complex according to the invention can be modified at the core regions with a reporter group which is used for a detection protocol.

While as many reporter groups can be attached as useful to appropriately label a nucleic acid of a poly-nucleic acid complex according to the invention, it is preferred to attach only a limited number of reporter groups to a single nucleic acid. This is to ensure that the presence of the reporter groups will not affect properties of the poly-nucleic acid complex, mainly will not affect the pH-responsiveness of the poly-nucleic acid complex, and that its solubility will not be affected in such a manner that the poly-nucleic acid will not be able to form the expected i-motif structure or any expected i-motif related structure, at the expected pH conditions. In some embodiments, there will be only 1 to 4, most preferably 1 or 2 or most preferred a single reporter group in each poly-nucleic acid complex. There are formats for the determination of nucleic acids which require more than one reporter group attached to a probe. In some embodiments, one of the reporter groups is a fluorescence quencher. Fluorescence quenching occurs when the fluorescent group and the fluorescence quencher are in close proximity to each other. Fluorescence occurs only when the fluorescence quencher and a fluorescent group (as the reporter group) are separated.

Directly detectable reporter groups are for example fluorescent groups, such as but not limited to, fluorescein and its derivatives, like hexachlorofluorescein and hexafluorofluorescein, rhodamines, psoralens, squaraines, porphyrines, fluorescent particles, quantum dots, bioluminescent compounds, like acridinium esters and luminol, or the cyanine dyes, like Cy-5 or Cy-3.

Further, spin labels like TEMPO, electrochemically detectably groups, ferrocene, viologene, heavy metal chelates and electrochemilummescent labels, like ruthenium bispyridyl complexes, and naphthoquinones, quencher dyes, like dabcyl, and nuclease active complexes, for example of Fe and Cu, are useful detectable groups. Other examples of such compounds are europium complexes.

Indirectly detectable reporter groups are reporter groups that can be recognized by another moiety which is directly or indirectly labelled. Examples of such indirectly detectable reporter groups include but are not limited to haptens, like digoxigenin which is detectable by means of ELISA or biotin. Digoxigenin for example can be recognized by antibodies against digoxigenin. Those antibodies may either be labelled directly or can be recognized by labelled antibodies directed against the (digoxigenin) antibodies. Biotin can be recognized by avidin and similar compounds, like streptavidin and other biotin binding compounds. Again, those compounds can be labelled directly or indirectly. Further interesting labels are those directly detectable by atomic force microscopy (AFM) or scanning tunnelling microscopy (STM).

A reporter group can further be a nucleotide sequence which does not interfere with other nucleotide sequences in the sample. The sample can therefore be specifically recognized by oligonucleotides of a complementary sequence. This nucleotide sequence can therefore be labelled directly or indirectly or can be immobilizable or immobilized.

A reporter group can further be a solid phase. Nanoparticles are included in the definition of the solid phase. Attachment one or more of the nucleic acids comprised in a poly- nucleic acid complex according to the invention with a solid phase can be either directly or indirectly as discussed above for the detectable group. Examples of such solid phases include but are not limited to sensor chips, latex beads or preferred nanoparticles such as gold nanoparticles. Solid phases that are useful for the immobilization of the probe according to the invention are selected from the group of polystyrene, polyethylene, polypropylene, glass, S1O₂ and T1O₂. The formats of such solid phases can be selected according to the needs of the instrumentation and format of the assay.

In some embodiments, a reporter group attached to one or more nucleic acids comprised in a poly-nucleic acid complex according to the invention may be any positively or negatively charged group. Examples of such positively or negatively charged groups include a carboxylate group.

A reporter group can further be a nucleic acid ligand such as a minor groove binder or an intercalator such as ethidium bromide, acridinium esters or actinomycin. Typical intercalating and cross-linking residues which bind to bioconjugates and/or nucleic acid binding compounds or intercalate with them and/or cleave or cross-link them, are for example, acridine, psoralen, phenanthridine, naphthoquinone, daunomycin or chloroethylaminoaryl conjugates.

Methods and tools making use of a poly-nucleic acid complex

As described in detail throughout the present specification, including in the examples herein, a poly-nucleic acid complex has the ability to form a C-quadruplex structure between the core regions of the C-rich polynucleotides, in appropriate pH conditions.

As also described elsewhere herein, the appropriate pH conditions in which a C- quadruplex structure is formed in a poly-nucleic acid complex may be determined by advance, since the said pH conditions depend upon the number of cytosine residues, or cytosine analog residues, comprised in the core regions of the C-rich polynucleotides.

Importantly, with a poly-nucleic acid as described herein, a C-quadruplex structure may be formed at a determined pH value ranging from mild acidic conditions to mild basic conditions. As shown in the examples herein, depending on the number of cytosine residues or cytosine analog residues comprised in the core regions of the C-rich polynucleotides, a C- quadruplex structure may be formed at a pH value ranging from about 6 to about 8, notably from about 6.1 to about 7.5, such as from 6.15 to 7.40.

As it is known in the art, the association of the cytosine (or cytosine analogs) residues to form a C-quadruplex structure, or conversely the dissociation of a said C-quadruplex, generates conformational changes that may be easily detected, such as by circular dichroism (CD) or by UV spectroscopy, as shown in the examples herein.

Advantage may be taken of the pH-responsiveness of a poly-nucleic acid complex according to the invention for a large variety of technical uses, including (i) for preparing pH- responsive sensors (ii) for preparing pH-responsive compositions for a controlled release of substances of interest, typically for a controlled release of active substances of therapeutic interest (iii) for preparing pH-responsive surfaces or materials, such as hydrogels or matrices for chromatography. If incorporated in a gel, the pH-sensitive reversible non-covalent interactions occurring in the i-motif core would make this type of gelator network responsive to pH. Stimuli- responsive hydrogels are used as the building blocks of actuators and sensors. Such assemblies may find applications in various fields such as nanoscale electronics, sensors, valves, biomaterials, tissue engineering, microfluidics and drug delivery. In some applications the i-motif core regions assembly may be considered as a proton-sponge, capable of the release or uptake of an important number of protons as a result of modest pH-changes. These devices may cause changes in polarity of a chromatographic surface or be used as pH-controlled affinity ligands in chromatography.

For preparing pH-responsive sensors, the one skilled in the art may easily refer to the numerous publications that disclose the extensive use of the pH-dependent folding of i-motif forming DNA sequences, notably for preparing pH switches for applications in nanotechnology. Illustratively, the one skilled in the art may refer to the article of Dembska et al. (2015, Chemosensors, 3 : 211-223) which describes i-motif DNA-based fluorescent pH-sensitive probes.

Immobilization on a solid support

In some embodiments of assays for measuring the pH of a sample, the said sample is contacted with a one or more poly-nucleic acid complexes as described herein.

Contacting a sample to be tested with one or more poly-nucleic acid complexes according to the invention can be accomplished in a container, for example.

The contacting step may be performed in various ways, such as by oscillating a container, subjecting a container to a vortex generating apparatus, repeated mixing with a pipette or pipettes, or by passing a fluid sample over a surface having one or more poly-nucleic acid complexes of the invention immobilized thereon, for example.

The generic term "container" encompasses an environment that receives (i) the said one or more poly-nucleic acid complexes and (ii) the said sample to be tested, which includes, for example, microtiter plates (e. g., 96-well or 384-well plates), silicon chips having one or more poly-nucleic acid complexes of the invention immobilized thereon and optionally oriented in an array (e. g., described above and in U.S. Patent No.US 6,261,776), and microfluidic devices (e.g., described in U.S. Patent Nos. US 6,440,722; US 6,429,025; US 6,379,974; and US 6,316,781). A test system comprising such a container may include attendant equipment for carrying out a test assay, such as signal detectors, robotic platforms, and pipette dispensers. Thus, one or more poly-nucleic acid complexes according to the invention may be immobilized to a solid support. The attachment between an assay component and the solid support may be covalent or non-covalent (see, e.g., U. S. Patent No. US 6,022,688 for non-covalent attachments). The solid support may be one or more surfaces of a system, such as one or more surfaces in each well of a microtiter plate, a surface of a silicon wafer, a surface of a bead that is optionally linked to another solid support, or a channel in a microfluidic device, for example. Types of solid supports, linker molecules for covalent and non-covalent attachments to solid supports, and methods for immobilizing nucleic acids and other molecules to solid supports are known (see e.g. U. S. Patent Nos. US 6,261,776; US 5,900,481; US 6,133,436; and US 6,022,688; and PCT application No. WO 01/18234).

In some embodiments, one or more poly-nucleic acid complexes as described herein may be immobilized on a support consisting of nanoparticles.

In some embodiments, nanoparticles include but are not limited to metal nanoparticles, e.g. gold, silver, copper and platinum, bimetallic nanoparticles, e.g., Au@Ag, Au@Pt, semiconductor nanoparticles, e.g. CdSe, and CdS, or CdSe coated with ZnS, and magnetic nanoparticles, e.g. ferromagnetic. Other nanoparticles which can be used for the invention include, but are not limited to ZnS, ZnO, Ti0₂, Agl, AgBr, Hgl₂, PbS, PbSe, ZnTe, CdTe, In₂S₃, In₂Se₃, CdsP₂, CdsAs₂, InAs, and GaAs. The size of the nanoparticles is preferably from about 1 nm to about 250 nm (mean diameter), most preferably from about 2 to about 50 run. Also, nanoparticles made of latex, plastics, silica, quartz (wafer), glass, zeolite or any organic material are included in this invention. Additionally, nanoparticles coated with any organic or inorganic material are included. Rods, carbon nanotubes and other nanotubes, nanosheets, nanocubes, nanoplates, nanoprisms, graphene and graphene oxides may also be considered as nanoparticles. Methods for the preparations of the above mentioned nanoparticles are known to man skilled in the art and have been reported in literature.

In some embodiments, one or more poly-nucleic acid complexes of the invention are bound to a DNA origami or a gold nanoparticle. Colloidal gold nanoparticles have high extinction coefficients for the bands that are visible by the eye. These intense colors depend on particle size, concentration, inter-particle distance, state of aggregation and geometry of the aggregates. These properties make gold nanoparticles particularly attractive for colorimetric assays.

Compositions

In some embodiments, a poly-nucleic acid complex as described herein may be used for manufacturing controlled release compositions, which include controlled release pharmaceutical compositions. One or more pharmaceutically active agents may be captured by a poly-nucleic acid of the invention at a first pH value and the said one more pharmaceutically active agent may be released from the said poly-nucleic acid complex at a second pH value. Illustratively, one or more pharmaceutically active agents may be brought into contact with poly-nucleic acid molecules at a pH wherein the core regions of the C-rich polynucleotides are disassembled (e.g. at a pH of 5), and then incorporation of the said one or more pharmaceutically active ingredient is performed by increasing the pH and thus initiate formation of the C-quadruplex structure, whereby a controlled release pharmaceutical composition is prepared. Then, the said pharmaceutical composition will release the said one or more pharmaceutically active agents when the poly-nucleic acid complex contained therein will be placed at pH conditions wherein the formed C-quadruplex structure disassemble (e.g. at a pH of 5). Illustratively, such a pharmaceutical composition may be suitable for the release of pharmaceutically active ingredients in acidic conditions, e.g. in the stomach, or, at the sub-cellular level, in lysosomes. Further illustratively, the controlled release of the pharmaceutically active agents may be performed with compositions further comprising pH regulating systems.

Compositions comprising one or more poly-nucleic acid complexes as described herein may be prepared as a solution, emulsion, gel or poly-matrix-containing formulation (e.g., liposome and microsphere). Gels encompass pH-responsive hydrogels, which are kown per se in the art.

Examples of such compositions are set forth in U.S. Patent Nos. US 6,455,308, US

6,455,307, US 6,451,602, and US 6,451,538, and examples of liposomes also are described in U.S. Patent No. US 5,703,055. The compositions can be prepared for any mode of administration, including topical, oral, pulmonary, parenteral and intrathecal administration. Examples of compositions for particular modes of administration are set forth in U. S. Patent Nos. US 6,455,308, US 6,455,307, US 6,451, 602, and US 6,451,538. Such poly-nucleic acid complex- containing compositions may include one or more pharmaceutically acceptable carriers, excipients, penetration enhancers, and/or adjuncts.

Choosing the combination of pharmaceutically acceptable salts, carriers, excipients, penetration enhancers, and/or adjuncts in the composition depends in part upon the mode of administration.

A poly-nucleic acid complex-containing composition may be presented conveniently in unit dosage forms, which are prepared according to conventional techniques known in the pharmaceutical industry. In general terms, such techniques include bringing poly-nucleic acid complex molecules according to the invention into association with pharmaceutical carrier (s) and/or excipient (s) in liquid form or finely divided solid form, or both, and then shaping the product if required. The poly-nucleic acid complex-containing compositions may be formulated into any dosage form, such as tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions also may be formulated as suspensions in aqueous, non-aqueous, or mixed media.

Aqueous suspensions may further contain substances which increase viscosity, including for example, sodium carboxymethylcellulose, sorbitol, and/or dextran. The suspension may also contain one or more stabilizers.

Nanomachines

Nucleic acid-based i-motif structures have already been used in the art to design a molecular nano-machine or logic gate that is driven by pH changes, notably by using a quenched and a non-quenched state of a dye. Logic gates include logic circuit gates, such as those using H⁺ and Ag⁺ as inputs, since CC base pairs may also be formed in a metal-dependent manner.

By itself, a poly-nucleic acid complex as described in the present specification represents a proton fuelled nano-machine. Liedl and Simmel ("Switching the Conformation of a DNA molecule with a Chemical Oscillator", Nano Letters, 2005, 5, 1894-1898) have reported the use of the conformational changes of a cytosine-rich DNA strand between a random coil conformation and an i-motif structure and its possible use as a molecular device. According to Liedl (2005), the DNA strand used was attached to a dye (Alexa Fluor 488) or a quencher (BHQ-I) to allow detection of the conformational changes.

In an embodiment of this invention a poly-nucleic acid complex, or alternatively a system or a composition comprising one or more poly-nucleic acid complexes as described herein, may be used as a nano-machine and especially as pH-sensitive nanoscopic devices.

The core regions of the C-rich polynucleotides comprised in a poly-nucleic acid complex of the invention may behave as a pH-dependent switch (i) causing a reversible assembly of the said core regions in C-quadruplexes at an acidic pH, which includes a mildly acidic pH, to a basic pH, which includes a mildly basic pH, depending on the length of the cytosine residues (or cytosine analog residues) comprised in the core regions, and (ii) causing a disassembling of the said core regions under alkaline conditions.

Thus, the invention also relates to a pH-responsive device comprising one or more poly-nucleic acid complexes described herein.

This invention also concerns a device for detecting a pH value or responding to a pH change in a sample, comprising one or more poly-nucleic acid complexes described herein. A poly-nucleic acid complex according to the invention, notably in embodiments wherein the said complex is immobilized on a support, may be used as a pH-sensitive colorimetric sensor.

In some embodiments, the one or more poly-nucleic acid complexes are immobilized in a known order on a support, e.g. in an ordered array of poly-nucleic acid complexes, wherein the location of each poly-nucleic acid complex which stabilizes at a known pH value is predetermined. Then, subsequent to a step of contacting a sample with the said device, detection of a stabilization signal at a defined location(s) of the array allows determining the pH value of the tested sample.

This invention also relates to a method of measuring the pH value of a sample comprising the steps of :

a) bringing one or more nucleic acid complexes as described herein with a sample, and b) detecting a signal indicative of the formation of quadruplexes between the cytosine-bearing nucleotides of the oligonucleotides comprised in the group of [CYT]_W, [CYT]_X; [CYT]_{y wi} [CYT]_Z.

In some embodiments of the method, wherein the signal is detected at step b) with a method selected in a group comprising (i) circular dichroism (CD), (ii) UV absorbance or fluorescence spectroscopy, (iii) fluorescence measurement and (iv) nuclear magnetic resonance (NMR), (v) surface-enhanced Raman Spectroscopy (SERS).

This invention also relates to a method for providing a response to pH changes at the nanoscale level, which method makes use of (i) one or more poly-nucleic acid complexes as described herein or (ii) any device comprising one or more of the said poly-nucleic acid complexes. In some embodiments, such a method comprises the steps of a) a programmed conformational change, b) the release or update of a bioactive compound, c) the release or update of proton ions by the i-motif core, which behaves as a proton sponge, and d) the change of physico-chemical properties of a surface or material incorporating the device.

The present invention is further illustrated, without in any way being limited to, by the examples hereafter. EXAMPLES

A. Materials and Methods.

All oligonucleotides (listed in Table SI) were purchased from Eurogentec with the purification grade of RP-Cartridge-Gold. Berberine chloride was purchased from Sigma- Aldrich. A.l. Preparation of oligonucleotides. Samples of tetra-stranded DNA systems or duplexes were prepared at the concentration of 30 μΜ in 50 mM Tris-acetate buffer containing 100 mM KC1 and 10 mM MgCl₂ (pH 7.80). These samples were heated at 87 °C for 10 min, and then slowly cooled down to room temperature. The DNA samples were stored overnight at 4 °C.

A.2. Circular dichroism (CD) spectroscopy. CD spectra were performed on a Jasco J-815 spectropolarimeter equipped with a Peltier temperature control accessory. Each spectrum was monitored at 15 °C and obtained by averaging three scans at the scan speed of 100 nm/min. The background of the corresponding buffer was subtracted from the average spectrum for each sample. The CD intensities at 288 nm were transformed into folded fractions at different pH values, which were fitted into sigmoid curves by Boltzmann equation. Samples were prepared by diluting as- prepared DNA samples by 30-times using 50 mM Tris-acetate buffer (containing 100 mM KC1 and 10 mM MgCy at different pHs. Each sample was incubated overnight at 4 °C before starting measurements.

Kinetic experiments were carried out by employing 1 μΜ C5 in a volume of 600 μΕ. The pH value was adjusted by adding concentrated HC1 or LiOH solution. CD signal was monitored at 288 nm immediately after pH-adjustments.

A.3. UV-vis spectroscopy. UV-vis spectra were carried out on a SAFAS spectrophotometer at 15 °C. Thermal denaturation profiles were monitored from 5 to 95 °C with the heating rate of 0.5 °C/min. Each sample was prepared as the same procedure described in the CD experiments.

A.4. Fluorescence single-wavelength measurement. Berberine tests were performed in 96-well plates (Greiner, Flat Bottom Black Polystyrol) in a volume of 30 μΕ. The excitation wavelength was fixed at 350 nm for berberine, and the emission intensity was collected at 530 nm. Each sample was prepared by mixing 2 μΜ berberine and 1 μΜ tetra-stranded DNA at different pH.

A.5. Size-exclusion HPLC (SE-HPLC). Samples were prepared at 15 μΜ and 10 μΕ were injected on a UltiMate 3000 UHPLC system (Thermo Scientific Dionex, Sunnyvale, CA, USA), equipped with an autosampler, a diode array detector and a Thermo Acclaim SEC-300 column (4.6x300 mm; 5-μιη hydrophilic polymethacrylate resin spherical particles, 300 A pore size). Elution of oligonucleotides was performed at 0.15 mL/min in TAE buffer (40 mM Tris-acetate and 1 mM EDTA, pH 8.3, purchased from Sigma-Aldrich) supplemented with 12.5 mM MgCl₂, with a column temperature of 20°C. A.6. Nuclear magnetic resonance (NMR). One- dimensional ^lH NMR experiments were performed on a Broker Avance 700 MHz spectrometer equipped with a liquid TXI 1H/13C/15N/2H, with Z-gradient probe. The NMR samples were prepared in in KH₂PO₄- H₃PO₄ buffer adjusted to different pH and the oligonucleotides were usually at concentrations ranging from 0.2 to 0.5 mM and transferred to 3 mm diameter NMR tube containing 10%D₂O. Standard ID proton NMR spectra were recorded with a sweep width of 32 ppm and a size of 32 K points. Excitation sculpting was used for water suppression in standard ID spectra acquisition. The data processing was carried out by using Topspin version 3.2 and further analysed with MestReNova.

Table 1. Oligonucleotides used for the formation of tetramolecular DNA structures

System Name SEQ ID NO. Sequence (from 5' to 3')

A-C5-Dp Ϊ TATGCACACGCGATCCCCCTATTTGCTAGCGCA

C5 B-C5-Ap 2 TCTGGTACGGCTTTCCCCCTTCGCGTGTGCATA

C-C5-Bp 3 TCGATGCTCGCGATCCCCCTAAGCCGTACCAGA

D-C5-Cp 4 TGCGCTAGCAAATTCCCCCTTCGCGAGCATCGA

A-C4-Dp 5 TATGCACACGCGATCCCCTATTTGCTAGCGCA

C4 B-C4-Ap 6 TCTGGTACGGCTTTCCCCTTCGCGTGTGCATA

C-C4-Bp 7 TCGATGCTCGCGATCCCCTAAGCCGTACCAGA

D-C4-Cp 8 TGCGCTAGCAAATTCCCCTTCGCGAGCATCGA

A-C3-Dp 9 TATGCACACGCGATCCCTATTTGCTAGCGCA

C3 B-C3-Ap 10 TCTGGTACGGCTTTCCCTTCGCGTGTGCATA

C-C3-Bp 11 TCGATGCTCGCGATCCCTAAGCCGTACCAGA

D-C3-Cp 12 TGCGCTAGCAAATTCCCTTCGCGAGCATCGA

A-C2-Dp 13 TATGCACACGCGATCCTATTTGCTAGCGCA

C2 B-C2-Ap 14 TCTGGTACGGCTTTCCTTCGCGTGTGCATA

C-C2-Bp 15 TCGATGCTCGCGATCCTAAGCCGTACCAGA

D-C2-Cp 16 TGCGCTAGCAAATTCCTTCGCGAGCATCGA

A-C7-Dp 17 TATGCACACGCGATCCCCCCCTATTTGCTAGCGCA

C7 B-C7-Ap 18 TCTGGTACGGCTTTCCCCCCCTTCGCGTGTGCATA

C-C7-Bp 19 TCGATGCTCGCGATCCCCCCCTAAGCCGTACCAGA

D-C7-Cp 20 TGCGCTAGCAAATTCCCCCCCTTCGCGAGCATCGA

A-C9-Dp 21 TATGCACACGCGATCCCCCCCCCTATTTGCTAGCGCA

C9 B-C9-Ap 22 TCTGGTACGGCTTTCCCCCCCCCTTCGCGTGTGCATA

C-C9-Bp 23 TCGATGCTCGCGATCCCCCCCCCTAAGCCGTACCAGA

D-C9-Cp 24 TGCGCTAGCAAATTCCCCCCCCCTTCGCGAGCATCGA System Name SEQ ID NO. Sequence (from 5' to 3')

A-C2-Dp 13 TATGCACACGCGATCCTATTTGCTAGCGCA

C2.5 B-C3-Ap 10 TCTGGTACGGCTTTCCCTTCGCGTGTGCATA

C-C2-Bp 15 TCGATGCTCGCGATCCTAAGCCGTACCAGA

D-C3-Cp 12 TGCGCTAGCAAATTCCCTTCGCGAGCATCGA

A(i ob_P)-C5 -Dp(iobp) 25 GCACACGCGATCCCCCTATTTGCTAGC

C5- B(i ob_P)-C5 - A (!obp) 26 GGTACGGCTTTCCCCCTTCGCGTGTGC dx(iobp) C(i ob_P)-C5 -B (i obp) 27 ATGCTCGCGATCCCCCTAAGCCGTACC

D(i ob_P)-C5 -Cp(iobp) 28 GCTAGCAAATTCCCCCTTCGCGAGCAT

A-TCTCT-Dp 29 TATGCACACGCGATTCTCTTATTTGCTAGCGCA

MutTC B-TCTCT-Ap 30 TCTGGTACGGCTTTTCTCTTTCGCGTGTGCATA

C-TCTCT-Bp 31 TCGATGCTCGCGATTCTCTTAAGCCGTACCAGA

D-TCTCT-Cp 32 TGCGCTAGCAAATTTCTCTTTCGCGAGCATCGA

A-T5-Dp 33 TATGCACACGCGATTTTTTTATTTGCTAGCGCA

MutT5 B-T5-Ap 34 TCTGGTACGGCTTTTTTTTTTCGCGTGTGCATA

C-T5-Bp 35 TCGATGCTCGCGATTTTTTTAAGCCGTACCAGA

D-T5-Cp 36 TGCGCTAGCAAATTTTTTTTTCGCGAGCATCGA ssl 37 GCACACGCGA ss2 38 GGTACGGCTT ss3 39 ATGCTCGCGA

Duplex ss4 40 GCTAGCAAAT

ss5 41 ATTTGCTAGC ss6 42 TCGCGTGTGC ss7 43 AAGCCGTACC ss8 44 TCGCGAGCAT

TC5 TC5 45 TCCCCC

Table 2. T_m of different systems derived from UV melting profiles at 295 nm

System pH T_m (°C) System pH T_m (°C)

7.53 20.6±0.7 7.08 24.7±0.3

C5 7.40 30.5±1.2 C3 6.79 37.2±0.5

7.08 47.6±0.3 6.51 42.8±0.7

6.79 52.9±0.4 6.37 45.5±0.9

7.40 18.7±0.4 6.51 15.7±0.1

C4 7.08 39.7±0.6 C2 6.37 22.5±0.5 System pH T_m (°C) System pH T_m (°C)

6.79 48.8±0.3 6.15 30.6±1.8

6.51 51.7±0.2 5.79 40.5±0.7

6.79 17.2±0.8

C2.5 6.51 27.8±0.2

6.37 30.8±0.5

6.15 35.9±0.7

Example 1 : Construction of poly-nucleotide complexes

It has been constructed five i-motif-forming systems composed by four DNA strands each containing a central core of 2-9 cytosines (sequences are listed in Table 1). The rationale was to utilize Watson-Crick duplexes to orientate the corresponding four C-stretches close together in an antiparallel manner (as illustrated in Figure 1).

The four DNA strands of each system assembled into a tetra-stranded structure at mild basic conditions, confirmed by SE-HPLC analysis (Figure 2). When the pH of the solution was reduced, the four C-rich moieties present in the core of this supramolecular assembly, are allowed to form a stable i-motif. The conformational pH stability of this structure was found to be directly dependent on the length of the corresponding C-runs. An added bonus of this design is that it allows the assembly of "asymmetric" i-motifs, in which the two intercalated duplexes may differ in length by one C C⁺ base pair (see C2.5 below).

Several independent lines of evidence confirm that i-motif is present at the core of the assemblies including C5, C4, C3, C2.5 and C2. Figure 3a shows the pH-dependent CD spectra of C5 system. At pH 8.00, the tetra-molecular C5 system exhibits a positive band at 275 nm and a negative peak around 250 nm, corresponding to typical Watson-Crick duplexes. As the pH level decreases from 7.80 to 7.08, the positive CD band shows a gradual red-shift. By subtracting the spectrum at pH 8.00 (thus, a tetra-stranded structure without the presence of an i-motif) from that at pH 7.08 (thus, with an expected i-motif in the assembly-core), the spectrum displays a positive band at 288 nm and a negative peak at 265 nm (see the inset of Figure 3a), which are close to the characteristic CD bands of i-motif conformation.

By transforming the CD data into the folded fractions at different pH, the apparent pH transitional midpoint (pH^T) was found to be pH 7.4, very close to or even higher than physiological pH (Figure 3b). In comparison, the d(TC₅) short oligonucleotide (i.e., without the guide duplexes), did not show characteristic band of i-motif even at pH 6.37 (Figure 4). This sequence, which was previously reported to form tetra-stranded i-motif, possesses a pH^T of 5.7. The presence of the duplex guide strands therefore led to remarkable shift in pH^T of 1.7 pH units.

The other systems considered in this study exhibited similar trends, with a pH^T found at 7.2 for C4, 7.0 for C3, 6.7 for C2.5 and 6.4 for C2, respectively (Figure 3b and Figure 5). Additionally, CD studies also confirmed that all pH-induced conformational transitions of all the systems presented here were achieved rapidly (CD signals reached to equilibrium in an extremely short time-scale (Figure 6), in contrast with the strong hysteresis typically associated with i-motif at near neutral pH.

Thermal difference spectra (TDS) and UV melting analysis further revealed the presence of i- motif structures. Two control sequences derived from C5 but with the cental block of 5 cytosines mutated to T5 or TCTCT (herein referred to as MutT5 and MutTC), were employed to study the formation and the thermal stability of i-motif structure. For both MutT5 and MutTC at pH 7.40, UV melting profile monitored at 260 nm display single sigmoid transitions, with the transitional temperature (T_m) around 60 °C (Figure 7a and 7b). In contrast, two distinguishable transitions were observed for C5 system at the same pH, with a T_m of 31 °C and 60 °C respectively (Figure 8c). This suggested the existence of an extra secondary structural motif in addition to the Watson- Crick duplexes.

Thermal difference spectra (TDS) were recorded at pH 7.40 for C5, by subtracting the spectrum at 15 °C from that at 45 °C (1^st transition almost completed at this temperature (Figure 9a). The TDS of C5 depicted a negative peak around 295 nm as well as two positive ones at 260 nm and 240 nm respectively (Figure 8a), confirming the presence of an i-motif structure. In contrast, no negative band appeared around 295 nm in the TDS of MutT5 or MutTC, demonstrating that, at pH 7.40, the secondary structure only exists in the C5 system. Similarly, negative bands at 295 nm were also detected in the TDS for the other systems, including C4 at pH 7.08, C3 at pH 6.79, C2.5 at pH 6.37 and C2 at 6.15 (Figure 8b).

A series of UV melting analysis were carried out at UV 295 nm for all five systems at different pH values (listed in Table 2). All the systems display single transition phases from 5 to 55 °C (Figure 9a), without significant interference from the melting process of duplexes (Figure 10). The T_m value was calculated as 30.5 °C for C5 at pH 7.40, 39.7 °C for C4 at pH 7.08, 37.2 °C for C3 at pH 6.79, 30.8 °C for C2.5 at pH 6.37 and 30.6 °C for C2 at pH 6.15. In the case of C5 system, the T_m increases from 20.6 °C to 52.9 °C as pH decreases from 7.53 to 6.79. Such highly pH-dependent structures were also detected in other systems (Figure 9b). To directly disclose the formation of i-motif structure, thermal denaturation experiments of C5 at slightly acidic pH were performed by using ID NMR spectroscopy. As expected, the spectrum at 15 °C evidences the formation of Watson-Crick base pairs (12-15 ppm) and C C⁺ base pairs (15-16 ppm), indicating the coexistence of duplex and i-motif (Figure 11). Additionally, these two parts were completely melted at 77 °C.

Example 2 : Measuring pH of a sample with a poly-nucleic acid complex

To provide an easy readout for i-motif formation, a fluorescent i-motif probe was tested. Recent reports have shown that berberine is capable of generating a turn-on response to an i-motif against a duplex or a single-stranded DNA. Therefore, it can be considered as a new class of fluorescent indicator to detect i-motif structure. As shown in Figure 12, fluorescence intensity of berberine in the presence of C5 system increasesas the pH is reduced from 7.80 to 7.08, and then reaches to a plateau when the pH is below 7. Fluorescence emission of berberine was proved to be insensitive to pH changes, as well as to the presence of duplex DNA (Figure 13). Therefore, it is reasonable to deduce that the fluorescence turn-on is originated from the selective interactions between berberine and i-motif. The five systems considered in this study showed similarly pH- dependent fluorescence emission, with a distinct pH^T of 7.4 for C5, 7.2 for C4, 6.9 for C3, 6.6 for C2.5 and 6.2 for C2, respectively. Further, two more systems (C7 and C9) were employed to disclose the influence of the length of C-stretches on the pH^T. Interestingly, a pH^T was found to be 7.5 for both C7 and C9 (Figure 14), showing that the pH^T reached to a plateau as the number of cytosines was above 7.

In summary, it is disclosed herein a new concept to guide the assembly of tetra-stranded i- motif structures at physiological pH. We demonstrate that, for the first time, thermally stable tetra- stranded i-motif can form at neutral pH. The transitional midpoints of guided i-motif structures can be easily tuned by changing the length of C-rich stretches. The guided i-motif systems exhibit pH- dependent interactions with berberine. This study paves a way to control the assembly of multi- stranded DNA nanostructures; the current architecture allows the design of a fast pH-responsive sensor acting now in a physiological pH range, and which fine pH-sensitivity may be finely tuned by minimal changes in the primary sequence. This motif could be of interest for DNA-based pH- sensors and devices.

Claims

1. A poly-nucleic acid complex comprising four distinct C-rich polynucleotides, wherein

2. The poly-nucleic acid complex according to claim 1, wherein a core region comprises a number of cytosine-bearing or cytosine analog- bearing nucleotides ranging from 2 to 10.

3. The poly-nucleic acid complex according to any one of claims 1 and 2, which comprises four nucleic acids, each nucleic acid comprising one C-rich polynucleotide.

4. The poly-nucleic acid complex according to any one of claims 1 to 3, wherein each oligonucleotide side region has, one independently from each other, a nucleotide length of 5 nucleotides or more, preferably 10 nucleotides or more.

5. The poly-nucleic acid complex according to any one of claims 1 to 4, comprising the following four distinct polynucleotides :

- [5'0LIG01]-[CYT]_W-[3'0LIG01], of formula (OLIGOl),

- [5 ' OLIG02] - [CYT]_X- [3 OLIG02] , of formula (OLIGO 2),

- [5'0LIG03]-[CYT]_y-[3'0LIG03], of formula (OLIGO 3), and

- [5'0LIG04]-[CYT]_Z-[3'0LIG04], of formula (OLIGO 4),

wherein :

- [5'OLIGO] is an oligonucleotide side region located at the 5'-end of a [CYT] region of a polynucleotide selected in the group consisting of (OLIGOl), (OLIG02), (OLIG03) and (OLIG04X - [3'OLIGO] is an oligonucleotide side region located at the 3 '-end of [CYT] region of a polynucleotide selected in the group consisting of (OLIGOl), (OLIG02), (OLIG03) and (OLIG04X

and

- each of [5'OLIGO] of a polynucleotide selected in the group consisting of (OLIGOl),

(OLIG02), (OLIG03) and (OLIG04) has a sequence complementary to a [3'OLIGO] of another polynucleotide selected in the group consisting of (OLIGOl), (OLIG02), (OLIG03) and (OLIG04).

6. The poly-nucleic acid complex according to claim 5, wherein w, x, y and z are all of the same value, the said value ranging from 2 to 10.

7. The poly-nucleic acid complex according to claim 5, wherein two integers selected in the group consisting of w, x, y and z have an identical first value and the two other integers in the said group have an identical second value, with a difference between the first and second value being of 2 or less.

8. The poly-nucleic acid complex according to any one of claims 4 to 6, wherein (i) each of the [5'OLIGO] selected in the group consisting of [5'OLIGOl], [5OLIG02], [5OLIG03] and [5OLIG04] and (ii) each of [3'OLIGO] selected in the group consisting of [3 OLIGOl], [3OLIG02], [3OLIG03] and [3OLIG04] has a nucleotide length of 4 nucleotides or more, and preferably of 10 nucleotides or more.

9. The poly-nucleic acid complex according to any one of claims 4 to 8, wherein :

- [5 OLIGOl] has a sequence complementary to a sequence of [3OLIG02]

- [3 OLIGOl] has a sequence complementary to a sequence of [5OLIG04],

- [5OLIG02] has a sequence complementary to a sequence of [3OLIG03], and

- [5OLIG03] has a sequence complementary to a sequence of 3OLIG04],

10. The poly-nucleic acid complex according to any one of claims 1 to 9, wherein one or more of the nucleic acids contained therein is labeled with a detectable molecule.

11. The poly-nucleic acid according to any one of claim 1 to 10, which poly-nucleic acid forms quadruplexes between the cytosine-bearing nucleotides of the oligonucleotides comprised in the group of [CYT]_W, [CYT]_X; [CYT]_{y and} [CYT]_Z at a known pH value, and wherein the said known pH value is predetermined by the value of each of the integers selected in the group consisting of w, x, y and z.

12. The poly-nucleic acid according to any one of claims 1 to 11, which poly-nucleic acid forms quadraplexes between the cytosine-bearing nucleotides of the oligonucleotides comprised in the group of [CYT]_W, [CYT]_X; [CYT]_{y and} [CYT]_Z at a pH value of 6.5 or more.

13. The poly-nucleic acid according to any one of claims 1 to 12, which is selected in a group comprising: a) a poly-nucleic acid complex comprising the polynucleotides below :

TATGCACACGCGATCCCCCTATTTGCTAGCGCA [SEQ ID NO. 1],

TCTGGTACGGCTTTCCCCCTTCGCGTGTGCATA [SEQ ID NO. 2],

TCGATGCTCGCGATCCCCCTAAGCCGTACCAGA [SEQ ID NO. 3], and

TGCGCTAGCAAATTCCCCCTTCGCGAGCATCGA [SEQ ID NO. 4], b) a poly-nucleic acid complex comprising the polynucleotides below :

TATGCACACGCGATCCCCTATTTGCTAGCGCA [SEQ ID NO. 5],

TCTGGTACGGCTTTCCCCTTCGCGTGTGCATA [SEQ ID NO. 6],

TCGATGCTCGCGATCCCCTAAGCCGTACCAGA [SEQ ID NO. 7], and

TGCGCTAGCAAATTCCCCTTCGCGAGCATCGA [SEQ ID NO. 8], c) a poly-nucleic acid complex comprising the polynucleotides below :

TATGCACACGCGATCCCTATTTGCTAGCGCA [SEQ ID NO. 9],

TCTGGTACGGCTTTCCCTTCGCGTGTGCATA [SEQ ID NO. 10],

TCGATGCTCGCGATCCCTAAGCCGTACCAGA [SEQ ID NO. 11], and

TGCGCTAGCAAATTCCCTTCGCGAGCATCGA [SEQ ID NO. 12], d) a poly-nucleic acid complex comprising the polynucleotides below :

TATGCACACGCGATCCTATTTGCTAGCGCA [SEQ ID NO. 13],

TCTGGTACGGCTTTCCTTCGCGTGTGCATA [SEQ ID NO. 14],

TCGATGCTCGCGATCCTAAGCCGTACCAGA [SEQ ID NO. 15], and

TGCGCTAGCAAATTCCTTCGCGAGCATCGA [SEQ ID NO. 16], e) a poly-nucleic acid complex comprising the polynucleotides below : TATGCACACGCGATCCCCCCCTATTTGCTAGCGCA [SEQ ID NO. 17], TCTGGTACGGCTTTCCCCCCCTTCGCGTGTGCATA [SEQ ID NO. 18],

TCGATGCTCGCGATCCCCCCCTAAGCCGTACCAGA [SEQ ID NO. 19], and

TGCGCTAGCAAATTCCCCCCCTTCGCGAGCATCGA [SEQ ID NO. 20], f) a poly-nucleic acid complex comprising the polynucleotides below :

TATGCACACGCGATCCCCCCCCCTATTTGCTAGCGCA [SEQ ID NO. 21],

TCTGGTACGGCTTTCCCCCCCCCTTCGCGTGTGCATA [SEQ ID NO. 22],

TCGATGCTCGCGATCCCCCCCCCTAAGCCGTACCAGA [SEQ ID NO. 23], and

TGCGCTAGCAAATTCCCCCCCCCTTCGCGAGCATCGA [SEQ ID NO. 24], g) a poly-nucleic acid complex comprising the polynucleotides below :

TATGCACACGCGATCCTATTTGCTAGCGCA [SEQ ID NO. 13],

TCTGGTACGGCTTTCCCTTCGCGTGTGCATA [SEQ ID NO. 10],

TCGATGCTCGCGATCCTAAGCCGTACCAGA [SEQ ID NO. 15], and

TGCGCTAGCAAATTCCCTTCGCGAGCATCGA [SEQ ID NO. 12], and

h) a poly-nucleic acid complex comprising the polynucleotides below :

GCACACGCGATCCCCCTATTTGCTAGC [SEQ ID NO. 25],

GGTACGGCTTTCCCCCTTCGCGTGTGC [SEQ ID NO. 26],

ATGCTCGCGATCCCCCTAAGCCGTACC [SEQ ID NO. 27], and

GCTAGCAAATTCCCCCTTCGCGAGCAT [SEQ ID NO. 28],

14. A pH-responsive device, comprising one or more poly-nucleic acid complexes according to any one of claims 1 to 13.

15. A method of measuring the pH value of a sample comprising the steps of:

a) bringing one or more nucleic acid complexes according to any one of claims 1 to 13 with a sample, and

b) detecting a signal indicative of the formation, of quadruplexes between the cytosine-bearing nucleotides of the oligonucleotides comprised in the group of [CYT]_W, [CYT]_X; [CYT]_{y wi} [CYT]_Z.

16. The method according to claim 15, wherein the signal is detected at step b) with a method selected in a group comprising (i) circular dichroism (CD), (ii) UV spectroscopy, (iii) fluorescence measurement and (iv) nuclear magnetic resonance.