CN117224672B - Cell surface universal DNA sensing tool box and preparation method and application thereof - Google Patents

Abstract

The invention discloses a universal DNA sensing tool box for cell surfaces and a preparation method and application thereof, and belongs to the technical field of DNA nanometer. The DNA sensing tool box comprises a DNA paper folding frame, and further comprises a sensing core and an anchoring block which are respectively assembled on the inner surface and the outer surface of the DNA paper folding frame. The invention discloses a cell surface universal sensing tool box based on a DNA paper folding frame, wherein an anchoring assembly block and a sensing core can be replaced according to different experimental requirements, and a highly customized platform for controlling cell states is constructed. The platform is anchored on the surface of the cell in a non-covalent or covalent bonding mode, so that the nano mechanical-natural hybrid cell is constructed, the capability of sensing an irregular signal is given to the cell, the diversity of cell function regulation is expanded, and a new strategy is provided for diagnosis and treatment application of engineering cells and bacteria.

Description

Cell surface universal DNA sensing tool box and preparation method and application thereof

Technical Field

The invention relates to the technical field of DNA (deoxyribonucleic acid) nanometer, in particular to a universal DNA sensing tool box for cell surfaces, and a preparation method and application thereof.

Background

Cells, which are key components of organisms, undergo billions of years of biological evolution, sense environmental signals through natural signal sensing/response pathways, respond through changes in cell state (growth, secretion, migration, adhesion, differentiation, proliferation, or death), and perform complex functions. By recombining these signal responses with different cellular status responses, a variety of genetically engineered cells, including immune cells, stem cells and bacteria, have been developed and applied in the treatment of diseases such as tumor destruction, control of inflammation and tissue repair. However, seemingly large libraries of signal sensing/response pathways are rarely used in genetic engineering. For example, engineered immune cells achieve specific antigen recognition and immune activation through antigen receptor gene modification. However, the unique structure and properties of antigen receptors greatly limit the diversity of engineering modifications. Because the entire binding-recognition-triggering mechanism of the natural antigen receptor is tailored for a single ligand-antigen protein, the expansion of the response of artificially modified antigen receptors to other types of ligands (hydrogen ions, reactive oxygen species, or characteristic disease markers in the tumor microenvironment) is hampered. Also, the signal sensing/response pathways available to engineered bacteria have limitations. One of the methods commonly used in engineering bacteria is a two-component signal transduction system in which bacteria sense and respond to environmental changes by controlling gene expression. While this is possible for most small molecule signal sensors, it is difficult to sense biological macromolecules such as proteins or nucleic acids by genetic engineering.

The unique self-recognition ability and highly predictable self-assembly properties give DNA the ability to design and construct arbitrary two-and three-dimensional structures. Recently, DNA nanodevices have been used to design and functionalize cell membranes to control cell states and program cell functions. DNA nanodevices with predictability and designability are used to control cell adhesion and interactions, kill tumor cells, arrange multiple cells in space, and even synthesize three-dimensional tissue. However, while a range of cell surface DNA nanodevices can be tailored for single cell state control and cell function, there is a lack of integrated and versatile systems for sensing cell state control from signals.

Disclosure of Invention

The invention aims to provide a cell surface universal DNA sensing tool box, a preparation method and application thereof, which are used for solving the problems in the prior art, and the cell surface universal sensing tool box is constructed by utilizing a DNA nanotechnology, so that the sensing capability of unconventional signals of cells is endowed to regulate and control various functions of the cells.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a DNA sensing tool box, which comprises a DNA paper folding frame, and further comprises a sensing core and an anchoring block which are respectively assembled on the inner surface and the outer surface of the DNA paper folding frame;

the sensing switch is an I-motif sensing switch responding to H ⁺, and the functional component is a nucleic acid-protein conjugate; the anchoring block includes nucleic acid molecules for anchoring the cell surface.

Preferably, the I-motif sensor switch comprises a first strand and a second strand, wherein the first strand is attached to the DNA paper folding frame by base complementary pairing, the second strand is coupled to the functional module, the first strand modifies a fluorescent group, the second strand modifies a quenching group, and the on and off states of the I-motif sensor switch are characterized in terms of quenching and recovery of fluorescence.

Preferably, when pH > responds to a threshold, the first strand and the second strand are held stationary, fluorescence quenched, and the switch is closed; when pH < response threshold, the first strand folds to form a four-strand structure, the second strand releases, fluorescence intensity increases, and the switch opens.

Preferably, the molar ratio of the first strand to the second strand is 1:2, and the nucleotide sequence of the first strand is as shown in SEQ ID NO:3, the nucleotide sequence of the second chain is shown as SEQ ID NO: 4.

Preferably, the nucleic acid-protein conjugates include CV1-PE38 and CD47-PD1.

Preferably, the anchor block comprises a MUC1 aptamer and a cholesterol-tagged nucleotide chain.

Preferably, the cells include tumor cells and immune cells.

Preferably, the DNA paper folding frame is formed by immobilizing M13 ssDNA by a strand using a nucleic acid self-assembly technique.

Preferably, the sensing switch, the functional component, the anchoring block and the triangular prism paper folding frame are mixed and incubated for assembly, and after the assembly is completed, the DNA sensing tool box is obtained through ultrafiltration; the molar ratio of the sensing switch, the functional component, the anchoring block and the triangular prism paper folding frame is 5:5:5:1.

The invention also provides an application of the DNA sensing tool kit, which comprises the following steps:

(1) The application in preparing medicines or drug delivery carriers for regulating and controlling tumor cell apoptosis;

(2) The application of the preparation of medicines or medicine carriers for regulating and controlling the interaction of immune cells and tumor cells.

The invention discloses the following technical effects:

The invention regulates and controls the cell function by engineering the natural signal sensing/response channel of the recombinant cell on the cell surface, and the construction of the engineering cell for diagnosis and treatment of serious diseases is a very innovative development direction. However, the limitations of the number of natural cell signal sensing-response pathways and the structural properties thereof, the complexity and time consumption of the operation of genetic engineering techniques, the risk of interfering with the natural state of cells and the like greatly limit the universality and flexibility of genetic engineering strategies on engineering the cell surface. The invention utilizes the DNA nanotechnology to construct a universal sensing tool box on the cell surface, and endows the cell with the sensing capability of unconventional signals to regulate and control various functions of the cell.

The sensing tool box integral structure comprises a triangular prism paper folding frame and a sensing core. The outer surface of the paper folding frame can anchor a chemical modification nucleic acid chain to fix the kit on the cell membrane and the bacterial cell wall surface through hydrophobic action or covalent modification. The sensing core is assembled inside the paper folding, the long-acting stability of the core in a complex physiological environment can be improved through the internal limit reaction space, and side effects such as off-target toxicity, signal leakage and the like caused by nonspecific combination of functional components can be avoided, so that accurate control is realized. The sensing core comprises a sensing switch and a functional component, and comprises: 1) The sensor switch includes: an I-motif switch responsive to a low pH environment (tumor microenvironment) and a strand displacement reaction switch responsive to nucleic acid; 2) The functional components include: the cell functional protein-nucleic acid conjugate is used for controlling apoptosis, adhesion, inhibition and other functions. The reprogramming of various cell functions is realized by selecting different sensing switches and functional components, and the reprogramming is further applied to practical scenes of immunoregulation and tumor killing. More specifically, the method comprises the following steps: (1) tumor cell apoptosis control: the DNA sensing kit is assembled to the surface of a tumor cell through an anchoring module composed of mucin 1 (MUC 1) aptamer, the internal sensing core is a pH responsive I-motif switch, the functional group is immunotoxin targeting transmembrane protein CD47, and the kit specifically releases the immunotoxin to kill the tumor cell in an acidic environment. (2) immune cell and tumor cell interaction control: the DNA sensing kit is assembled on the surface of an immune cell membrane by utilizing the hydrophobicity of cholesterol groups, the inner sensing core is a pH responsive I-motif switch, the functional groups are bifunctional fusion nano antibodies targeting CD47 and PD-1 (programmed death receptor 1), and when an acidic environment appears, the kit releases the bifunctional nano antibodies, mediates the interaction of immune cells and tumor cells, blocks a PD-1/PD-L1 channel, relieves the inhibition, and simultaneously enhances the killing activity of immune cells. According to the invention, by constructing a universal DNA sensing tool box on the cell surface, grafting a novel cell signal sensing channel and reprogramming the cell function, a nanometer mechanical-natural hybrid cell is constructed, the diversity of response signals and state changes of engineering cells and engineering bacteria is expanded, and a new strategy is provided for diagnosis and treatment application of the engineering cells and the engineering bacteria.

Drawings

FIG. 1 is a DNA sensing kit for reprogramming immune cells and tumor cells; a: tumor cells; b: immune cells and tumor cells;

FIG. 2 is a triangular prism paper folding structure designed by CADnano;

FIG. 3 is a structural prediction of triangular prism sheet folding;

FIG. 4 is a structural representation of a triangular prism sheet; a: agarose gel electrophoresis image of triangular prism paper folding structure; b: transmission electron microscope image of triangular prism paper folding structure; c: triangular prism paper folding structure diagram;

FIG. 5 is an optimization of the I-motif three-chain switch; a: three different I-chain core sequences; b: optimizing the I chain core sequence; c: the sequence and structure of two O chains; d: optimization of the O chain; e: stability of three-chain switches combined by different sequences;

FIG. 6 shows the feasibility of an enzyme-labeled instrument for testing the I-motif switch inside the folded paper;

FIG. 7 is a cholesterol modification strategy for anchoring nucleic acids to the cell surface; a: confocal images of cholesterol functionalized folded papers; b: flow-validating cell anchoring of cholesterol-modified DNA; c: flow-validating cell anchoring of cholesterol functionalized folded paper;

FIG. 8 is a MUC1 aptamer targeting strategy for anchoring nucleic acids at the cell surface; a: flow-validating cell anchoring of MUC1 aptamer; b: flow-through validation of cell anchoring of MUC1 aptamer functionalized paper folding; c: a MUC1 aptamer functionalized paper folding confocal image;

FIG. 9 is a plasmid construction map of CV1-PE38, CD47-PD 1;

FIG. 10 is a SDS-PAGE graph showing successful expression of IT by E.coli expression systems;

FIG. 11 shows the toxicity of CV1-PE38 (IT) on MCF-7 and HepG2 cells.

FIG. 12 is a functional representation of IT-O; A. b respectively verifying the targeting of IT-O (Ni-NTA strategy) to MCF-7 and HepG2 for a flow cytometer; c: toxicity of IT-O to MCF-7 and HepG2 cells;

FIG. 13 is a confocal imaging characterization of the targeted and dynamic release of internal immunotoxins from the sensing kit;

FIG. 14 is a confocal imaging characterization of the targeted and dynamic release of internal immunotoxins from the sensing kit;

FIG. 15 is a cytotoxicity experiment of the nanokit at different pH under DMEM+10% FBS conditions;

FIG. 16 is an expression purification and targeting test of CD47-PD 1; a: SDS-PAGE map of CD47-PD 1; B. c is the targeting of CD47-PD1 to A431 and T cells, respectively, by flow analysis;

FIG. 17 is a graph showing that copolymerization Jiao Biaozheng CD47-PD1 promotes cell adhesion of A431 and T cells;

FIG. 18 is the activation of T cells by CD47-PD 1; a: effect of CD47-PD1 on inhibited T cell IFN- γ; b: effect of CD47-PD1 on inhibited T cells killing tumor cells;

FIG. 19 is a schematic of a nanokit for controlling cell adhesion in response to different pH;

FIG. 20 is a kit response to pH controlling T cell activation and killing of A431; a: t cell killing capacity control; b: t cell activation control.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The modified nucleic acid sequences and the paper folding staple chain sequences used in the following examples of the present invention were synthesized by the company limited by the biological engineering (Shanghai) and the unmodified nucleic acid sequences were synthesized by the company limited by the biological sciences of Shanghai (see Table 1). The information of the cells, strains and plasmids used in the experiment is shown in Table 2, and the biological reagents used are shown in Table 3.

Table 1 nucleic acid sequence information involved in experiments

TABLE 2 cell, strain and plasmid information

TABLE 3 Experimental materials

TABLE 4M13 stage chain sequence

* The underlined, unbiased sequence is the I-strand anchor site, which is complementarily paired with the shaded portion of the I1 (Tri-prism) strand sequence; the underlined italic sequence is the a-chain anchor site.

Preparing a culture medium and a solution:

(1) LB medium: each 25g of LB culture medium powder was dissolved in 1000mL of water, and the mixture was packed into centrifuge tubes or conical flasks after dissolution, and autoclaved at 121℃for 20min.

(2) PBS buffer: commercial 20 XPBS was diluted to 1 XPBS with water.

(3) Antibiotics: kanamycin powder and ampicillin powder were weighed and dissolved in sterile water at a concentration of 50mg/mL. Filtering with sterile 0.22 μm filter head in an ultra clean bench, packaging into sterile EP tube, and storing at-20deg.C.

(4) IPTG mother liquor: isopropyl-beta-D-thiogalactoside (IPTG) powder was dissolved in sterile water at a final concentration of 96mg/mL, filtered in an ultra-clean bench using a sterile 0.22 μm filter head, sub-packaged into sterile EP tubes, and stored at-20deg.C.

(8) 10 XSDS-PAGE running buffer: 144g Gly,30.3g Tris was weighed into a beaker and deionized water was added to volume to 1000mL. Electrophoresis liquid: 10 XSDS-PAGE running buffer 100mL,10mL 10% SDS in water and deionized water was added to fix the volume to 1000mL.

(9) Coomassie brilliant blue staining solution: 0.25G of Coomassie brilliant blue G250 was weighed into a beaker and dissolved well by adding 45mL of distilled water and 10mL of glacial acetic acid.

(11) 10% Ammonium Persulfate (APS): 0.1g of ammonium persulfate was weighed into a brown EP tube containing 1mL of water and dissolved well.

(12) Imidazole equilibration buffer: 3g NaH ₂PO₄, 8.766g NaCl,0.344g imidazole, constant volume to 500mL, pH adjusted to 8.0 with NaOH; imidazole wash buffer: 3g NaH ₂PO₄, 8.766g NaCl,0.688g imidazole, constant volume to 500mL, pH adjusted to 8.0 with NaOH; imidazole elution buffer: 1.5g NaH ₂PO₄, 4.383g NaCl,4.3g imidazole, constant volume to 250mL, and pH adjusted to 8.0 using NaOH.

(13) DNA denaturing PAGE gel: the gel plate was 0.75mm, comb 10 well, loaded with 10-20. Mu.L (12. Mu.L, 500 nM-1. Mu.M concentration of DNA). Concentrated glue: 0.84g urea, 1M, tris 250. Mu.L pH 6.8, 330. Mu.L acrylamide/bisacrylamide (29:1, 30%) was fixed to a volume of 2mL with deionized water. And (3) separating glue: 2.1g urea, 650. Mu.L Tris (3M, pH 8.8), 2.75mL acrylamide/bisacrylamide (19:1, 40%), deionized water to 5mL. Loading buffer solution: 0.48g urea, 93.75. Mu.L Tris (1M, pH 6.8), 62.5. Mu.L 1% bromophenol blue dye, and deionized water to a volume of 1mL. Electrophoresis buffer solution: 2.5mM Tris,0.19M glycine.

M13 ssDNA,7249nt, purchased from NEW ENGLAND Biolabs, cat# and gauge: b3003-50pmol.

Example 1

1. Design, construction and characterization of DNA triangular prism paper folding carrier

The DNA triangular prism paper folding structure is formed by mixing long-chain M13 phage genome DNA and 178 short staple chains and then carrying out gradient annealing. The design and sequence of the above DNA paper folding structure are all completed and exported above CADnano.

The specific steps of the paper folding synthesis are as follows:

(1) 7249nt of M13 ssDNA was mixed with 178 strand strands mixed in a molar ratio of 1:5 in 1 XTris-EDTA-Mg ²⁺ buffer (pH 7.4,20mM Tris-HCl,1mM EDTA,10mM MgCl ₂).

(2) The mixture was dispensed into PCR tubes at 50. Mu.L per tube, annealing procedure: the temperature is maintained at 75 ℃ for 5min, then the temperature is gradually annealed from 65 ℃ to 5 ℃ and each 1 ℃ is maintained for 15min, and the total time of the program is about 15 h.

(3) The mixture obtained in 5 tubes was subjected to agarose gel electrophoresis (TAE) running 10X DNA Loading buffer in an amount of 5. Mu.L each.

(4) The blades cut the desired strip and chop it to maximize recovery and purity.

(5) Placed in a filter column of Quantum Prep Freeze' N Squeeze DNA gel extraction spin column. The column was placed in the cannula.

(6) The sample was spun at 13000g for 3min at room temperature.

(7) Purified DNA was collected from the collection tube.

(8) And (3) carrying out TEM (transmission electron microscope) electron microscope characterization on the purified folded paper: samples were prepared on top of the copper mesh, first pretreated with 2M magnesium acetate onto the copper mesh for 2min, and excess liquid was removed using filter paper.

(9) Adding the purified paper folding frame into a copper net, and standing for 30min.

(10) 1% Uranyl acetate was added to the copper mesh and quickly blotted using filter paper.

(11) 1% Uranyl acetate was added to the copper mesh for dyeing for 2min. The triangular prism paper fold was characterized using a transmission electron microscope after complete drying at room temperature.

(12) Agarose gel electrophoresis characterization of the folded paper: 1% agarose gel was prepared, and the gel was dissolved by heating using a1×TAE microwave oven, and the nucleic acid dye was added thereto, and after pouring, the gel was allowed to solidify.

(13) The spotting wells were filled with 10X DNA loading buffer M13 ssDNA mixed with a DNA paper folding frame and run under 160V.

(14) After electrophoresis was completed, a photograph was taken in a gel imager using a UV channel.

2. Design and optimization of switches

(1) For optimization convenience, the I-motif switch is designed into a 3-chain combined form (L+O+I), a quenching group BHQ1 and a fluorescent group FAM are respectively modified on an O chain and an L chain, and complementary sequences are positioned on a C-rich core sequence of the I-motif, so that when the pH value is reduced, the I-motif is folded at the core sequence, and the functional group is released and functions. The L chain is modified with FAM fluorescent groups, the O chain is provided with BHQ1 quenching groups, and the two states of the I-motif switch are reflected through quenching and recovery of fluorescence.

(2) The L chain, O chain, I chain were mixed in a molar ratio of 1:4:2 in 1 XPBS to prepare a stock solution with a final concentration of L of 1. Mu.M (while retaining a set of positive controls without O chain) and annealed. Heating at 95deg.C for 5min, and then placing on ice for 20min.

(3) 2 XPBS was formulated and titrated to 1 XPBS using HCl to pH 7.37, 7.11, 6.49, 6.01, 5.63 and 5.09.

(4) Mu.L of the mother liquor, 150. Mu.L of 2 XPBS, 7.5. Mu.L of 200mM Mg ²⁺, 112.5. Mu.L of water were mixed to prepare a reaction solution having a final concentration of L of 100 nM.

(5) The reaction was carried out at 37℃for 2 hours, and at the end of the reaction, the reaction solution was added in 100. Mu.L per well, 3 plates were added in parallel to the 384-well plate of the black matrix, and the fluorescence intensities of the respective wells at the initial and end points were measured at an excitation wavelength of 485nM and an emission wavelength of 520 nM.

(6) The reaction was continued at 37℃for 24 hours, and the fluorescence intensity at this time was measured to characterize the stability and leakage rate of the switch binding.

(7) The sequence combinations of I1, I2 and O1, O2 were continued to be optimized in the same manner, the main difference being the number of complementary bases to which I and O bind to the core sequence.

(8) The fluorescence intensity of solution A after 10-fold dilution in 1 XPBS+5 mM Mg ²⁺ was measured, and the fluorescence intensity of solution B and solution C after addition of T1 (1 nM/2.5nM/5nM/7.5nM/10nM/20nM/50nM/80nM/100 nM) under the same buffer conditions were measured, respectively.

(9) A standard curve of fluorescence intensity of F1 chain with concentration was prepared, F1 was diluted to 10nM, 20nM, 40nM, 60nM, 80nM and 100nM in 1 XPBS+5 mM Mg ²⁺, respectively, and the fluorescence intensity was measured at each concentration.

3. Plasmid construction

(1) Constructing CV1-PE38 and CD47-PD1 expression plasmids, fusing and connecting target genes by utilizing a PCR technology, constructing the expression plasmids by selecting pET28a plasmids as a skeleton, and relating to primer sequences as follows:

TABLE 4 primer sequences

(2) The reaction system was 50. Mu.L, wherein 2X TAQ MASTER Mix 25. Mu.L, water 21. Mu.L, F primer 1. Mu.L, R primer 1. Mu.L, template 1. Mu.L, taq DNA polymerase 1. Mu.L, dNTP 1. Mu.L. The PCR reaction conditions were set at 95℃for 5min in the first step; the second step is 95 ℃ for 20s; step three, 58 ℃ for 30s; fourth step, 72 ℃,1kb/1min, wherein 2-4 steps total 34 cycles; fifth step, 72 ℃ for 10min.

(3) The above sample was added with 5. Mu.L of 10 XDNA loading buffer and subjected to agarose gel electrophoresis.

(4) Cutting the target strip under an ultraviolet lamp, placing the cut target strip into a centrifuge tube, carrying out glue recovery according to a glue recovery kit instruction, and measuring the concentration of recovered DNA.

(5) The fragment of interest, the backbone fragment and the 2 Xmix homologous recombinase are recovered and mixed. The system was 4. Mu.L of the fragment of interest, 2. Mu.L of the backbone, 6. Mu.L of enzyme, and a low concentration of the components were added in an appropriate amount. Placing in 50deg.C water bath for 30min.

(6) Melting DH5 alpha competence on ice, placing homologous recombination product on ice, mixing the two in an ultra clean bench, and standing on ice for 30min.

(7) Immediately after heat shock at 42 ℃ for 90s, ice bath is carried out for 2min.

(8) 500. Mu.L of LB medium was added and incubated at 37℃for 45min with shaking at 220 rpm.

(9) The solid medium (150 mL) was thawed, cooled with running water until it could be held by hand for 10s, and the plates were inverted by shaking about 20 times with kanamycin.

(10) Centrifuging at 8000rpm for 1min, sucking 500 μl supernatant, re-suspending the rest of the bacterial liquid coated plate, and culturing overnight.

(11) And (3) picking single colonies in the super clean bench, adding 10 mu L of sterile water into each PCR tube, picking single colonies again, uniformly mixing, and taking 1 mu L of the single colonies as a template.

(12) The bacterial liquid PCR system is Mix 12.5. Mu.L, water 10.5. Mu.L, F primer 0.5. Mu.L, R primer 0.5. Mu.L and template 1. Mu.L. The procedure is 95℃for 5min in the first step; the second step is 95 ℃ for 20s; step three, 58 ℃ for 30s; fourth step, 72 ℃,1kb/15s, wherein 2-4 steps total 34 cycles; fifth step, 72 ℃ for 10min.

(13) The product was subjected to agarose gel electrophoresis at 5. Mu.L, and the remaining PCR stock was subjected to DNA sequencing.

(14) Single colonies after successful sequencing were inoculated into 5mL of LB for overnight culture.

(15) The cells were collected and plasmids were extracted according to the plasmid extraction kit instructions, and plasmid concentration was measured using an enzyme-labeled instrument.

(16) The plasmid was transformed into E.coli competent BL21 (DE 3) according to the transformation procedure described above.

(17) Picking single colony, activating, preserving seeds and preserving a seed system: 500. Mu.L of the bacterial liquid was added with 500. Mu.L of 50% glycerol.

4. Expression and purification of functional proteins

(1) Seed-retaining bacterial liquid is added into 5mL LB containing one thousandth of kanamycin for overnight culture, and the same steps are activated for the second time.

(2) All the bacterial liquid after the secondary activation is inoculated into a 250mL conical flask (containing 100mL of LB), cultured for 3-4 hours, and after the OD ₆₀₀ is 0.6-0.8, 100 mu L of IPTG (96 mg/mL) is added for induction, and the bacterial liquid is cultured for 12-16 hours at a temperature of 18 ℃ and a shaking table of 220 rpm.

(3) The bacterial solution was transferred to a 50mL centrifuge tube and centrifuged at 8000rpm at 4℃for 10min.

(4) After washing the cells twice with 1 XPBS, they were sonicated in PBS. (program set 45% power, ultrasound for 3s, shut down for 5 s).

(5) The crushed sample was centrifuged at 8000rpm for 10min, and the precipitate and supernatant were separated.

(6) The supernatant was subjected to nickel column purification, first 10mL of imidazole equilibration buffer was used to equilibrate the nickel column, then the supernatant was added, 3 column volumes of imidazole wash buffer was used to elute the hybrid protein, and finally the imidazole elution buffer was used to elute the protein of interest.

(7) The nickel column was washed with 10mL of 0.5M NaOH, and 10mL of imidazole equilibration buffer was added and stored at 4 ℃.

(8) Concentrating the purified protein by using a proper ultrafiltration tube, changing a protein eluting buffer into PBS, storing the concentrated protein at 4 ℃ for a short period, and storing the concentrated protein at-80 ℃ after adding equal amount of 50% glycerol for a long period.

(9) Protein concentration was quantified using BCA protein, working solution a: b=50:1, 200 μl working solution and 20 μl protein sample were added to each well of the 96-well plate, and incubated at 37 ℃ for 30min. Absorbance was measured at 562nm using an enzyme-labeled instrument.

(10) Preparing SDS-PAGE gel: and (3) separating glue: 2.5mL of 10% underfill, 2.5mL of underfill buffer, and 65. Mu.L of accelerator, the interface was flattened using isopropanol. Concentrated glue: 1mL of the upper layer gum, 1mL of the color upper layer gum buffer solution and 35 mu L of the coagulant were inserted into the corresponding comb, and the comb was used after solidification.

(11) Electrophoresis system: mu.L of Protein sample was added with 3. Mu.L of 6 Xprotein buffer, the gel concentration voltage was 80V, and the gel separation voltage was 120V.

(12) The protein gel was carefully isolated and stained by immersing in coomassie brilliant blue for about 30min. Adding a proper amount of water, putting into a microwave oven, boiling for decoloring, and finally putting into a gel imager for observing the result and photographing.

5. Protein-DNA coupling strategy

5.1 Drawing of fluorescent chain Standard Curve

The DNA was dissolved in PBS and diluted to 200nM, 100nM, 50nM, 25nM, 12.5nM, 6.25nM and 0nM. The fluorescence intensity at 485nm excitation, 520nm emission was measured.

5.2Ni-NTA strategy:

(1) Thiol-modified DNA was dissolved with water, and for amino-modified DNA, 10mM SPDP was first added and incubated for 1h at room temperature.

(2) TCEP (initial concentration of 100mM, final concentration of 10 mM) and thiol-modified DNA (initial concentration of 100. Mu.M, final concentration of 20. Mu.M), and removal of disulfide bonds by incubation at room temperature for 15-30 min.

(3) 70-Fold excess of Maleimido-C3-NTA was added, incubated at room temperature for 1h, excess crosslinker removed, and stored in PBS at 4deg.C.

(4) NTA-DNA (20. Mu.M) and 0.5mM NiCl ₂ (20 mM stock solution) were incubated at room temperature for more than 30 min.

(5) The 3k ultrafiltration tube removed excess Ni ²⁺.

(6) After purification, the protein (initial concentration: 8. Mu.M) and DNA (initial concentration: 20. Mu.M) were mixed in a molar ratio of 2:3 and incubated at room temperature for 1h.

(7) The PAGE gel is used for observing whether DNA is successfully modified, and the sample and the loading buffer are uniformly mixed according to the proportion of 1:1, and heated for 5min at 95 ℃.

(8) Loading, concentrating gel voltage 150V and separating gel voltage 300V.

(9) SYBR Gold staining was used. 2.5. Mu.L+25 mL 1 XTBE was stained for 20-30min.

(10) The purple color was observed for the bands and photographed.

(11) The prepared nucleic acid-protein conjugate was analyzed using an AKTA pure protein purifier and purified.

6. Assembly of a sensing kit

Excess switch strand, functional nucleic acid strand and DNA-protein conjugate were mixed together with purified paper folding frame and incubated overnight at 25 ℃ in 1 x PBS buffer supplemented with 10mM magnesium ions. To ensure proper ligation of all linker chains anchored to the paper fold to the DNA-protein conjugate, the molar ratio of paper fold structure to DNA-protein conjugate during incubation was 1:200. after assembly, the nanokit was purified using a 100k ultrafiltration tube to remove excess chains and functional groups. The resulting product was stored at 4 ℃ to maintain its integrity for future use.

7. Cell culture

Culture of four cell lines MCF-7, HEK-293T, hepG and A431 was performed using 90% DMEM medium, 10% Fetal Bovine Serum (FBS) and penicillin (100U/mL)/streptomycin (0.1 mg/mL) double antibody medium and incubated in a constant temperature incubator containing 5% CO ₂ at 37 ℃. The expanded T cells were cultured under the same conditions using medium containing 90%1640 medium, 10% Fetal Bovine Serum (FBS) and penicillin (100U/mL)/streptomycin (0.1 mg/mL) double antibodies.

Cell passage: the desired cell culture medium was warmed up with PBS and the culture medium in the cell flask was aspirated. PBS was added for washing once, an appropriate amount of EDTA-trypsin (1 mL in T25 square flask and 2mL in T75 square flask) was added, the mixture was left at 37℃for 2-3min, after the cells became round and fall off, an equal volume of cell culture medium was added, and transferred to a centrifuge tube, and 800g was centrifuged for 1min, the culture solution was aspirated, fresh medium was added for resuspension and an appropriate amount of liquid was taken and inoculated into the cell culture flask (5 mL in T25 square flask and 15mL in T75 square flask).

T cell expansion: the beads were stored and resuspended in a centrifuge tube and then transferred to a new centrifuge tube. The beads were resuspended using an equal volume or at least 1mL of PBS, then the centrifuge tube was placed on top of the magnet rack for 30s-60s, the supernatant carefully aspirated with the gun head, taking care not to aspirate the beads, and 1.2 volumes of 1640 medium containing 200IU/mL rhIL-2 were added for use. For Ficoll isolated PBMC, T cell density was adjusted to 1-1.5X10 ⁶ cells/mL using 1640 medium containing 200IU/mL rhIL-2, magnetic beads were added at a ratio of 3:1 of magnetic beads to T cell number, and incubated in a 5% CO ₂ incubator at 37 ℃. The cell state was observed and counted every day, and the cell number was adjusted to 0.5 to 1X 10 ⁶ cells/mL. After 12-14 days of culture, 600g of cells were collected by centrifugation and the magnetic beads were removed, frozen using cell frozen stock, placed in a refrigerator at-80℃for 24 hours, and transferred to liquid nitrogen.

T cell activation: the 1640 culture medium is preheated at 37 ℃ in advance, the T cells in the liquid nitrogen tank are taken out and placed in a water bath kettle at 37 ℃ for thawing, the thawed T cells are transferred to a centrifuge tube, and the 1640 culture medium is slowly added to 10mL. And (3) centrifuging at 600g for 10min, re-suspending the T cells by using a 1640 culture medium, transferring the T cells into a culture container, adding the washed magnetic beads according to the ratio of the number of the magnetic beads to the number of the T cells being 1:1, and culturing for 24h to obtain activated T cells.

8. Anchoring strategy of toolbox on cell surface

(1) 150 Ten thousand MCF-7 cells were digested and removed in an ultra clean bench.

(2) The removed cells were washed once with PBS, aliquoted into three centrifuge tubes 1,2,3, and centrifuged at 500g for 3min.

(3) The resulting 3-tube cell pellet was subjected to the following treatments: 1 was resuspended by adding 100. Mu.L of PBS+5mM Mg ²⁺, 2 by adding 100. Mu.L of PBS and 200nM of MUC1 aptamer A1,3 by adding 100. Mu.L of PBS+5mM Mg ²⁺. Incubate at 37℃for 2h.

(4) Three groups of cells were washed three times with PBS and 500nM of the fluorescent strand complementary to A1 was added to two B, C tubes, and after incubation for 1h at room temperature, the cells were washed three times with PBS and fluorescence was detected using a flow cytometer.

(5) Cholesterol-modified chain A2 was tested in the same manner (first incubation time was changed to room temperature for 1 h) and fluorescence was detected using a flow cytometer.

Copolymerization Jiao Biaozheng DNA anchoring at cell surface

(1) Aptamer targeting

A DNA triangular prism paper fold was prepared and labeled with Dox and a Cy3 labeled strand loaded inside the paper fold. HepG2 and MCF-7 were treated according to the two-step incubation method described above (first step A1 treatment, second step paper folding treatment) and fluorescence shift was detected using a flow cytometer while the remaining cells were placed in 24-well plates at the bottom of glass and observed for fluorescence of cells using a nikon confocal imaging system and photographed.

(2) Cholesterol modification

Cy 3-labeled strand-pair paper-folding labels were internally loaded using Dox and paper-folding. MCF-7 was treated according to the two-step incubation method described above (first step A1 treatment, second step paper folding treatment) and fluorescence shift was detected using a flow cytometer while the Nikon confocal microscope was used to observe the cell fluorescence and photograph.

9. Cell death control

Anchoring of immunotoxins and response of nanokits:

The I-motif in the kit was modified with BHQ1 moieties to quench fluorescence on complementary DNA labeled with FAM on immunotoxin-DNA. The inactivated I-motif selected as the control did not respond to pH changes and its core sequence (C-rich) was removed. Then, using it, an inactivation kit was synthesized and purified. Sufficient MCF-7 cells (MUC 1 high expression) and HepG2 cells (MUC 1 low expression) were collected (1X 10 ⁵ per sample) and the cells were washed with PBS. In addition to setting the necessary blank for cells at different pH, MCF-7 cells were treated with A1 (MUC 1 Apt) functionalized kits at pH 7.4 and pH6.0, A1 functionalized inactive kits at pH 7.4 and pH6.0, and unfunctionalized kits at pH 7.4 and pH 6.0. While the A1 functionalized kit treated HepG2 cells at pH6.0 served as control. The treatment method comprises the following steps: after treating the cells with 1. Mu.M A1, they were washed three times with PBS, incubated at room temperature for 30min in 1 XPBS containing 5mM Mg ²⁺, and then washed three times with PBS. Cells were incubated with the kit or the inactivated kit at 1 XPBS+5 mM Mg ²⁺ for 30min at room temperature. Cells not treated by the functionalized kit are incubated directly with the kit or the inactivated kit without prior A1 treatment. All samples were washed three times with PBS, after removing excess DNA, cells were observed using confocal microscopy, and photographed.

Toxicity of the nanokit in response to different pH: media of different pH values were prepared (and added to the nanokit) and sterilized in an ultra clean bench using a 0.22 μm filter head. MCF-7 and HepG2 cells were digested and inoculated onto 96-well plates, 8000 cells were inoculated per well, and medium from mixing kits of different pH was changed when cell density reached 70% -90%. Culturing was continued for 48 hours, and cell viability was measured as described above.

10. Immune cell and tumor cell interaction control

T cells co-incubation with tumor cells: magnetic bead activated T cells were collected by centrifugation at 600g and resuspended in fresh 1640 medium and counted using a hemocytometer. A431 cells were digested and collected by centrifugation, resuspended and counted using 1640 medium. A431 and T cells were then incubated in 96-well plates at a ratio of 3:1 (9000: 3000) in 3 replicates, and after two to three days of incubation, the cells were removed by centrifugation and the cytokine IFN-. Gamma.content of the supernatant was measured. When testing CD47-PD1 and kits, a431 cells were added after incubation with T cells.

Measurement of IFN-gamma cytokines: the method is suitable for gradient dilution of standard products and is used for preparing a standard curve. The supernatant of the cells after three days of culture in 96-well plates was collected and centrifuged at 1000g for 3min to remove the cells and cell debris.

(1) On the strip equilibrated to room temperature, 100. Mu.L of standard & specimen universal diluent was added to the blank wells, 100. Mu.L of specimen was added to each of the remaining wells, the strip was sealed with gummed paper, and incubated at 37℃for 90min in the absence of light.

(2) The biotinylated antibody working solution was prepared in advance and the plate was washed 5 times.

(3) The blank wells were filled with biotinylated antibody dilution, the remaining wells were filled with 100 μl of working fluid, the strips were sealed with gummed paper, and incubated at 37deg.C for 60min in the absence of light.

(4) The enzyme conjugate working solution is prepared in advance, and the plate is washed 5 times.

(5) The blank wells were filled with 100. Mu.L of enzyme conjugate diluent and the remaining wells with 100. Mu.L of enzyme conjugate working solution, the strips were sealed with gummed paper and incubated at 37℃for 30min in the absence of light.

(6) The plate was washed 5 times, 100. Mu.L/Kong Xianse substrate TMB was added and incubated at 37℃for 15min in the absence of light.

(7) Stop solution 100. Mu.L/well was added and OD ₄₅₀ was measured.

Confocal detection of cell adhesion: a431, hepG2 and expanded T cells were digested and collected, T cells were stained with cell membrane red fluorescent probe di and two other cells were stained with cell membrane green fluorescent probe DiO. T cells and tumor cells were mixed at a ratio of 10:1, incubated in 1 XPBS+5 mM Mg ²⁺+0.5mM Ni²⁺ in buffer, incubated at room temperature for 1h, and cell adhesion was observed. The other group observed changes in cell adhesion effect upon addition of CD47-PD1 bifunctional nanobodies. And the adhesion of cells after treatment with the kit at different pH conditions.

Then, the kit is tested for activating T cells to secrete IFN-gamma and enhancing the killing of tumor cells, the T cells are inoculated into an orifice plate, incubated with the kit for 30min at 37 ℃, then A431 cells are added, and the cell viability is determined and the IFN-gamma test method is as above.

11. Results and analysis

11.1 Principle of experiment

The invention uses nucleic acid self-assembly technology to fix M13 ssDNA into triangular prism paper folding structure by using a strand chain. In order to enrich the application scenarios of paper folding, a sensing core based on protein functions (comprising an I-motif switch and a functional group corresponding to pH) and an anchoring module based on MUC1 aptamer/cholesterol modification (specific targeting/non-specific anchoring) are introduced. The working principle of the I-motif switch is as follows: when the pH value is greater than a response threshold value, the three-chain structure O/I/L keeps a stable state, and the switch is closed; when pH < response threshold, I folds forming a four-chain structure, O is released into solution and the switch opens. In the controlled cell death model, MUC1 aptamer A1 is an anchoring module, CV1-PE38 Immunotoxin (IT) and output chain O conjugate (IT-O) are functional groups, and when an acidic environment is sensed, a switch is opened to release IT-O so as to kill target cells MCF-7. Meanwhile, as MUC1 and CD47 of HepG2 negative cells are low-expression, the kit cannot function, and the customization and the specificity of the kit are reflected. In the control cell activation and adhesion model, cholesterol modification is used as an anchoring module A2 to anchor on the surface of T cells, and a CD47-PD1 bifunctional nanobody (BsAb) and an O chain conjugate BsAb-O are used as functional groups. The acid environment is sensed, the switch is opened to release BsAb-O, and the inhibition of PDL1 highly expressed on the surface of the A431 cells on the T cells is blocked, and meanwhile, the adhesion of the T cells to tumor cells is induced, so that the killing effect of the T cells on the A431 is further improved. As shown in fig. 1.

11.2 Design, construction and characterization of the triangular prism paper folding Carrier

The sensing tool box used in the invention is constructed based on a DNA triangular prism paper folding structure, so that caDNAno is used for designing DNA paper folding and an anchoring site on the paper folding, and NUPACK is used for designing a DNA sequence of double-chain and triple-chain substitution reaction. The total number of DNA folded paper designed by the invention is 178, and the detailed sequence information is shown in Table 4. The two-dimensional and three-dimensional design diagram of the DNA triangular prism paper folding is shown in fig. 2, wherein 71, 69, 75, 77, 49, 51, 55, 57, 59, 61, 65 and 67 are anchoring sites inside the paper folding and are used for loading functional groups and sensing switches. The anchor assembly a chain anchors the kit to the cell surface, either covalently or non-covalently, at both 56, 54.

The designed sequence information is input to TacoxDNA websites for predicting the triangular prism paper folding frame structure, as shown in fig. 3.

And synthesizing and purifying the DNA triangular prism paper folding frame according to the experimental method of the design, construction and characterization of the DNA triangular prism paper folding carrier. The structure was then characterized, and the agarose gel electrophoresis results (FIG. 4A) showed that the left lane was M13ssDNA on the right of the purified paper folding structure, and that the migration rate of the left sample band was significantly slower than that of the right sample, which indicated that M13ssDNA with 178 strand integration formed a larger molecular structure. The presence of a shallow band following the sample band a in fig. 4 may be a dimer structure. The invention also carries out TEM electron microscope characterization (B in fig. 4) on the purified paper folding frame, the scale is 50nm, the side view, the front view and the top view of the paper folding frame are respectively from left to right, and the successful assembly of the triangular prism paper folding structure is proved by the multi-angle photo. The three-dimensional view of the folded paper is shown in FIG. 4C, showing the binding sites inside and outside the folded paper in different colors for binding different functional nucleic acids or proteins to assemble the complete kit. Dark grey sites are used to anchor the sensing core and orange sites are used to attach the anchor module.

11.3 Design, optimization and functional verification of the sensor switch

The DNA sensing kit can respond to the environmental pH (H ⁺), and a three-chain switch L/O/I is designed based on the classical I-motif DNA structure to respond to low pH and release functional groups, and I-motif can respond to H ⁺ to form semi-protonated cytosine-cytosine base pairs (C.C ⁺). The I-motif sequence (I strand) binds to the other two strands L and O by base complementary pairing, the O and I strand binding sequences are located in the core region of the I-motif (rich in C), when the pH reaches a threshold, the I strand folds to form semi-protonated cytosine-cytosine base pairs, and the O strand drops due to reduced binding capacity. The invention is applied to a toolbox, the L chain is connected to the stand chain, and the O chain is combined with the functional group to generate the output of the toolbox. At the O chain modified BHQ1 quenching group, the L chain modified FAM fluorescent group, the state of the three-chain switch was characterized according to quenching and recovery of fluorescence, as shown in FIG. 5 at A, C.

The normal tissue internal environment pH is about 7.4, the solid tumor tissue environment pH is 5.5-7.0, and in order for the switch to respond to the solid tumor acidic microenvironment, the present invention next optimizes the sensing switch sequence so that it can respond at pH 6.0. First, the I chain core sequence is optimized, and the C-rich core sequence is a determinant of the ability of I-motif to respond to pH. The core sequences of I1, I2 and I3 are (C₅)₄(T₄)₃、(C₄)₄(T₄)₃、(C₃)₄(TAA)₃, respectively, and the optimized result is shown as B in FIG. 5, when the pH is reduced from 7 to 6.2, the I1 and the I2 are completely folded, and the I3 starts to be folded at the pH of 6, so that the pH response to the pH is too low, and the method has no application significance. The results indicate that I1, I2 can be used for continued optimization of the subsequent O chain sequence to achieve full switch opening at pH 6. The folding rate was calculated by the formula (reaction end point fluorescence intensity-reaction initial fluorescence intensity)/(unquenched fluorescence intensity-reaction initial fluorescence intensity) ×100%. The difference between O1, O2 and O3 is that the binding sequence of the I chain is respectively 3G, 4G and 5G, the number of complementary bases and the binding capacity are positively correlated, and the pH value of the complete open state of the switch is negatively correlated. The final optimization of the O chain results are shown as D in FIG. 5, the combination of L/O1/I1 starts folding at pH 6.5, and the highest pH response sensitivity is achieved when all folding is completed at pH 6. Next we tested the fluorescence intensity of the switches over 24 hours to observe the degree of switch stability, and the results of E in fig. 5 show that the two switches L/O3/I1 and L/O3/I2 increased the fluorescence intensity by 10% -20% over the initial state over 24 hours, demonstrating that the state of the switch is unstable and there is a potential risk of leakage. The leakage rate of the other switches is less than 5%, and the switch can be kept stable within 24 hours. In summary, the most sensitive, most state stable three-chain switch of L/O1/I1 was selected for subsequent experiments.

The optimized switch is assembled on the paper folding frame, and the running condition of the optimized switch in the paper folding and on the cell surface is verified. The L chain in the three-chain switch is a paper folding frame inherent sequence, and an O1 (SH) chain-functional group compound and an I1 (Tri-prism) chain are anchored in paper folding according to an experimental method of 1 'design, construction and characterization of a DNA triangular prism paper folding carrier', wherein the O1 (SH) chain modifies a quenching group and the I1 (Tri-prism) chain modifies a Cy3 fluorescent group. The samples were incubated in PBS at different pH and the fluorescence intensity after the reaction was measured, and as shown in FIG. 6, the fluorescence shift of the flow-measured cells was weaker when the fluorescence intensity value of the samples was lower than pH 6 at pH 7.4. The folded paper was further immobilized on the cell surface by cholesterol modification, and fluorescence was observed using a confocal microscope. The cell surface at pH 6.0 was significantly more fluorescent than at pH 7.4. The results indicate that at pH 7.4, the I-motif switch is closed, the I1 (Tri-prism) chain and the O1 (SH) chain are combined, and the fluorescence of the I1 (Tri-prism) chain is quenched by the O1 (SH) chain. At pH 6.0, the I-motif switch is opened, the I1 (Tri-prism) chain is folded, the O1 (SH) chain is dropped, and the fluorescence intensity is enhanced. Together, the three experimental results demonstrate the feasibility of this switch on the cell surface.

11.4 MUC1 aptamer specific targeting of toolbox

After verifying the feasibility of the nonspecific cholesterol modification strategy, the specific targeting ability of MUC1 aptamers to MCF-7 cells (cell surface highly expressing MUC 1) was tested using the same method as "kit cholesterol modification anchoring". Flow cytometry results showed that the muc1apt+s1 group treated cells had a distinct fluorescent label of the cells, whereas the negative control group S1 was not aptamer-added, and therefore failed to carry fluorescence to the cells (a in fig. 8). The feasibility of paper folding to target cells through MUC1 aptamer was then further verified, as shown in fig. 8B, with the muc1apt+origami group having a stronger fluorescence intensity than the Origami group. The confocal imaging results further demonstrate the targeting of the kit, as shown in fig. 8C, the paper fold was visualized by fluorescent DNA labeling, the paper fold with an anchor module (MUC 1 aptamer) could be targeted to the MCF-7 cell surface to form a fluorescent ring, while HepG2 cell surfaces that did not express MUC1 did not have a fluorescent ring representing the paper fold structure, which together demonstrated that the MUC1 aptamer could target the paper fold specifically to MCF-7 cells (high expressing MUC 1).

11.5 Cholesterol modified Anchor of kit

To ensure the anchoring of the kit on the cell surface, the feasibility of the cholesterol modification strategy was first verified. The cholesterol-modified DNA (CW 7) was used to bind to Cy 3-labeled antisense strand S2 and then incubated with cells, and the cells were flow analyzed for fluorescence. As a result, see B in FIG. 7, the CW7+S2 group has a significantly stronger fluorescence shift than the S2 group. The purified paper folding structure was then double-labeled with DOX and Cy 3-labeled I-strands, and the labeled paper folding structure was subjected to cholesterol-modified DNA treatment and incubated with cells. As a result of the flow assay, as shown in FIG. 7C, the CW7+Origami group has a significantly stronger fluorescence shift than the Origami group. We also subsequently observed cell surface fluorescence using confocal fluorescence microscopy and photographed, as shown in fig. 7 a, with the result that the A2 (cholesterol modified) treated paper fold showed bright fluorescent rings on the cell surface, whereas the untreated paper fold showed only weak fluorescence on the cell surface, possibly nonspecifically adsorbed. Together, the three experimental results indicate that cholesterol modification strategies can successfully anchor the nanokit to the cell surface, but this experiment also has the problem that fluorescence is also present inside the cells in the confocal images due to the strong invasiveness of DOX to the cells.

11.6 Construction and expression of plasmids

The functional groups selected by the invention are CV1-PE38 and CD47-PD1, and the two proteins are constructed in escherichia coli DH5 alpha and expressed in BL21 (DE 3). Wherein CV1-PE38 is composed of CV1 nanobody fragment and truncated pseudomonas aeruginosa exotoxin 38 (PE 38), wherein CV1 nanobody is formed by internalizing high-affinity mutant (Weiskopf K,et al.Engineered SIRPαVariants as Immunotherapeutic Adjuvants to Anticancer Antibodies.Science 341,88-91(2013).).PE38 obtained by SIRPalpha mutation and directed evolution of CD47 binding antibody, and catalyzing ADP ribosylation of dimethylformamide residue in elongation factor-2 (EF-2) to cause rapid decrease of Mcl-1 level and apoptosis, thus killing tumor cells (Wayne AS,et al.Anti-CD22 Immunotoxin RFB4(dsFv)-PE38(BL22)for CD22-Positive Hematologic Malignancies of Childhood:Preclinical Studies and Phase I Clinical Trial.Clinical Cancer Research 16,1894-1903(2010).)., the gene sequences are synthesized by company and classical GS flexible linker is added in the middle by PCR technology to construct fusion protein, and plasmid map is shown in figure 9. The CD47-PD1 bispecific nanobody is expressed by fusion of a CD47 targeting nanobody (Sockolosky JT,et al.Durable antitumor responses to CD47 blockade require adaptive immune stimulation.Proceedings of the National Academy of Sciences 113,E2646-E2654(2016).) and a PD1 targeting nanobody, and the plasmid map is shown in FIG. 9.

11.7 Protein-DNA coupling techniques

The coupling was based on nickel-mediated interactions between NTA and His-tag bearing target proteins using a non-covalent Ni-NTA strategy. Two histidine residues and one NTA molecule can satisfy all six coordination sites of nickel (II) ions. This method is commonly used in nickel column affinity chromatography purification of proteins. Specific characterization results "characterization of CV1-PE38 and CV1-PE38-DNA conjugate", thiol-modified DNA was reacted with maleimide-C3-NTA groups to label NTA groups on the DNA, and then His-tagged recombinant protein, ni ²⁺, were mixed and reacted with them to prepare nucleic acid protein conjugates.

11.8 Characterization of IT and IT-O

IT was expressed using the e.coli expression system and expression of immunotoxins was successfully verified by SDS-PAGE. As shown in FIG. 10, the left and right lanes are protein bands of CV1-PE38 after nickel column purification and concentration in a 10k ultrafiltration tube, respectively, and the size was about 55kD, which indicates successful expression of CV1-PE 38.

Positive cells MCF-7 (CD 47 high expression) and negative cells (CD 47 low expression) HepG2 were determined, targeting of CV1-PE38 was first characterized, CV1-PE38 was labeled with a fluorescence labeled secondary antibody against His tag as shown in fig. 11, and the ability of immunotoxins and their conjugates to target MCF-7 cells was tested. As a result, as shown in FIG. 11, the IT-O group (conjugate) and the IT group (CV 1-PE 38) treated cells each carried a large amount of fluorescence, but the IT-O group fluorescence shift was relatively weak, presumably resulting from overlapping of the binding sites of the IT-O and the fluorescent-labeled secondary antibody. The ability of CV1-PE38 to kill both cells was then evaluated at 50nM and 200nM, and the results showed that about 80% of cell killing was achieved by both 50nM and 200nM CV1-PE38, but almost no HepG2 cells were killed by CV1-PE38 at the same concentration, and all the results showed that CV1-PE38 could specifically kill MCF-7 cells highly expressing CD 47.

A protein nucleic acid conjugate (IT-O/CV 1-PE 38-O) was then prepared using the Ni-NTA strategy, with the O chain being fluorescently labeled with FAM. The results, as shown in FIG. 12 at A, B, demonstrate the specific targeting of the conjugates, were very strong in targeting MCF-7 (positive cells) at a concentration of 200nM, while HepG2 (negative cells) had no fluorescent shift. The conjugates were further tested for cytotoxicity against both cells and the results are shown in FIG. 12C, consistent with the results of 11.9 above.

11.9 Control of cell death

After verifying the normal functions of the anchoring module and the sensing module of the toolbox, the invention characterizes the overall operation condition of the toolbox, and the overall operation condition is observed and photographed by a fluorescence confocal microscope. As shown in FIG. 13, the I chain in the folded paper carries a quenching group, the O chain of the conjugate carries a fluorescent group, and the I/O chain is quenched by fluorescence in a bound state, whereas at pH 6.0, the I chain and the O chain are separated, and the fluorescence of the O chain is recovered. The results of this section were visualized through the whole workflow of the cell surface fluorescence visualization nanokit, stained with Dox embedded between double strands, but all showed the invasiveness of red fluorescence, presumably due to the Dox not washing clean, resulting in the Dox fluorescence invading into the cell interior, thus eliminating the red fluorescence channel, considering only the green fluorescence results of IT-O (fig. 14). The invention synthesizes an I-motif with the C-rich core sequence deleted, and prepares a nano Toolbox (Toolbox) of CV1-PE38 as a control, and prepares a Toolbox without a response module as a control. The results in the figure show that the a1+toolbox (pH 7.4) group is not green fluorescent, while the a1+toolbox (pH 6.0) group is green fluorescent, while the Toolbox (pH 6.0) group is not green fluorescent, indicating that the Toolbox is fully anchored to the cell surface, and when pH 6.0, the switch is opened to release the conjugate to target the cell surface, causing the cell to carry green fluorescent. The cell surface of the a1+toolbox (pH 6.0) group does not have green fluorescence, and comparison with the a1+toolbox (pH 6.0) group shows that the switchless Toolbox does not release the internal conjugate, so that the cells carry green fluorescence, and meanwhile, all the sensing switches are positioned in the paper folding, otherwise, the free-state I/O-CV1-PE38 conjugate also carries green fluorescence and targets the cell surface under the condition of pH 6.0. The above results demonstrate the full flow path of the sensor switch inside the kit, the anchoring of the sensor kit to the cell surface and the release of functional groups and function of the entire kit in response to pH.

Finally, the invention tests the cell specific killing generated by the kit in response to pH, and incubates the purified nano kit with MCF-7 cells and HepG2 under the condition of different pH values, and the result is shown in figure 15. At pH 7.8 (pH of DMEM medium), MCF-7 cells loaded in the kit have about 20% decrease in cell viability, but at an environmental pH of 6.0, hepG2 cells loaded in the kit have about 60% decrease in cell viability, without significant change in cell viability at both pH. The results demonstrate that the sensing kit can release the contents in response to an acidic environment to produce specific cell killing, but at pH 7.8 the MCF-7 cell viability of the loading kit is reduced by 20%, presumably the kit is partially disintegrated within 48 hours of incubation time, and the contents leak to reduce cell viability.

11.10CD47 functional characterization of PD1

The CD47-PD1 expression plasmid is constructed and expressed in escherichia coli BL21 (DE 3), after being purified and concentrated by a nickel column, SDS-PAGE is used for characterizing the CD47-PD1 protein, the A result in FIG. 16 shows that the band after the concentration of the CD47-PD1 is about 30kD (red frame circles), and the successful expression of the functional group is proved. Then, the functional characterization is carried out, and the flow cytometry analyzes the targeting of the CD47 nano antibody and the targeting of the PD1 nano antibody, wherein the target cells are selected from A431 which highly express CD47 and T cells which highly express PD 1. The flow results after preparing the nucleated acid protein conjugate using the Ni-NTA strategy are shown in FIG. 16 at B, C, and the cells after nanobody treatment have stronger fluorescence shift, which proves the targeting ability of CD47-PD 1.

The effect of CD47-PD1 on a431 and T cell interactions was then further observed by confocal fluorescence microscopy. A431 After mixing (green) and T cells (red), the two cells were not linked when incubated for 1 hour at room temperature at a tumor cell to immune cell ratio of 1:10, and there was significant cell adhesion of the two cells when CD47-PD1 was added, whereas cell adhesion of the negative cells HepG2 (CD 47 underexpression) and T cells was not affected by CD47-PD 1. See fig. 17.

The invention tests the activation ability of CD47-PD1-O (alpha CD47/PD 1-O) to T cells, and the tested indexes are IFN-gamma secretion and cytotoxicity. Through investigation, A431 is a tumor cell which highly expresses PDL1 and has stronger inhibition on T cells, can inhibit IFN-gamma secretion, and HepG2 does not express PDL1 as a negative control. The effect of nanobody on IFN-gamma secretion from T cells after bead activation have extremely high IFN-gamma secretion capacity, but after co-incubation with A431, secretion amount decreases because it inhibits T cells through PDL1/PD1 pathway, as shown in FIG. 18A. However, the mixed system treated by CD47-PD1 has improved IFN-gamma secretion, and the result shows that the bifunctional antibody and the nucleic acid protein conjugate thereof can promote the secretion of IFN-gamma by T cells. Meanwhile, the present invention also tested the killing ability of T cells against a431 and HepG2, as shown in fig. 18B, the magnetic bead activated T cells did not significantly kill a431 because their activity was inhibited, and when CD47-PD1-O was added, the tumor killing ability of T cells was increased, and the cell viability of a431 was reduced to about 50%. And for a negative cell HepG2, the T cell can kill the cell strongly under the condition of the existence of CD47-PD1, and the cell activity is below 40% after 48h culture. This result indicates that CD47-PD1 can increase the killing ability of T cells against tumor cells and promote IFN- γ secretion by T cells.

11.11 Control of immune and tumor cell interactions

After verifying the feasibility of the internal sensing core of the toolbox and the cholesterol anchoring strategy, the invention constructs a complete sensing toolbox and anchors the complete sensing toolbox on the surface of T cells, controls the state of the nanometer toolbox through cell culture mediums with different pH values, further controls the interaction of immune cells and tumor cells, and the experimental result is obtained by observing and photographing through a fluorescence confocal microscope. As shown in fig. 19, after mixing T cells (red) and a431 cells (green), both cells did not adhere, and T cells treated with the kit also did not adhere after mixing with a431 at pH 7.4. When the pH was adjusted to 6.0, both cells produced cell adhesion under the action of CD47-PD1, and even one A431 cell linked to multiple T cells, and the results confirmed the ability of the kit to control cell adhesion in response to pH changes.

The invention then characterizes kits (Toolbox) without sensing core at different pH and the ability of the kits to activate and kill T cells. In FIG. 20, A is the control of the killing capacity of the kit, and the killing capacity of T cells on A431 is enhanced and the activity of A431 cells is reduced at pH 6.0. The kit without sensing core (Toolbox) showed no significant change in a431 cell viability under different pH conditions, and the result indicated that the nanokit could activate T cell killing of tumor cells by releasing functional groups in response to pH values. In FIG. 20, B is the control of T cell activation by the nanokit under different pH conditions, and since IFN-gamma is sensitive to acidity, the subsequent culture environment needs to maintain pH around 7, after incubation for 30min in a medium with pH of 6 using the kit and T cells, pH is adjusted to around 7 with a slightly alkaline medium, and then incubated with A431, and the pH of the medium is not too low for 3 days, which would affect IFN-gamma content, and finally ELISA kit is used to test IFN-gamma content. At pH 6, the kit responds and releases CD47-PD1 for blocking the PD1/PDL1 pathway, avoiding inhibition of A431, and thus the group has higher IFN-gamma levels. Meanwhile, the IFN-gamma level of the inactivated toolbox group is not obviously changed due to no release of functional groups, and the results together indicate that the sensing toolbox controls the interaction (activation and cell adhesion) of immune cells and tumor cells.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims (2)

1. The DNA sensing tool box comprises a DNA paper folding frame and is characterized by further comprising a sensing core and an anchoring assembly which are respectively assembled on the inner surface and the outer surface of the DNA triangular prism paper folding frame;

The sensing switch is an I-motif sensing switch responding to H ⁺, and the functional component is a nucleic acid-protein conjugate; the anchoring block is a nucleic acid molecule for anchoring the cell surface;

The I-motif sensing switch comprises a first chain and a second chain, wherein the first chain is connected to the DNA triangular prism paper folding frame through base complementation pairing, the second chain is coupled with the functional component, the first chain modifies a fluorescent group, the second chain modifies a quenching group, and the opening and closing states of the I-motif sensing switch are characterized according to quenching and recovery of fluorescence;

When pH > responds to a threshold, the first and second chains merge and remain stable, fluorescence quenching, and switch closing; when the pH is less than the response threshold, the first chain is folded to form a four-chain structure, the second chain is released, the fluorescence intensity is enhanced, and the switch is opened;

The molar ratio of the first strand to the second strand is 1:2, and the nucleotide sequence of the first strand is shown in SEQ ID NO:3, the nucleotide sequence of the second chain is shown as SEQ ID NO:4 is shown in the figure;

the nucleic acid-protein conjugates include CV1-PE38 and CD47-PD1;

The anchoring block comprises a MUC1 aptamer and a cholesterol marked nucleotide chain, and the nucleotide sequence of the MUC1 aptamer is shown in SEQ ID NO:1, the sequence of the cholesterol-tagged nucleotide chain is shown in SEQ ID NO:2 is shown in the figure;

such cells include tumor cells and immune cells;

The DNA triangular prism paper folding frame is formed by fixing M13 ssDNA by using a strand chain by using a nucleic acid self-assembly technology;

the sequence of the strand chain is shown in the following table:

Sequence(s) CCCTTGTTTAAATATCAAGTTAAGATAATAAATGATTAAAAA CAAACCCTCAATAGGGTAGCTTATAAGCAAAACGA TGTTTATATCGGCTGCCGTTTAAGAACGCTATTTTCAAA ATGAAACAATCGAGCTTCAAACTGGTCACGCTACGCAGC TGAGGATAACTCGTCATCATATATAATCAGATTTTGTACCTTAGCA AATTTCTCTCAGAGCCACCACGTTGTTCCTTCACCGTGAGACCTAA ACACCGGAACCAGTCAGGACGCTGGTCACGCTACGCAGC CCTGATAGCCAGAGGTGACCTTGCCAGTTGAATACATT TAACAAATAAGAACTGGCTCA GCGTATTAAGAAAAGTAAGCACTTACCG TTACAAGAGAACCTATTTACATGGGAATGGAGCCGCCA CAGAAAAGATTGACCATAGACTGGAAAAACCCAAC TTATATCATAATTACTAGAAAAGAATAACTGGTCACGCTACGCAGC ACATAAAATTCAGAAAAGCTATCAATATTCAAGAACCC CATTGATCCTTGAAAACATAGTTAATTT CAGAGAGTAATTTGCCAGTTAGCACCCACTGGTCACGCTACGCAGC CCGAAATCGGCAAACATTGACGATATTC GCCTGAGCCCCGGTTGATAATCGCATTACTGGTCACGCTACGCAGC CGAACTGCATCGCCAAAACACCATGAGGCAGCGAACAAC GCGAACTTCTGACCTGAAAGCTGGATTACTGGTCACGCTACGCAGC CGGAAAGACTAAACAGTTGCGGAACCTCGTTGCCA AAAATTAATTCTATTAACGATAGCATAACTAACAA ATGCTGATGAGAGCAACACTACTGGTCACGCTACGCAGC TGAGGAAAAATCTAAAGCATCAGGCGGTCAGTATTTTAATGCCTGGTCACGCTACGCAGC TAGGCTGCTGACGAGAAACACTTAATTTCAACTTTACGGAACCTGGTCACGCTACGCAGC ATTGACCAGCTTTCCGGCACCTTCGCCA CTTTCCACGTATTGGGCGCCAAGCAAGC TCAGCTATTCCAAGGCACTCAGAACCTCGCCTTAATTAT CCTCCCTGACTCCAGGGTCGATTGACGGAGCG AGGTCGAAAGCATAAAGTGTAACATTAACTGGTCACGCTACGCAGC AAGAAACTTATTAATTTTAAAACTAATA AGGTAAAACCACGGAATAAGTGTTAGCACTGGTCACGCTACGCAGC GGATTAGTCACCGTACTCAGGGAGCCACCTGGTCACGCTACGCAGC TCATAACTCGTCATAAATATT ATTTTGTTTAAATGTGAGCGAACGGCGGCTGGTCACGCTACGCAGC CGGGTACTCCACACAACATACCTGCCCGCTGGTCACGCTACGCAGC AGTAATAATTTAGGCAGAGGCATCCCAAATCAACG CACGTTGCAGGAAGATCGCACCTGTTGG TTCCATTTGACCTTGCTTGAGAAGCTCCGGCTTTC AAAGACCGTGCGTTATATCGCCATAAAGGTAACGCGCC GCCGATTTGGTTGCTTTGACGGCGCTGGCTGGTCACGCTACGCAGC GACTCCTGTACCGCCACCCTC ATAATTCGCGTCTGTGGGCGCATCGTAA GGATAAATGACCCTAGTAGTATTCATTTTGGAAGTGCTGTAGAGAC AAATTGTTATCCGCAACCTGTCGTGCCA GACGGTCGAAATCCAAAGAGGCGGGTAATTGCGGGCGAT CAGACTGACAGAATCAAGTTTGCACCGTTCCAGTA CACCCTCCGCCTGTAGCATTCAGACGTT TAAGCGGATACAGTGCCTTAACGGTGGCCTTAGGAGGT GCTACAATTATCCGGTATTCTTTATTTT CAAGTGTGGAAAGCCGGCGAAAATCAAG AGAACACATATAAAAGAAACGATACATACTGGTCACGCTACGCAGC AAATGAAAACAGCCATATTATATCAAGACTGGTCACGCTACGCAGC TTATTACACCGAGGAAACGCACCCAATA TCCTGAAGCATGTAGGAATCAAGAAGGCTTTTATCCAGA AACGTCAGAGCAACTAAAGTACTGGTCACGCTACGCAGC CCAGAACTAGCCCGGAGTTGCGGGTGGTGCGC AAAGAAAAATGCGATTTGCTGCTCTCTTGACAGGCGCA AACGTAGGAACAAAGTTACCACAATGAA GCCAATAACATAACTGATAGCTATGATAGCCAAAATACCAAA AAGTAAGGTGAATTATCACCGGGAAATTCTGGTCACGCTACGCAGC AGATTAAATAAAGCCTGACATGTAAGAGAATAGATAAG ACAAACAACTGGTAATAAGTTCGTATAAACAGTTATTGCTCA GCCGCTTAATACGTAATGCCA AGCGTCAATTCTGAAACATGA GAGTACCTGCGGATGGCTTAGTTCCCAACTGGTCACGCTACGCAGC CCAAAAGTTCGGTCGCTGAGG GCCGTCACCGAACGCACCAGATATACTTACAGAAAACAATAAATTA GCGAACCCTCAACATGTTTTA CTCCGTGGTGCCGGAAGCTGGTAATATCGACCAGTAATAATTCTGGTCACGCTACGCAGC GGATTTTAGAATAGAAAGGAATTGCTTT TTGCGTTTTTTCTTTTCACCAGCCTGGC CTTGCCTAACGAGCGTCTTTCCTGAATCCTGGTCACGCTACGCAGC TTCACAAAAGCCAGTAGGGAAACGAGCGTTTACCGGAA CCCTCAGAAGTTTCCATTAAACAAAAGA AATTTTTTGTAGCCAGCTTTCGATAGGTCTGGTCACGCTACGCAGC ATTCATTAATTAAGAGGCTGACTGGTCACGCTACGCAGC ATTTAAACCCGTCGGAAAGGGACATTCTTTAAAAATACCGATCTGGTCACGCTACGCAGC TCTCCCATTAGACGGGAGAATTAAAAACCTGGTCACGCTACGCAGC CCAGAGCAAAACCGTCACCCACGTGGCGCGCT GACTATTGACTCACCGAAGTAGCGTAGCGCGGCCACCC GTCACACCAGAACAATATTACGTAGAAG TCTCGGAGTGGCTAAACTGAGTTTAATAGGAGATA TTTTTTGACGTCAAAGGGCGACACCACCATAGCCC CCTGAGAAGATAGGGTTGAGTCCTCAGAAAGCGCAGTCTCTG GTCCGTACTAAAAGGGAGAGGCCATGCCTGACGCCAGCTGGCAGAGAAC TTTTAACAGTCAATAGTGAATATGTGAG GAGGCGACGGATTCGCCTGATTATTTGC GGACGACGACAGTAGCGGGCCTCTTCGC GAATTAGTCTAACACCGAAATGAAGGTTATCGATTAGA AAGTACACAGCGATTTTGAGGCGAGGGTTAGTTGCAATT ACCACCAGCAGAAGATAAAACCTAAAACCTGGTCACGCTACGCAGC CGAGGTGGCCGACAATGACAAAGACAGC GGATCACAATCGAGCTCGGCGATTGATCGGTTCGGCCTGTGTAGAGCCT TAAAACGGCGACCTGCTCCATGTTACCCATCCTAA ACGTAAACTGAATAATGGAAGCGGAACA AAAGCCACTTTTGATGATACACTGCCTATTTCGGAAGGATTACTGGTCACGCTACGCAGC TTAATACATCAAGAAAACAAAGAAGATGCTGGTCACGCTACGCAGC AACATTAAGGAATACCACATTAAAATAGCTGGTCACGCTACGCAGC TCATATATCGGTTGTAAATCAAATAACCCAGTTGAAGCTTAAAGGT ATCGGAAACTAAAGACTTTTTTCATCTT ATCGCCAGGCCAACAGAGATATTCACCACTGGTCACGCTACGCAGC ATTGAAGCAAGTCTTTAGGGGGTACTTTTGCGAGA ATCGGTTCGCCCACGCATAACATCGTCACTGGTCACGCTACGCAGC GGGATGTGCTGCAAGAATTCGTAATCAT CGGTGTCGGGGCGCGAGCTGA TTACCTGTTACATCGGGAGAATAAAGAACTGGTCACGCTACGCAGC CATTATCAGCCAACTAAGAATTTTACTACAAATTTTCAAGGT TTAGTTGCGAGGCGTTTTAGCTCGAGAA GAAAGGCCGGAGACAGCAAACAAGAGAA TTTGATTGAGGAATTAGATCGATATTCGGTCGGAACCG GAGTGAGGGGCAACAGCCTAAAGGGAGCCACCACACCCGCATCTGGTCACGCTACGCAGC TAAGGCGACGCGAGAAAACTTTTAGGTTCTGGTCACGCTACGCAGC CCTTATTTCACCAATGAAACCAGCCAGCAAAATCAGGCGACACTGGTCACGCTACGCAGC GGTCCACATAAATCAAAAGAACACCACCCCTCATT CAAGCCCCGTCACCAGTACAACTGTATG AAGGTGGCACGCCACCCTCAGCTGGTCACGCTACGCAGC TTTTTACAGGAGATGGTCAGAACGACAGACCTTGAAAG GTGCCAAGGGTGCCTACGCGCTTAATGCGGTACGCCAGAACACTGGTCACGCTACGCAGC TTACCAACGAGGGAGTTAAAGCTGGTCACGCTACGCAGC AGGAGCACGTGAGCTAACTGTCCATTGATTAAAACGCTTCTGAAAGTAA CGAGAGGATAGTAAAATGTTTAAATCAA CTAGCATGTCAATCCAGCTCATTTTTTA TACAAAGGCCCCAAAAACAGGCGTTAATCTGGTCACGCTACGCAGC CAATTGTAAAAAGATTGATTTTTGTAAATTAAACGCAA GGGTTATTTAGATTAAGACGCTCTGTAA AACCGCCAGCCCTCATAGTTA CAGGAACGCCGCTACAGGGCGACGCTGCCTGGTCACGCTACGCAGC CTCAAGCCTGGCTTGCAGTTGTAAAGCGCCAGCTTCTGGGAACAAGTAA CTCCAACTTGCTGAATATAATTTCATTCCTGGTCACGCTACGCAGC TCAGAACAGTCCACCTAAATCGGAACCT TAGTACAAATCCAATCGCAAGTATGTAACTGGTCACGCTACGCAGC GATTGCCCAGTTTGGAACAAGCGCCACCTTAGCGT ATTCGACTTAGAAGTATTAGACTAGCCTTTATTTCATGCCGGAGCAATA GCGTAACCCCCGATTTAGAGCGGTGCCG TAACGAACTAAATCATTGCTTGCCGCTGACCAGGGAAC TCAGAGCCGGCTCTAGACAGGGTTTGCGCAATCCAGCCGTAATGGATCA TTCAACCGTCACAATCAATAGAGACTCCCTGGTCACGCTACGCAGC CCTGAGTGCCTCAGAGAATTAAGATACAAACGAGTTCATTTTTTTA TCCGTTAAATATATGTAAGTCTGGAGTCAAATGCAATG CGCGCGGGGAGAGGTGCCCCAGCAGGCG GTACCAGGTATAGCCCGGAATGGGATAG TAAAGCATATTAAAGAACGTGCAGAGCCTTTTCAT ATAGAGCCTTATAATTTTCTTTCCCACAGACACCCTCAAGGT AATAAAATGCAGATACATAACTACCAGACTGGTCACGCTACGCAGC ATAAATAGCAGTCAGAGCAAGAAAGAAGGAAGCAGTATTTAT GTACGGGGTTATGCCCCGGAGTGTAATAAATAGAGCCG CGGCATTGCAGCACCGTAATCCTTGAGCCATTTGGGGAGGGACTGGTCACGCTACGCAGC TCTGGTCAGTTGGCAAATCAATGAACCTCAAATAT TTTACATCATTGCAACAGGAAGTAATAA AATATTGAATATACAGTAACACAGGTTTCTGGTCACGCTACGCAGC AGGGAAGCGAAAAAAAAGGCTCTGGTCACGCTACGCAGC CTACGCAAGCAAATCAGATATTTACCGCGCCCAATAGAAGGCACCAACC CCGCCAGATCCCTTGCTGGTTCGGTTTGGTCG TTGGGAAGGAATTACGAGGCA AAATACCTATATTTTAGTTAAACTACCT CGACGATATAGCGTCCAATACTCAGAAA TTTACGACAAGAAAAATAATA TCTGTCCGGCTTAATTGAGAACAAATTCTTACCAGTGGTTTG ACCGACAATTTAACAACGCCATTTAGTATCATATGTGATAAA AGAGTAAATTCAGTGAATAAGGTGAATTACCTTATCTACGTT AAAGGGATGGCAATTCATCAATTCCTGATTATCAGATTGGCA CCTTTGCATAGATAAAGGAAT AGCTAAATTTTAAATCACCATCAATATGGGTCATT AACATTAAATTTTTACCGTTCTAGCTGAAGAGATC GAAGGGCAAGTTGGGTAACGCGGATCCC TGAATAAATTACCTTTTTTAATCGCGCA CATCGTAGAAACCAATCAATACAACAATATAAAGTCACTGCCCGTTAACTAAA CAAGCAAGTCTTTCCTTATCAATGCAGAAAGTAATCACTGCCCGTTAACTAAA TGACCCCACGGAGATTTGTATACCAACTAGGCGCACACTGCCCGTTAACTAAA ATACACTTGATAAATTGTGTCAATCATATTCATCACACTGCCCGTTAACTAAA TCTTAGCCGGAACGAAGAACCCACTGCCCGTTAACTAAA GGATATTCATTATTTCGAGCCCACTGCCCGTTAACTAAA ATTGCGTCTGATTGTTTGGATAGGAGCGGAATTATATTAAATCACTGCCCGTTAACTAA TTCTGCGTTTCGCAAATGGTCTACAGGCAAGGCAAAGCATAACACTGCCCGTTAACTAA CATATAATGTTTAGCTATATTGCATTAACATCCAATACCAAACACTGCCCGTTAACTAA TCAATTCTACTAATGTAATCACTGCCCGTTAACTAAA TTTTGCGGGAGATTACAAACACACTGCCCGTTAACTAAA

The M13 ssDNA was 7249nt in number of bases, purchased from NEW ENGLAND Biolabs, cat# and spec B3003-50pmol.

2. The method for preparing a DNA sensing tool kit according to claim 1, wherein the DNA sensing tool kit is obtained by mixing and incubating a sensing switch, a functional component, an anchoring block and a triangular prism paper folding frame for assembly and performing ultrafiltration after the assembly is completed; the molar ratio of the sensing switch, the functional component, the anchoring block and the triangular prism paper folding frame is 5:5:5:1.