CN111939265A - DNA nano ladder of polyvalent aptamer and preparation method and application thereof - Google Patents
DNA nano ladder of polyvalent aptamer and preparation method and application thereof Download PDFInfo
- Publication number
- CN111939265A CN111939265A CN202010856470.3A CN202010856470A CN111939265A CN 111939265 A CN111939265 A CN 111939265A CN 202010856470 A CN202010856470 A CN 202010856470A CN 111939265 A CN111939265 A CN 111939265A
- Authority
- CN
- China
- Prior art keywords
- dna
- seq
- aptamer
- ladder
- stranded dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
- A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides a DNA nano ladder of a polyvalent aptamer, and a preparation method and application thereof. The invention takes natural DNA molecules as raw materials, on the basis of the DNA paper folding theory, the special property of a rolling circle amplification product is utilized to construct a DNA nano ladder, and a large amount of aptamers are introduced, so that a drug delivery system with simple design, strong drug loading capacity, target specificity and biocompatibility is constructed, and through the substitution of the aptamers or drugs, the carrier can also be applied to various types of target cells.
Description
Technical Field
The invention belongs to the technical field of biomedicine, and relates to a DNA nano ladder of a polyvalent aptamer, and a preparation method and application thereof.
Background
The morbidity and mortality of cancer in China are on the rising trend year by year, and the disease becomes one of four chronic diseases in China. Currently, chemotherapeutic drugs are widely used in cancer therapy, but they induce cytotoxicity in both tumor cells and healthy cells; due to the multi-drug resistance phenomenon, a special protein pump existing in some tumor cells can pump chemotherapeutic drugs such as doxorubicin hydrochloride (Dox) out of the cells to generate drug resistance to the drugs. Therefore, it is a challenge in the field of biomedical technology to develop a targeting drug carrier that is simple in design and can specifically recognize tumor cells.
The DNA nano structure has become a novel drug carrier in recent years, the preparation of the DNA nano structure mainly depends on the self-assembly of DNA, the complementary pairing of DNA chain basic groups is driven through the mutual synergistic effect of hydrogen bonds, stacking, static electricity and hydrophobicity, and the DNA nano structure with a specific structure and function is obtained through the design of a DNA chain sequence. The DNA paper folding technique is a novel self-assembly method, and the design idea is to fold a long single-stranded DNA (ssDNA) as a scaffold chain back and forth, and fix the shape by utilizing a plurality of staple chains (DNA short chains) to obtain a specific structure. In order to further simplify the DNA paper folding, a Rolling Circle Amplification (RCA) product is used as a scaffold chain, and a preset shape is constructed by combining several staple chains by utilizing the periodicity and the large molecular weight of the RCA product, so that the number of the staple chains can be further reduced, and the sequence design is simplified.
Multivalent targeted binding has recently received much attention in the biomedical field due to its advantages such as high affinity, high specificity, etc. The aptamer is developed by the exponential enrichment ligand phylogenetic evolution technology (SELEX), is essentially an oligonucleotide sequence, and can form a stable secondary or tertiary structure through internal force to be specifically combined with a target object (such as a protein). The aptamer is fixed on the surface of a DNA nano structure or a nano particle, the obtained multivalent ligand can be simultaneously combined with a receptor on a target tumor cell to realize high binding affinity and selectivity, the multivalent receptor on a cell membrane can promote endocytosis of the cell, and the treatment efficiency is higher compared with that of a monovalent molecular DNA nano structure.
Disclosure of Invention
The invention aims to provide a DNA nano ladder of a polyvalent aptamer, which is a drug delivery carrier with simple design, strong drug loading capacity and target specificity, can realize specific targeting of tumor cells and induce selective cytotoxicity, thereby greatly reducing the adverse reaction of an anti-tumor drug (such as doxorubicin hydrochloride (Dox)) on normal cells and reducing the side effect of chemotherapy.
In order to achieve the above object, in one aspect, the present invention provides a DNA ladder comprising m tandem repeat units, wherein the repeat units comprise two long single-stranded DNA molecules and 2n short single-stranded DNA molecules, wherein m is an integer of 80 to 320, n is an integer of 3 or more and 7 or less,
wherein, in the repeating unit, the sequences of the two long single-strand DNA molecules are different; at least one short single-stranded DNA molecule in the 2n short single-stranded DNA molecules is connected with an adapter, each short single-stranded DNA molecule is provided with two sections of hybridization regions, one of the two sections of hybridization regions is hybridized with one part of the long single-stranded DNA molecule, the other hybridization region is hybridized with one part of the other short single-stranded DNA molecule to form a double-helix structure, and therefore the two long single-stranded DNA molecules and the 2n short single-stranded DNA molecules are self-assembled into the DNA nano ladder.
In the invention, the 'multivalent' refers to the multivalent binding of multiple ligands and multiple receptors, the number of ligand-receptor binding pairs is the valence state, and a large number of aptamers contained in the DNA nano ladder can realize multivalent binding with receptors on cell membranes.
In the repeat unit of the present invention's multivalent aptamer DNA nano ladder, preferably, the two long single-stranded DNA molecules may be the same length. Preferably, the long single-stranded DNA molecule may be 13-240 bp in length, more preferably 63 bp. In one embodiment, the two long single-stranded DNA molecules are represented by (GGTGCTTAGTCGAAAGAAAGAAAGGAAGAAGTTTCAAGGAAAGGAAACAAGAAGGCGAAGACA, SEQ ID NO:13) and (AGGGCTTGGCATAGACGAGTTGACAGAGACGGAATCCGACCATTGTGCGCTATCTTCATCTTA, SEQ ID NO: 14).
In the DNA nano ladder consisting of m tandem repeat units, the finally formed long single-strand DNA has periodicity and high molecular weight. The length of the long single-stranded DNA is mainly influenced by the Rolling Circle Amplification (RCA) reaction time and the concentration of dNTPs, and the length can be selected from the range of about 5000bp to 20000bp, and more preferably the length is about 8000 bp. Preferably, the length of the two long single-stranded DNAs may be the same. More preferably, both long-chain DNA molecular chains A, B have about 127 tandem repeats of 63 bases; the molecular weight of the long-chain DNA molecular chain A is about 19708g/mol, and the molecular weight of the long-chain DNA molecular chain B is about 19448 g/mol.
In the repeating unit of the DNA nano ladder of the invention, the short single-stranded DNA molecule is a segment of oligonucleotide (a general term for short-chain nucleotides with less than 50 bases). The more GC base pairs per strand, the higher the drug loading. In a specific embodiment, the short single-stranded DNA molecules are each 42bp in length. In one embodiment, the 2n short single-stranded DNA molecules (wherein n ═ 3) are shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO: 12. In the invention, the lengths of the short single-stranded DNA molecules are required to be the same, and the short single-stranded DNA molecules have two sections of hybridization regions which are respectively hybridized and folded with the long single-stranded DNA molecules and the other (adjacent) short single-stranded DNA molecules in pairs to form a rectangular region, thereby finally constructing a ladder-shaped DNA nano structure (DNA nano ladder). In the invention, the sequence of each short single-stranded DNA molecule is divided into two sections of hybridization regions, the sequence of one section of hybridization region must be complementary with the long single-stranded DNA molecule, the sequence of one section of hybridization region is complementary with the other (adjacent) short single-stranded DNA molecule, the sequence forming the hybridization region can select any complementary base, but the sequence design of the short single-stranded DNA molecule is to avoid forming special DNA secondary structures such as hairpin structure, G-quadruplex and the like as much as possible.
In the repeating unit of the DNA nano ladder of the polyvalent aptamer, m can be an integer of 100-150, and m is 127; n is an integer of 3 to 5, and more preferably, n is 3.
In a specific embodiment, in the multivalent aptamer DNA nano ladder of the invention, the aptamer is labeled with a fluorophore at the 5' end. In one embodiment, the fluorophore can be carboxyfluorescein (FAM), or Cy 5.
In one embodiment, the DNA nano ladder of the multivalent aptamer has a theoretical width of about 5.4nm to 13.9nm, preferably about 11(4+21 × 0.34 ═ 11.1) nm; the theoretical length is about 1700nm to 6800nm, preferably about 2700(8000 × 0.34 ═ 2720) nm. The width of the DNA nano ladder can be controlled by short single-stranded DNA molecule design sequences, and the length can be controlled by Rolling Circle Amplification (RCA) reactions.
In the invention, the width of the DNA nano ladder can be controlled by directly changing the length of the hybridization region of two short single-stranded DNA molecules.
In the DNA nano ladder of the present invention, there is no particular limitation on the selection of the aptamer. As long as specific targeting of tumor cells can be achieved. An aptamer is essentially a DNA or RNA oligonucleotide sequence that can form a stable secondary structure such as a hairpin structure, a pseudoknot, a G-quadruplex, etc., through base complementary pairing to form a stable complex with a receptor, and the binding has high bond and degree and selectivity. The aptamer may be a tumor cell aptamer that specifically binds to a receptor protein on the cell membrane, for example, acute lymphoblastic leukemia T-lymphocyte (CCRF-CEM) aptamer Sgc8, which specifically binds to protein tyrosine kinase 7(PTK7), PTK7 is overexpressed on CCRF-CEM cells; or human breast cancer cell (MCF-7) aptamer S2.2, which can be specifically combined with MUC1 protein, and MUC1 is over-expressed on MCF-7 cells; or aptamer AS1411, which can specifically bind to the broad-spectrum tumor marker nucleolin. A plurality of aptamers are connected to one side of the DNA nano ladder to form a multivalent aptamer structure.
In one embodiment, the aptamer may be acute lymphoblastic leukemia T-lymphocyte (CCRF-CEM) aptamer Sgc8, the aptamer may specifically bind to protein tyrosine kinase 7(PTK7), PTK7 is overexpressed on CCRF-CEM cells, and a plurality of aptamers are attached to one side of a DNA nano ladder to form a multivalent aptamer structure to bind to the CCRF-CEM cells, thereby achieving specific detection.
In one embodiment, the aptamer may also be human breast cancer cell (MCF-7) aptamer S2.2 or broad-spectrum aptamer AS 1411.
In another aspect, the present invention provides a method for preparing the DNA nano ladder as described above, comprising the steps of:
(1) synthesizing two long single-stranded DNAs each having a nucleotide sequence of m long single-stranded DNA molecules connected in series by Rolling Circle Amplification (RCA) reactions, respectively;
(2) and (2) constructing the DNA nano ladder by combining m multiplied by 2n short single-stranded DNA molecules by taking the two long single-stranded DNAs synthesized in the step (1) as scaffold chains based on DNA origami.
Preferably, in the preparation method, in the step (1), the circular DNAs shown as SEQ ID NO. 1 and SEQ ID NO. 2 are respectively used as templates, Phi29 DNA polymerase (10U/. mu.L) is added to initiate reaction in the presence of DNA primers shown as SEQ ID NO. 3 and SEQ ID NO. 4, Phi29 DNA polymerase buffer solution and dNTPs, the reaction is incubated at 30 ℃ for 10min, and then the temperature is raised to 65 ℃ to inactivate the Phi29 DNA polymerase, so as to prepare the long single-strand DNA shown as SEQ ID NO. 5 and SEQ ID NO. 6.
The preparation method preferably comprises, in the step (2), sequentially taking the long single-stranded DNA shown in SEQ ID NO. 5 and SEQ ID NO. 6 and the short single-stranded DNA molecules shown in SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12, (wherein, preferably, the concentration ratio of the long single-stranded DNA to the short single-stranded DNA molecules is 1: 10-200, more preferably 1:10, 1:20, 1:50, 1:100, 1:150 or 1:200, and the optimal concentration ratio is 1:100), adding the long single-stranded DNA and the short single-stranded DNA into a centrifuge tube containing an annealing buffer solution, wherein the annealing buffer solution is a centrifuge tube containing 12mM Mg2+The TAE buffer solution is mixed uniformly and properly lowAnd (3) quickly centrifuging, carrying out heat treatment at 95 ℃ for 5min, naturally annealing to 25 ℃, and standing overnight to obtain the DNA nano ladder.
In one embodiment, the present invention provides a method of constructing the above-described multivalent aptamer DNA nano ladder, comprising the steps of:
1) preparation of Long Single-stranded DNA:
the Rolling Circle Amplification (RCA) reactions were performed with the circular DNA templates A, B shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively, and 2. mu.L of the primers (10. mu.M) shown in SEQ ID NO. 3 and SEQ ID NO. 4, 2. mu.L of the circular DNA template (10. mu.M), 2. mu.L of the 10 XPhi 29 DNA polymerase buffer and 2. mu.L of dNTPs (7mM) were sequentially added to each reaction system, followed by ddH supplementation2O to the total volume of 20 mu L, adding 0.8 mu L Phi29 DNA polymerase (10U/. mu.L) to initiate reaction, incubating at 30 ℃ for 10min, raising the temperature to 65 ℃ to inactivate the Phi29 DNA polymerase, and preparing Rolling Circle Amplification (RCA) products, namely a strand A and a strand B, shown as SEQ ID NO:5 and SEQ ID NO: 6;
2) preparing a DNA nano ladder:
in step 1), 1 μ L of each of the product chain A and chain B of the Rolling Circle Amplification (RCA), such as1 μ L (concentration 100 μ M) of the short chains 1-6 shown in SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12, is added into a centrifuge tube containing an annealing buffer solution containing 12mM Mg2+TAE buffer of (5), supplement of ddH2O to 100 mu L, mixing evenly, centrifuging at a proper low speed, carrying out heat treatment at 95 ℃ for 5min, naturally annealing to 25 ℃, and standing overnight to obtain the DNA nano ladder.
In another aspect, the present invention provides a DNA nano ladder-antitumor drug complex of a polyvalent aptamer, wherein the DNA nano ladder is used as a drug carrier to load an antitumor drug.
In the present invention, the mode of loading the antitumor drug is not particularly limited. For example, in one embodiment, the anti-neoplastic drug can be inserted between DNA duplexes by physical binding to form a DNA nano ladder-anti-neoplastic drug complex. In this case, the antitumor agent may be an anthracycline anticancer drug such as doxorubicin hydrochloride (Dox), Daunorubicin (DNR) and Epirubicin (EPR), whose aromatic group may be partially inserted between DNA base pairs to coordinate with guanine bases on the DNA strand. In one embodiment, the anti-tumor drug may be doxorubicin hydrochloride (Dox). Alternatively, for example, in the present invention, at least one of the short single-stranded DNA molecules not linked to the aptamer may be extended by a cohesive end to anchor gene-based antitumor drugs such as small interfering rna (sirna), cytosine-phosphate-guanosine (CPG), and the like, thereby obtaining the DNA nano ladder multiple drug delivery system.
In another aspect, the present invention provides a method for preparing the DNA nano ladder-antitumor drug complex of the polyvalent aptamer, comprising the step of loading an antitumor drug using the DNA nano ladder as a drug carrier.
In one embodiment, the DNA nano ladder obtained by the above preparation method is incubated with an anti-tumor drug (e.g., doxorubicin hydrochloride (Dox)) to prepare a complex. In the preparation method of the above-mentioned complex, preferably, the DNA nano ladder is incubated with 200nM antitumor drug (e.g., doxorubicin hydrochloride (Dox)) at 30 ℃ for 30min to prepare DNA nano ladder-antitumor drug (e.g., Dox complex) capable of loading about 2000 antitumor drug molecules (e.g., doxorubicin hydrochloride (Dox)) per DNA nano ladder.
In one embodiment, the present invention provides a method for preparing a DNA nano ladder-Dox complex, comprising the steps of: incubating 2 μ L of the prepared DNA nano ladder with 98 μ L of doxorubicin hydrochloride (Dox) with a concentration of 200nM at 30 deg.C for 30min to obtain the DNA nano ladder-Dox compound.
The DNA nano ladder of the invention can have slow release property. The DNA nano ladder is stably present in Phosphate Buffered Saline (PBS) or Fetal Bovine Serum (FBS) that mimics the extracellular environment; under conditions that mimic the intracellular environment and contain an endonuclease (D Nase I), the DNA nano ladder is destroyed and the inserted drug is slowly released.
The drug release of the DNA nano ladder-antitumor drug (e.g., Dox) complex of the present invention: to simulate the intracellular environment, 3. mu.L of 1U/. mu.L of DNA endonuclease (D Nase I) was added to the DNA nano ladder-antitumor drug (e.g., Dox) complex, the DNA double-stranded structure was destroyed, and the drug was slowly released within 20 min.
On the other hand, the invention provides the application of the DNA nano ladder of the polyvalent aptamer in the preparation of a drug carrier, in particular an anti-tumor drug carrier.
In another aspect, the present invention provides the use of the above-described DNA ladder for the preparation of diagnostic reagents.
In particular embodiments, the multivalent aptamer DNA nano ladder comprises Sgc8 aptamers and the diagnostic reagent can be used to detect acute lymphoblastic leukemia T lymphocytes.
In another aspect, the invention provides the use of the DNA nano ladder-Dox complex described above in the preparation of a medicament for the treatment and/or diagnosis of tumors.
Advantageous effects
Compared with the prior art, the invention has the advantages that:
(1) the DNA nano ladder has the advantages of proper size, space addressability, strong biocompatibility, easy functional modification and the like, can be used for conveying various anti-cancer drugs such as tumor targeting ligands, small interfering RNA (siRNA), doxorubicin hydrochloride (Dox), cytosine-phosphate-guanosine (CPG) and the like, and is an excellent drug carrier. (2) The Rolling Circle Amplification (RCA) technology is used as an efficient isothermal enzymatic amplification means, the product has periodicity and high molecular weight, and can be used as a support chain for periodically assembling a DNA nano ladder, so that the assembly design is simplified. (3) Due to the special two-dimensional and three-dimensional structure of the aptamer, the aptamer has high affinity and selectivity in combination with a target, and can specifically recognize the target protein on a cell membrane.
The invention takes natural DNA molecules as raw materials, on the basis of the DNA paper folding theory, the special property of a Rolling Circle Amplification (RCA) product is utilized to construct a DNA nano ladder, a large amount of aptamers are introduced, a drug delivery system with simple design, strong drug loading capacity, target specificity and biocompatibility is constructed, and the vector can be applied to various types of target cells through the substitution of the aptamers or drugs.
Drawings
FIG. 1 shows the self-assembly and functional schematic of DNA nano ladders for drug delivery. Wherein: a schematically shows a process of obtaining a long single-stranded DNA molecule by an RCA reaction using a circular DNA as a template; b schematically shows the process that 2 long-chain ssDNA molecules and 6 short-chain ssDNA molecules are self-assembled into a DNA nano ladder repeating unit, and an anti-tumor drug Dox (represented by a solid circle) is inserted between DNA double chains in a physical combination mode to form a DNA nano ladder-Dox compound; c schematically shows that the aptamer of the DNA nano ladder-Dox complex with 3 repeating units can specifically bind to a target receptor on a tumor cell, and the DNA nano ladder-Dox complex is finally degraded by nuclease in the cell to release a drug due to the fact that the endocytosis of the cell is enhanced by the multivalent effect.
FIG. 2 is an agarose gel electrophoresis of the Rolling Circle Amplification (RCA) product of example 1.
FIG. 3 shows the morphological characterization of the DNA nano-ladder of example 2, wherein (a) is a transmission electron microscopy image of the DNA nano-ladder; (b) is an atomic force microscope image.
FIG. 4 is a graph of the DNA nano ladder drug loading and release results in examples 3 and 4. (a) Monitoring doxorubicin hydrochloride (Dox) loading on the DNA nano ladder based on doxorubicin hydrochloride (Dox) fluorescence quenching; (b) in the presence of DNase I, doxorubicin hcl (Dox) was released from the DNA nano ladder-Dox complex.
Detailed Description
In order to make the content of the present invention more comprehensible, the technical solutions in the embodiments of the present invention will be described clearly and completely below, but the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. The scope of the invention is defined by the appended claims.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The DNA sequences used in the present invention were purchased from Biotechnology Ltd. Agarose, TAE buffer, DNA Ladder was purchased from Shanghai Biyuntian Biotechnology Ltd. Doxorubicin hcl was purchased from shanghai source, leafy biotechnology limited. The experimental water was ultrapure water prepared by Milli-Q IQ7000 type ultrapure water system of Milli, France.
Example 1: method for preparing Rolling Circle Amplification (RCA) product
Rolling Circle Amplification (RCA) reactions were performed with the circular DNA templates A, B, respectively, in which 2. mu.L of the primer (10. mu.M), 2. mu.L of the circular DNA template (10. mu.M), 2. mu.L of 10 XPhi 29 DNA polymerase buffer and 2. mu.L of dNTPs (7mM) were added to each reaction system in this order, and ddH was supplemented2And O to the total volume of 20 mu L, adding 0.8 mu L Phi29 DNA polymerase (10U/. mu.L) to initiate reaction, uniformly mixing, centrifuging at a proper low speed, placing in a constant temperature shaking instrument for incubation at 30 ℃ for 10min, then keeping the temperature at 65 ℃ for 10min, and inactivating the Phi29 DNA polymerase to obtain Rolling Circle Amplification (RCA) products, namely a strand A and a strand B. The Rolling Circle Amplification (RCA) product was characterized by agarose gel electrophoresis to a length of about 8000 nt.
Table 1: oligonucleotide sequences referred to in example 1
Example 2: preparation method of DNA nano ladder
mu.L each of the Rolling Circle Amplification (RCA) products, strand A and strand B, prepared in example 1, and 1. mu.L each of the short strands 1-6 (concentration: 100. mu.M) were added to a container containing 42. mu.L of 2 XTAE-Mg2+(24mM) in a centrifuge tube, ddH was added2O to 100 mu L, mixing evenly, centrifuging at a proper low speed, carrying out heat treatment at 95 ℃ for 5min, naturally annealing to 25 ℃ to prepare the DNA nano ladder.
The transmission electron microscope was tested at an acceleration voltage of 200 KV. Preparation of transmission electron microscope samples: and (3) dropwise adding a 5 mu LDNA nano ladder sample onto a copper net, standing for 5 minutes, dyeing for 1 minute by using 1% uranyl acetate, and testing after the sample is completely dried.
The self-assembled product was characterized by a transmission electron microscope, and as shown in fig. 3(a), it was seen that the product had a linear shape with a width of about 10nm, which was in accordance with the theoretical width of the design.
Tapping Mode (Tapping Mode AFM) test is selected by an atomic force microscope. Atomic force microscope sample preparation: a10 μ LDNA nano ladder sample was dropped onto the mica plate for 10 minutes of sedimentation, followed by ddH2O wash 10 times and test after the sample is completely dried.
Due to the large aspect ratio of the DNA nano ladders, they have a certain flexibility, as shown in fig. 3(b), and the entanglement between the DNA nano ladders can be seen on the atomic force microscope image.
Table 2: oligonucleotide sequences used in example 2
Note: the underlined part in short chain 6 indicates Sgc8 the aptamer sequence, which in this example is labeled with a fluorophore at the 5' end.
Example 3: drug Loading experiments
The fixed Dox concentration was 200nM, the DNA nano ladder concentrations were 1nM, 0.4nM, 0.2nM, 0.1nM, 0.04nM, 0.02nM, 0.01nM, 0.005nM, 0.0025nM, respectively, after mixing well, centrifugation, incubation at 30 ℃ for 30 min.
The detection method selected by the microplate reader is fluorescence intensity detection, the detection type is an end point scanning mode, the excitation wavelength is set to be 485nm, the emission wavelength is set to be 590nm, and the detection temperature is 30 ℃.
The preparation method of the DNA nano ladder-Dox compound comprises the following steps: 200nM antitumor drug doxorubicin hydrochloride (Dox) was incubated with 1nM, 0.4nM, 0.2nM, 0.1nM, 0.04nM, 0.02nM, 0.01nM, 0.005nM, 0.0025nM DNA nano ladder at 30 deg.C for 30 min.
The antitumor drug doxorubicin hydrochloride (Dox) is inserted between G-C bases of a DNA double strand in a physical combination mode to form a DNA nano ladder-Dox compound, and autofluorescence is quenched. As shown in FIG. 4(a), DNA nano ladders of various concentrations were incubated with 200nM doxorubicin hydrochloride (Dox), and the Dox fluorescence intensity was measured by a microplate reader. The Dox fluorescence quenching degree increases with the increase of the concentration of the DNA nano ladder, when the concentration of the DNA nano ladder is 0.1nM, the curve reaches the inflection point, and the maximum drug loading of the DNA nano ladder is analyzed to be about 1:2000 in terms of the molecular ratio of the DNA nano ladder to the drug.
Example 4: drug Release test
And (3) selecting dynamic detection by the microplate reader, wherein the detection time is 90min, the detection time interval is 30s, the detection method is fluorescence intensity detection, the detection type is an end point scanning mode, the excitation wavelength is set to be 485nm, the emission wavelength is set to be 590nm, and the detection temperature is 30 ℃.
The DNA nano ladder-Dox compound simulates the release of intracellular environment drugs: incubating the DNA nano ladder-Dox with 200nM Dox and 0.1nM DNA nano ladder at 30 deg.C for 30min to obtain the DNA nano ladder-Dox compound. 3 muL of 1U/muL DNA endonuclease (D NaseI) is added into the DNA nano ladder-Dox compound, the double-chain structure of the DNA is destroyed, as shown in figure 4(b), the Dox fluorescence intensity recovery is measured by an enzyme-linked immunosorbent assay (excitation and emission wavelengths are 485 and 590nm respectively), and the drug is slowly released within 20 min.
Sequence listing
<110> China university of Petroleum (east China)
Anqiu plasticizer factory
<120> DNA nano ladder of polyvalent aptamer and preparation method and application thereof
<130> DI20-0910-XC37
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 63
<212> DNA
<213> Artificial sequence
<220>
<223> circular DNA template A
<400> 1
tgtcttcgcc ttcttgtttc ctttccttga aacttcttcc tttctttctt tcgactaagc 60
acc 63
<210> 2
<211> 63
<212> DNA
<213> Artificial sequence
<220>
<223> circular DNA template B
<400> 2
tcccgaaccg tatctgctca actgtctctg ccttaggctg gtaacacgcg atagaagtag 60
aat 63
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> primer A
<400> 3
ggcgaagaca ggtgcttagt c 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> primer B
<400> 4
cggttcggga attctacttc t 21
<210> 5
<211> 8001
<212> DNA
<213> Artificial sequence
<220>
<223> chain A
<400> 5
ggtgcttagt cgaaagaaag aaaggaagaa gtttcaagga aaggaaacaa gaaggcgaag 60
acaggtgctt agtcgaaaga aagaaaggaa gaagtttcaa ggaaaggaaa caagaaggcg 120
aagacaggtg cttagtcgaa agaaagaaag gaagaagttt caaggaaagg aaacaagaag 180
gcgaagacag gtgcttagtc gaaagaaaga aaggaagaag tttcaaggaa aggaaacaag 240
aaggcgaaga caggtgctta gtcgaaagaa agaaaggaag aagtttcaag gaaaggaaac 300
aagaaggcga agacaggtgc ttagtcgaaa gaaagaaagg aagaagtttc aaggaaagga 360
aacaagaagg cgaagacagg tgcttagtcg aaagaaagaa aggaagaagt ttcaaggaaa 420
ggaaacaaga aggcgaagac aggtgcttag tcgaaagaaa gaaaggaaga agtttcaagg 480
aaaggaaaca agaaggcgaa gacaggtgct tagtcgaaag aaagaaagga agaagtttca 540
aggaaaggaa acaagaaggc gaagacaggt gcttagtcga aagaaagaaa ggaagaagtt 600
tcaaggaaag gaaacaagaa ggcgaagaca ggtgcttagt cgaaagaaag aaaggaagaa 660
gtttcaagga aaggaaacaa gaaggcgaag acaggtgctt agtcgaaaga aagaaaggaa 720
gaagtttcaa ggaaaggaaa caagaaggcg aagacaggtg cttagtcgaa agaaagaaag 780
gaagaagttt caaggaaagg aaacaagaag gcgaagacag gtgcttagtc gaaagaaaga 840
aaggaagaag tttcaaggaa aggaaacaag aaggcgaaga caggtgctta gtcgaaagaa 900
agaaaggaag aagtttcaag gaaaggaaac aagaaggcga agacaggtgc ttagtcgaaa 960
gaaagaaagg aagaagtttc aaggaaagga aacaagaagg cgaagacagg tgcttagtcg 1020
aaagaaagaa aggaagaagt ttcaaggaaa ggaaacaaga aggcgaagac aggtgcttag 1080
tcgaaagaaa gaaaggaaga agtttcaagg aaaggaaaca agaaggcgaa gacaggtgct 1140
tagtcgaaag aaagaaagga agaagtttca aggaaaggaa acaagaaggc gaagacaggt 1200
gcttagtcga aagaaagaaa ggaagaagtt tcaaggaaag gaaacaagaa ggcgaagaca 1260
ggtgcttagt cgaaagaaag aaaggaagaa gtttcaagga aaggaaacaa gaaggcgaag 1320
acaggtgctt agtcgaaaga aagaaaggaa gaagtttcaa ggaaaggaaa caagaaggcg 1380
aagacaggtg cttagtcgaa agaaagaaag gaagaagttt caaggaaagg aaacaagaag 1440
gcgaagacag gtgcttagtc gaaagaaaga aaggaagaag tttcaaggaa aggaaacaag 1500
aaggcgaaga caggtgctta gtcgaaagaa agaaaggaag aagtttcaag gaaaggaaac 1560
aagaaggcga agacaggtgc ttagtcgaaa gaaagaaagg aagaagtttc aaggaaagga 1620
aacaagaagg cgaagacagg tgcttagtcg aaagaaagaa aggaagaagt ttcaaggaaa 1680
ggaaacaaga aggcgaagac aggtgcttag tcgaaagaaa gaaaggaaga agtttcaagg 1740
aaaggaaaca agaaggcgaa gacaggtgct tagtcgaaag aaagaaagga agaagtttca 1800
aggaaaggaa acaagaaggc gaagacaggt gcttagtcga aagaaagaaa ggaagaagtt 1860
tcaaggaaag gaaacaagaa ggcgaagaca ggtgcttagt cgaaagaaag aaaggaagaa 1920
gtttcaagga aaggaaacaa gaaggcgaag acaggtgctt agtcgaaaga aagaaaggaa 1980
gaagtttcaa ggaaaggaaa caagaaggcg aagacaggtg cttagtcgaa agaaagaaag 2040
gaagaagttt caaggaaagg aaacaagaag gcgaagacag gtgcttagtc gaaagaaaga 2100
aaggaagaag tttcaaggaa aggaaacaag aaggcgaaga caggtgctta gtcgaaagaa 2160
agaaaggaag aagtttcaag gaaaggaaac aagaaggcga agacaggtgc ttagtcgaaa 2220
gaaagaaagg aagaagtttc aaggaaagga aacaagaagg cgaagacagg tgcttagtcg 2280
aaagaaagaa aggaagaagt ttcaaggaaa ggaaacaaga aggcgaagac aggtgcttag 2340
tcgaaagaaa gaaaggaaga agtttcaagg aaaggaaaca agaaggcgaa gacaggtgct 2400
tagtcgaaag aaagaaagga agaagtttca aggaaaggaa acaagaaggc gaagacaggt 2460
gcttagtcga aagaaagaaa ggaagaagtt tcaaggaaag gaaacaagaa ggcgaagaca 2520
ggtgcttagt cgaaagaaag aaaggaagaa gtttcaagga aaggaaacaa gaaggcgaag 2580
acaggtgctt agtcgaaaga aagaaaggaa gaagtttcaa ggaaaggaaa caagaaggcg 2640
aagacaggtg cttagtcgaa agaaagaaag gaagaagttt caaggaaagg aaacaagaag 2700
gcgaagacag gtgcttagtc gaaagaaaga aaggaagaag tttcaaggaa aggaaacaag 2760
aaggcgaaga caggtgctta gtcgaaagaa agaaaggaag aagtttcaag gaaaggaaac 2820
aagaaggcga agacaggtgc ttagtcgaaa gaaagaaagg aagaagtttc aaggaaagga 2880
aacaagaagg cgaagacagg tgcttagtcg aaagaaagaa aggaagaagt ttcaaggaaa 2940
ggaaacaaga aggcgaagac aggtgcttag tcgaaagaaa gaaaggaaga agtttcaagg 3000
aaaggaaaca agaaggcgaa gacaggtgct tagtcgaaag aaagaaagga agaagtttca 3060
aggaaaggaa acaagaaggc gaagacaggt gcttagtcga aagaaagaaa ggaagaagtt 3120
tcaaggaaag gaaacaagaa ggcgaagaca ggtgcttagt cgaaagaaag aaaggaagaa 3180
gtttcaagga aaggaaacaa gaaggcgaag acaggtgctt agtcgaaaga aagaaaggaa 3240
gaagtttcaa ggaaaggaaa caagaaggcg aagacaggtg cttagtcgaa agaaagaaag 3300
gaagaagttt caaggaaagg aaacaagaag gcgaagacag gtgcttagtc gaaagaaaga 3360
aaggaagaag tttcaaggaa aggaaacaag aaggcgaaga caggtgctta gtcgaaagaa 3420
agaaaggaag aagtttcaag gaaaggaaac aagaaggcga agacaggtgc ttagtcgaaa 3480
gaaagaaagg aagaagtttc aaggaaagga aacaagaagg cgaagacagg tgcttagtcg 3540
aaagaaagaa aggaagaagt ttcaaggaaa ggaaacaaga aggcgaagac aggtgcttag 3600
tcgaaagaaa gaaaggaaga agtttcaagg aaaggaaaca agaaggcgaa gacaggtgct 3660
tagtcgaaag aaagaaagga agaagtttca aggaaaggaa acaagaaggc gaagacaggt 3720
gcttagtcga aagaaagaaa ggaagaagtt tcaaggaaag gaaacaagaa ggcgaagaca 3780
ggtgcttagt cgaaagaaag aaaggaagaa gtttcaagga aaggaaacaa gaaggcgaag 3840
acaggtgctt agtcgaaaga aagaaaggaa gaagtttcaa ggaaaggaaa caagaaggcg 3900
aagacaggtg cttagtcgaa agaaagaaag gaagaagttt caaggaaagg aaacaagaag 3960
gcgaagacag gtgcttagtc gaaagaaaga aaggaagaag tttcaaggaa aggaaacaag 4020
aaggcgaaga caggtgctta gtcgaaagaa agaaaggaag aagtttcaag gaaaggaaac 4080
aagaaggcga agacaggtgc ttagtcgaaa gaaagaaagg aagaagtttc aaggaaagga 4140
aacaagaagg cgaagacagg tgcttagtcg aaagaaagaa aggaagaagt ttcaaggaaa 4200
ggaaacaaga aggcgaagac aggtgcttag tcgaaagaaa gaaaggaaga agtttcaagg 4260
aaaggaaaca agaaggcgaa gacaggtgct tagtcgaaag aaagaaagga agaagtttca 4320
aggaaaggaa acaagaaggc gaagacaggt gcttagtcga aagaaagaaa ggaagaagtt 4380
tcaaggaaag gaaacaagaa ggcgaagaca ggtgcttagt cgaaagaaag aaaggaagaa 4440
gtttcaagga aaggaaacaa gaaggcgaag acaggtgctt agtcgaaaga aagaaaggaa 4500
gaagtttcaa ggaaaggaaa caagaaggcg aagacaggtg cttagtcgaa agaaagaaag 4560
gaagaagttt caaggaaagg aaacaagaag gcgaagacag gtgcttagtc gaaagaaaga 4620
aaggaagaag tttcaaggaa aggaaacaag aaggcgaaga caggtgctta gtcgaaagaa 4680
agaaaggaag aagtttcaag gaaaggaaac aagaaggcga agacaggtgc ttagtcgaaa 4740
gaaagaaagg aagaagtttc aaggaaagga aacaagaagg cgaagacagg tgcttagtcg 4800
aaagaaagaa aggaagaagt ttcaaggaaa ggaaacaaga aggcgaagac aggtgcttag 4860
tcgaaagaaa gaaaggaaga agtttcaagg aaaggaaaca agaaggcgaa gacaggtgct 4920
tagtcgaaag aaagaaagga agaagtttca aggaaaggaa acaagaaggc gaagacaggt 4980
gcttagtcga aagaaagaaa ggaagaagtt tcaaggaaag gaaacaagaa ggcgaagaca 5040
ggtgcttagt cgaaagaaag aaaggaagaa gtttcaagga aaggaaacaa gaaggcgaag 5100
acaggtgctt agtcgaaaga aagaaaggaa gaagtttcaa ggaaaggaaa caagaaggcg 5160
aagacaggtg cttagtcgaa agaaagaaag gaagaagttt caaggaaagg aaacaagaag 5220
gcgaagacag gtgcttagtc gaaagaaaga aaggaagaag tttcaaggaa aggaaacaag 5280
aaggcgaaga caggtgctta gtcgaaagaa agaaaggaag aagtttcaag gaaaggaaac 5340
aagaaggcga agacaggtgc ttagtcgaaa gaaagaaagg aagaagtttc aaggaaagga 5400
aacaagaagg cgaagacagg tgcttagtcg aaagaaagaa aggaagaagt ttcaaggaaa 5460
ggaaacaaga aggcgaagac aggtgcttag tcgaaagaaa gaaaggaaga agtttcaagg 5520
aaaggaaaca agaaggcgaa gacaggtgct tagtcgaaag aaagaaagga agaagtttca 5580
aggaaaggaa acaagaaggc gaagacaggt gcttagtcga aagaaagaaa ggaagaagtt 5640
tcaaggaaag gaaacaagaa ggcgaagaca ggtgcttagt cgaaagaaag aaaggaagaa 5700
gtttcaagga aaggaaacaa gaaggcgaag acaggtgctt agtcgaaaga aagaaaggaa 5760
gaagtttcaa ggaaaggaaa caagaaggcg aagacaggtg cttagtcgaa agaaagaaag 5820
gaagaagttt caaggaaagg aaacaagaag gcgaagacag gtgcttagtc gaaagaaaga 5880
aaggaagaag tttcaaggaa aggaaacaag aaggcgaaga caggtgctta gtcgaaagaa 5940
agaaaggaag aagtttcaag gaaaggaaac aagaaggcga agacaggtgc ttagtcgaaa 6000
gaaagaaagg aagaagtttc aaggaaagga aacaagaagg cgaagacagg tgcttagtcg 6060
aaagaaagaa aggaagaagt ttcaaggaaa ggaaacaaga aggcgaagac aggtgcttag 6120
tcgaaagaaa gaaaggaaga agtttcaagg aaaggaaaca agaaggcgaa gacaggtgct 6180
tagtcgaaag aaagaaagga agaagtttca aggaaaggaa acaagaaggc gaagacaggt 6240
gcttagtcga aagaaagaaa ggaagaagtt tcaaggaaag gaaacaagaa ggcgaagaca 6300
ggtgcttagt cgaaagaaag aaaggaagaa gtttcaagga aaggaaacaa gaaggcgaag 6360
acaggtgctt agtcgaaaga aagaaaggaa gaagtttcaa ggaaaggaaa caagaaggcg 6420
aagacaggtg cttagtcgaa agaaagaaag gaagaagttt caaggaaagg aaacaagaag 6480
gcgaagacag gtgcttagtc gaaagaaaga aaggaagaag tttcaaggaa aggaaacaag 6540
aaggcgaaga caggtgctta gtcgaaagaa agaaaggaag aagtttcaag gaaaggaaac 6600
aagaaggcga agacaggtgc ttagtcgaaa gaaagaaagg aagaagtttc aaggaaagga 6660
aacaagaagg cgaagacagg tgcttagtcg aaagaaagaa aggaagaagt ttcaaggaaa 6720
ggaaacaaga aggcgaagac aggtgcttag tcgaaagaaa gaaaggaaga agtttcaagg 6780
aaaggaaaca agaaggcgaa gacaggtgct tagtcgaaag aaagaaagga agaagtttca 6840
aggaaaggaa acaagaaggc gaagacaggt gcttagtcga aagaaagaaa ggaagaagtt 6900
tcaaggaaag gaaacaagaa ggcgaagaca ggtgcttagt cgaaagaaag aaaggaagaa 6960
gtttcaagga aaggaaacaa gaaggcgaag acaggtgctt agtcgaaaga aagaaaggaa 7020
gaagtttcaa ggaaaggaaa caagaaggcg aagacaggtg cttagtcgaa agaaagaaag 7080
gaagaagttt caaggaaagg aaacaagaag gcgaagacag gtgcttagtc gaaagaaaga 7140
aaggaagaag tttcaaggaa aggaaacaag aaggcgaaga caggtgctta gtcgaaagaa 7200
agaaaggaag aagtttcaag gaaaggaaac aagaaggcga agacaggtgc ttagtcgaaa 7260
gaaagaaagg aagaagtttc aaggaaagga aacaagaagg cgaagacagg tgcttagtcg 7320
aaagaaagaa aggaagaagt ttcaaggaaa ggaaacaaga aggcgaagac aggtgcttag 7380
tcgaaagaaa gaaaggaaga agtttcaagg aaaggaaaca agaaggcgaa gacaggtgct 7440
tagtcgaaag aaagaaagga agaagtttca aggaaaggaa acaagaaggc gaagacaggt 7500
gcttagtcga aagaaagaaa ggaagaagtt tcaaggaaag gaaacaagaa ggcgaagaca 7560
ggtgcttagt cgaaagaaag aaaggaagaa gtttcaagga aaggaaacaa gaaggcgaag 7620
acaggtgctt agtcgaaaga aagaaaggaa gaagtttcaa ggaaaggaaa caagaaggcg 7680
aagacaggtg cttagtcgaa agaaagaaag gaagaagttt caaggaaagg aaacaagaag 7740
gcgaagacag gtgcttagtc gaaagaaaga aaggaagaag tttcaaggaa aggaaacaag 7800
aaggcgaaga caggtgctta gtcgaaagaa agaaaggaag aagtttcaag gaaaggaaac 7860
aagaaggcga agacaggtgc ttagtcgaaa gaaagaaagg aagaagtttc aaggaaagga 7920
aacaagaagg cgaagacagg tgcttagtcg aaagaaagaa aggaagaagt ttcaaggaaa 7980
ggaaacaaga aggcgaagac a 8001
<210> 6
<211> 8001
<212> DNA
<213> Artificial sequence
<220>
<223> chain B
<400> 6
agggcttggc atagacgagt tgacagagac ggaatccgac cattgtgcgc tatcttcatc 60
ttaagggctt ggcatagacg agttgacaga gacggaatcc gaccattgtg cgctatcttc 120
atcttaaggg cttggcatag acgagttgac agagacggaa tccgaccatt gtgcgctatc 180
ttcatcttaa gggcttggca tagacgagtt gacagagacg gaatccgacc attgtgcgct 240
atcttcatct taagggcttg gcatagacga gttgacagag acggaatccg accattgtgc 300
gctatcttca tcttaagggc ttggcataga cgagttgaca gagacggaat ccgaccattg 360
tgcgctatct tcatcttaag ggcttggcat agacgagttg acagagacgg aatccgacca 420
ttgtgcgcta tcttcatctt aagggcttgg catagacgag ttgacagaga cggaatccga 480
ccattgtgcg ctatcttcat cttaagggct tggcatagac gagttgacag agacggaatc 540
cgaccattgt gcgctatctt catcttaagg gcttggcata gacgagttga cagagacgga 600
atccgaccat tgtgcgctat cttcatctta agggcttggc atagacgagt tgacagagac 660
ggaatccgac cattgtgcgc tatcttcatc ttaagggctt ggcatagacg agttgacaga 720
gacggaatcc gaccattgtg cgctatcttc atcttaaggg cttggcatag acgagttgac 780
agagacggaa tccgaccatt gtgcgctatc ttcatcttaa gggcttggca tagacgagtt 840
gacagagacg gaatccgacc attgtgcgct atcttcatct taagggcttg gcatagacga 900
gttgacagag acggaatccg accattgtgc gctatcttca tcttaagggc ttggcataga 960
cgagttgaca gagacggaat ccgaccattg tgcgctatct tcatcttaag ggcttggcat 1020
agacgagttg acagagacgg aatccgacca ttgtgcgcta tcttcatctt aagggcttgg 1080
catagacgag ttgacagaga cggaatccga ccattgtgcg ctatcttcat cttaagggct 1140
tggcatagac gagttgacag agacggaatc cgaccattgt gcgctatctt catcttaagg 1200
gcttggcata gacgagttga cagagacgga atccgaccat tgtgcgctat cttcatctta 1260
agggcttggc atagacgagt tgacagagac ggaatccgac cattgtgcgc tatcttcatc 1320
ttaagggctt ggcatagacg agttgacaga gacggaatcc gaccattgtg cgctatcttc 1380
atcttaaggg cttggcatag acgagttgac agagacggaa tccgaccatt gtgcgctatc 1440
ttcatcttaa gggcttggca tagacgagtt gacagagacg gaatccgacc attgtgcgct 1500
atcttcatct taagggcttg gcatagacga gttgacagag acggaatccg accattgtgc 1560
gctatcttca tcttaagggc ttggcataga cgagttgaca gagacggaat ccgaccattg 1620
tgcgctatct tcatcttaag ggcttggcat agacgagttg acagagacgg aatccgacca 1680
ttgtgcgcta tcttcatctt aagggcttgg catagacgag ttgacagaga cggaatccga 1740
ccattgtgcg ctatcttcat cttaagggct tggcatagac gagttgacag agacggaatc 1800
cgaccattgt gcgctatctt catcttaagg gcttggcata gacgagttga cagagacgga 1860
atccgaccat tgtgcgctat cttcatctta agggcttggc atagacgagt tgacagagac 1920
ggaatccgac cattgtgcgc tatcttcatc ttaagggctt ggcatagacg agttgacaga 1980
gacggaatcc gaccattgtg cgctatcttc atcttaaggg cttggcatag acgagttgac 2040
agagacggaa tccgaccatt gtgcgctatc ttcatcttaa gggcttggca tagacgagtt 2100
gacagagacg gaatccgacc attgtgcgct atcttcatct taagggcttg gcatagacga 2160
gttgacagag acggaatccg accattgtgc gctatcttca tcttaagggc ttggcataga 2220
cgagttgaca gagacggaat ccgaccattg tgcgctatct tcatcttaag ggcttggcat 2280
agacgagttg acagagacgg aatccgacca ttgtgcgcta tcttcatctt aagggcttgg 2340
catagacgag ttgacagaga cggaatccga ccattgtgcg ctatcttcat cttaagggct 2400
tggcatagac gagttgacag agacggaatc cgaccattgt gcgctatctt catcttaagg 2460
gcttggcata gacgagttga cagagacgga atccgaccat tgtgcgctat cttcatctta 2520
agggcttggc atagacgagt tgacagagac ggaatccgac cattgtgcgc tatcttcatc 2580
ttaagggctt ggcatagacg agttgacaga gacggaatcc gaccattgtg cgctatcttc 2640
atcttaaggg cttggcatag acgagttgac agagacggaa tccgaccatt gtgcgctatc 2700
ttcatcttaa gggcttggca tagacgagtt gacagagacg gaatccgacc attgtgcgct 2760
atcttcatct taagggcttg gcatagacga gttgacagag acggaatccg accattgtgc 2820
gctatcttca tcttaagggc ttggcataga cgagttgaca gagacggaat ccgaccattg 2880
tgcgctatct tcatcttaag ggcttggcat agacgagttg acagagacgg aatccgacca 2940
ttgtgcgcta tcttcatctt aagggcttgg catagacgag ttgacagaga cggaatccga 3000
ccattgtgcg ctatcttcat cttaagggct tggcatagac gagttgacag agacggaatc 3060
cgaccattgt gcgctatctt catcttaagg gcttggcata gacgagttga cagagacgga 3120
atccgaccat tgtgcgctat cttcatctta agggcttggc atagacgagt tgacagagac 3180
ggaatccgac cattgtgcgc tatcttcatc ttaagggctt ggcatagacg agttgacaga 3240
gacggaatcc gaccattgtg cgctatcttc atcttaaggg cttggcatag acgagttgac 3300
agagacggaa tccgaccatt gtgcgctatc ttcatcttaa gggcttggca tagacgagtt 3360
gacagagacg gaatccgacc attgtgcgct atcttcatct taagggcttg gcatagacga 3420
gttgacagag acggaatccg accattgtgc gctatcttca tcttaagggc ttggcataga 3480
cgagttgaca gagacggaat ccgaccattg tgcgctatct tcatcttaag ggcttggcat 3540
agacgagttg acagagacgg aatccgacca ttgtgcgcta tcttcatctt aagggcttgg 3600
catagacgag ttgacagaga cggaatccga ccattgtgcg ctatcttcat cttaagggct 3660
tggcatagac gagttgacag agacggaatc cgaccattgt gcgctatctt catcttaagg 3720
gcttggcata gacgagttga cagagacgga atccgaccat tgtgcgctat cttcatctta 3780
agggcttggc atagacgagt tgacagagac ggaatccgac cattgtgcgc tatcttcatc 3840
ttaagggctt ggcatagacg agttgacaga gacggaatcc gaccattgtg cgctatcttc 3900
atcttaaggg cttggcatag acgagttgac agagacggaa tccgaccatt gtgcgctatc 3960
ttcatcttaa gggcttggca tagacgagtt gacagagacg gaatccgacc attgtgcgct 4020
atcttcatct taagggcttg gcatagacga gttgacagag acggaatccg accattgtgc 4080
gctatcttca tcttaagggc ttggcataga cgagttgaca gagacggaat ccgaccattg 4140
tgcgctatct tcatcttaag ggcttggcat agacgagttg acagagacgg aatccgacca 4200
ttgtgcgcta tcttcatctt aagggcttgg catagacgag ttgacagaga cggaatccga 4260
ccattgtgcg ctatcttcat cttaagggct tggcatagac gagttgacag agacggaatc 4320
cgaccattgt gcgctatctt catcttaagg gcttggcata gacgagttga cagagacgga 4380
atccgaccat tgtgcgctat cttcatctta agggcttggc atagacgagt tgacagagac 4440
ggaatccgac cattgtgcgc tatcttcatc ttaagggctt ggcatagacg agttgacaga 4500
gacggaatcc gaccattgtg cgctatcttc atcttaaggg cttggcatag acgagttgac 4560
agagacggaa tccgaccatt gtgcgctatc ttcatcttaa gggcttggca tagacgagtt 4620
gacagagacg gaatccgacc attgtgcgct atcttcatct taagggcttg gcatagacga 4680
gttgacagag acggaatccg accattgtgc gctatcttca tcttaagggc ttggcataga 4740
cgagttgaca gagacggaat ccgaccattg tgcgctatct tcatcttaag ggcttggcat 4800
agacgagttg acagagacgg aatccgacca ttgtgcgcta tcttcatctt aagggcttgg 4860
catagacgag ttgacagaga cggaatccga ccattgtgcg ctatcttcat cttaagggct 4920
tggcatagac gagttgacag agacggaatc cgaccattgt gcgctatctt catcttaagg 4980
gcttggcata gacgagttga cagagacgga atccgaccat tgtgcgctat cttcatctta 5040
agggcttggc atagacgagt tgacagagac ggaatccgac cattgtgcgc tatcttcatc 5100
ttaagggctt ggcatagacg agttgacaga gacggaatcc gaccattgtg cgctatcttc 5160
atcttaaggg cttggcatag acgagttgac agagacggaa tccgaccatt gtgcgctatc 5220
ttcatcttaa gggcttggca tagacgagtt gacagagacg gaatccgacc attgtgcgct 5280
atcttcatct taagggcttg gcatagacga gttgacagag acggaatccg accattgtgc 5340
gctatcttca tcttaagggc ttggcataga cgagttgaca gagacggaat ccgaccattg 5400
tgcgctatct tcatcttaag ggcttggcat agacgagttg acagagacgg aatccgacca 5460
ttgtgcgcta tcttcatctt aagggcttgg catagacgag ttgacagaga cggaatccga 5520
ccattgtgcg ctatcttcat cttaagggct tggcatagac gagttgacag agacggaatc 5580
cgaccattgt gcgctatctt catcttaagg gcttggcata gacgagttga cagagacgga 5640
atccgaccat tgtgcgctat cttcatctta agggcttggc atagacgagt tgacagagac 5700
ggaatccgac cattgtgcgc tatcttcatc ttaagggctt ggcatagacg agttgacaga 5760
gacggaatcc gaccattgtg cgctatcttc atcttaaggg cttggcatag acgagttgac 5820
agagacggaa tccgaccatt gtgcgctatc ttcatcttaa gggcttggca tagacgagtt 5880
gacagagacg gaatccgacc attgtgcgct atcttcatct taagggcttg gcatagacga 5940
gttgacagag acggaatccg accattgtgc gctatcttca tcttaagggc ttggcataga 6000
cgagttgaca gagacggaat ccgaccattg tgcgctatct tcatcttaag ggcttggcat 6060
agacgagttg acagagacgg aatccgacca ttgtgcgcta tcttcatctt aagggcttgg 6120
catagacgag ttgacagaga cggaatccga ccattgtgcg ctatcttcat cttaagggct 6180
tggcatagac gagttgacag agacggaatc cgaccattgt gcgctatctt catcttaagg 6240
gcttggcata gacgagttga cagagacgga atccgaccat tgtgcgctat cttcatctta 6300
agggcttggc atagacgagt tgacagagac ggaatccgac cattgtgcgc tatcttcatc 6360
ttaagggctt ggcatagacg agttgacaga gacggaatcc gaccattgtg cgctatcttc 6420
atcttaaggg cttggcatag acgagttgac agagacggaa tccgaccatt gtgcgctatc 6480
ttcatcttaa gggcttggca tagacgagtt gacagagacg gaatccgacc attgtgcgct 6540
atcttcatct taagggcttg gcatagacga gttgacagag acggaatccg accattgtgc 6600
gctatcttca tcttaagggc ttggcataga cgagttgaca gagacggaat ccgaccattg 6660
tgcgctatct tcatcttaag ggcttggcat agacgagttg acagagacgg aatccgacca 6720
ttgtgcgcta tcttcatctt aagggcttgg catagacgag ttgacagaga cggaatccga 6780
ccattgtgcg ctatcttcat cttaagggct tggcatagac gagttgacag agacggaatc 6840
cgaccattgt gcgctatctt catcttaagg gcttggcata gacgagttga cagagacgga 6900
atccgaccat tgtgcgctat cttcatctta agggcttggc atagacgagt tgacagagac 6960
ggaatccgac cattgtgcgc tatcttcatc ttaagggctt ggcatagacg agttgacaga 7020
gacggaatcc gaccattgtg cgctatcttc atcttaaggg cttggcatag acgagttgac 7080
agagacggaa tccgaccatt gtgcgctatc ttcatcttaa gggcttggca tagacgagtt 7140
gacagagacg gaatccgacc attgtgcgct atcttcatct taagggcttg gcatagacga 7200
gttgacagag acggaatccg accattgtgc gctatcttca tcttaagggc ttggcataga 7260
cgagttgaca gagacggaat ccgaccattg tgcgctatct tcatcttaag ggcttggcat 7320
agacgagttg acagagacgg aatccgacca ttgtgcgcta tcttcatctt aagggcttgg 7380
catagacgag ttgacagaga cggaatccga ccattgtgcg ctatcttcat cttaagggct 7440
tggcatagac gagttgacag agacggaatc cgaccattgt gcgctatctt catcttaagg 7500
gcttggcata gacgagttga cagagacgga atccgaccat tgtgcgctat cttcatctta 7560
agggcttggc atagacgagt tgacagagac ggaatccgac cattgtgcgc tatcttcatc 7620
ttaagggctt ggcatagacg agttgacaga gacggaatcc gaccattgtg cgctatcttc 7680
atcttaaggg cttggcatag acgagttgac agagacggaa tccgaccatt gtgcgctatc 7740
ttcatcttaa gggcttggca tagacgagtt gacagagacg gaatccgacc attgtgcgct 7800
atcttcatct taagggcttg gcatagacga gttgacagag acggaatccg accattgtgc 7860
gctatcttca tcttaagggc ttggcataga cgagttgaca gagacggaat ccgaccattg 7920
tgcgctatct tcatcttaag ggcttggcat agacgagttg acagagacgg aatccgacca 7980
ttgtgcgcta tcttcatctt a 8001
<210> 7
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> short chain 1
<400> 7
tgtcttcgcc ttcttgtttc cacggtacgt atcggactat tg 42
<210> 8
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> short chain 2
<400> 8
tttccttgaa acttcttcct tgactgtcga ttacccgtta at 42
<210> 9
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> short chain 3
<400> 9
tctttctttc gactaagcac cgcagtatga catcgaccgg at 42
<210> 10
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> short chain 4
<400> 10
tggtcggatt ccgtctctgt ccaatagtcc gatacgtacc gt 42
<210> 11
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> short chain 5
<400> 11
taagatgaag atagcgcaca aattaacggg taatcgacag tc 42
<210> 12
<211> 83
<212> DNA
<213> Artificial sequence
<220>
<223> short chain 6
<400> 12
atctaactgc tgcgccgccg ggaaaatact gtacggttag aaactcgtct atgccaagcc 60
ctatccggtc gatgtcatac tgc 83
<210> 13
<211> 63
<212> DNA
<213> Artificial sequence
<220>
<223> Long Single-stranded DNA molecule
<400> 13
ggtgcttagt cgaaagaaag aaaggaagaa gtttcaagga aaggaaacaa gaaggcgaag 60
aca 63
<210> 14
<211> 63
<212> DNA
<213> Artificial sequence
<220>
<223> Long Single-stranded DNA molecule
<400> 14
agggcttggc atagacgagt tgacagagac ggaatccgac cattgtgcgc tatcttcatc 60
tta 63
Claims (10)
1. A multivalent aptamer DNA nanostaiver, comprising m tandem repeat units comprising two long single-stranded DNA molecules and 2n short single-stranded DNA molecules, wherein m is an integer from 80 to 320, preferably m is an integer from 100 to 150, more preferably m is 127; n is an integer of 3 to 7 inclusive, preferably 3 to 5 inclusive, more preferably 3,
wherein, in the repeating unit, the sequences of the two long single-strand DNA molecules are different; at least one short single-stranded DNA molecule in the 2n short single-stranded DNA molecules is connected with an adapter, each short single-stranded DNA molecule is provided with two sections of hybridization regions, one of the two sections of hybridization regions is hybridized with one part of the long single-stranded DNA molecule, the other hybridization region is hybridized with one part of the other short single-stranded DNA molecule to form a double-helix structure, and therefore the two long single-stranded DNA molecules and the 2n short single-stranded DNA molecules are self-assembled into the DNA nano ladder.
2. The multivalent aptamer DNA nano ladder of claim 1, wherein in the repeating unit, the two long single-stranded DNA molecules are shown as SEQ ID NO 13 and SEQ ID NO 14, and the 2n short single-stranded DNA molecules (wherein n ═ 3) are shown as SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12.
3. The multivalent aptamer DNA nanoshield of claim 1 or 2, wherein the aptamer is a tumor cell aptamer, preferably selected from one or more of the following: acute lymphoblastic leukemia T-lymphocyte (CCRF-CEM) aptamer Sgc8, human breast cancer cell (MCF-7) aptamer S2.2, aptamer AS 1411; preferably, the aptamer is labeled with a fluorophore at the 5' end.
4. A method of making the multivalent aptamer DNA nano ladder of any of claims 1-3, comprising the steps of:
(1) synthesizing two long single-stranded DNAs each having a nucleotide sequence of m long single-stranded DNA molecules connected in series by Rolling Circle Amplification (RCA) reactions, respectively;
(2) and (2) constructing the DNA nano ladder by combining m multiplied by 2n short single-stranded DNA molecules by taking the two long single-stranded DNAs synthesized in the step (1) as scaffold chains based on DNA origami.
5. The production method according to claim 4,
in the step (1), respectively taking the circular DNA shown as SEQ ID NO. 1 and SEQ ID NO. 2 as a template, adding Phi29 DNA polymerase in the presence of DNA primers shown as SEQ ID NO. 3 and SEQ ID NO. 4, Phi29 DNA polymerase buffer solution and dNTPs to initiate reaction, incubating at 30 ℃ for 10min, raising the temperature to 65 ℃ to inactivate Phi29 DNA polymerase, preparing the long single-strand DNA shown as SEQ ID NO. 5 and SEQ ID NO. 6,
in the step (2), the long single-stranded DNA shown as SEQ ID NO 5 and SEQ ID NO 6 and the short single-stranded DNA molecules shown as SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12 are taken in sequence and added into a centrifuge tube containing annealing buffer solution, and the annealing buffer solution is a buffer solution containing 12mM Mg2+The TAE buffer solution is evenly mixed, properly centrifuged at low speed, thermally treated at 95 ℃ for 5min, naturally annealed to 25 ℃, and kept overnight to prepare the DNA nano ladder.
6. The method of claim 4, comprising the steps of:
1) preparation of Long Single-stranded DNA:
the Rolling Circle Amplification (RCA) reactions were performed with the circular DNA templates A, B shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively, and 2. mu.L of the primers (10. mu.M) shown in SEQ ID NO. 3 and SEQ ID NO. 4, 2. mu.L of the circular DNA template (10. mu.M), 2. mu.L of the 10 XPhi 29 DNA polymerase buffer and 2. mu.L of dNTPs (7mM) were sequentially added to each reaction system, followed by ddH supplementation2O to the total volume of 20 mu L, adding 0.8 mu L Phi29 DNA polymerase (10U/. mu.L) to initiate reaction, incubating at 30 ℃ for 10min, raising the temperature to 65 ℃ to inactivate the Phi29 DNA polymerase, and preparing Rolling Circle Amplification (RCA) products, namely a strand A and a strand B, shown as SEQ ID NO:5 and SEQ ID NO: 6;
2) preparing a DNA nano ladder:
in step 1), 1 μ L of each of the product chain A and chain B of the Rolling Circle Amplification (RCA), such as1 μ L (concentration 100 μ M) of the short chains 1-6 shown in SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12, is added into a centrifuge tube containing an annealing buffer solution containing 12mM Mg2+TAE buffer of (5), supplement of ddH2O to 100 μ L, mixing, centrifuging at low speed, heat treating at 95 deg.C for 5min, and standingAnnealing to 25 ℃, and standing overnight to prepare the DNA nano ladder.
7. A polyvalent aptamer DNA nano ladder-antitumor drug complex, wherein the polyvalent aptamer DNA nano ladder according to any one of claims 1 to 3 is used as a drug carrier to carry an antitumor drug.
8. The polyvalent aptamer DNA nano ladder-antitumor drug complex of claim 7, wherein said antitumor drug is inserted between DNA double strands by means of physical binding to form a DNA nano ladder-antitumor drug complex, preferably said antitumor drug is an anthracycline anticancer drug such as doxorubicin hydrochloride (Dox), Daunorubicin (DNR) and Epirubicin (EPR); alternatively, genetic antineoplastic agents, e.g., small interfering rna (sirna), cytosine-phosphate-guanosine (CPG), are anchored by extending at least one of the short single-stranded DNA molecules to which the aptamer is not attached beyond the cohesive end.
9. The method for preparing a polyvalent aptamer DNA nano ladder-antitumor drug complex as claimed in claim 7 or 8, which comprises the step of loading an antitumor drug using the polyvalent aptamer DNA nano ladder as claimed in any one of claims 1 to 3 as a drug carrier.
10. Use of the DNA nanoscaler of a polyvalent aptamer according to any of claims 1 to 3 for the preparation of a pharmaceutical carrier, in particular an antineoplastic pharmaceutical carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010856470.3A CN111939265B (en) | 2020-08-24 | 2020-08-24 | DNA nano ladder of polyvalent aptamer and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010856470.3A CN111939265B (en) | 2020-08-24 | 2020-08-24 | DNA nano ladder of polyvalent aptamer and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111939265A true CN111939265A (en) | 2020-11-17 |
| CN111939265B CN111939265B (en) | 2022-06-07 |
Family
ID=73360195
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010856470.3A Active CN111939265B (en) | 2020-08-24 | 2020-08-24 | DNA nano ladder of polyvalent aptamer and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111939265B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113278607A (en) * | 2021-04-20 | 2021-08-20 | 南京大学 | Preparation method of circular single-stranded DNA integrated by nucleic acid aptamer and application of circular single-stranded DNA integrated by nucleic acid aptamer in DNA paper folding |
| CN114246951A (en) * | 2021-12-24 | 2022-03-29 | 中国石油大学(华东) | DNA nano-carrier compound and preparation method and application thereof |
| CN116804673A (en) * | 2023-06-20 | 2023-09-26 | 江南大学 | Pathogenic bacteria side-stream chromatography detection method integrating multivalent aptamer and multifunctional nano-enzyme |
| CN117224672A (en) * | 2023-08-25 | 2023-12-15 | 华东理工大学 | Cell surface universal DNA sensing tool box and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030099939A1 (en) * | 1997-03-27 | 2003-05-29 | Hu A-Li W. | Nucleic acid ladders |
| CN109470691A (en) * | 2018-11-15 | 2019-03-15 | 郑州大学 | A kind of self assembly aptamer/protein composite nanoscale probe, preparation method, kit and its application |
| CN109536489A (en) * | 2017-09-21 | 2019-03-29 | 南京大学 | A kind of DNA molecular watt or its nucleic acid nano structure and its application |
| CN109675049A (en) * | 2019-02-11 | 2019-04-26 | 青岛大学 | A kind of medicament slow release DNA nanostructure and the preparation method and application thereof of pH induction |
-
2020
- 2020-08-24 CN CN202010856470.3A patent/CN111939265B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030099939A1 (en) * | 1997-03-27 | 2003-05-29 | Hu A-Li W. | Nucleic acid ladders |
| CN109536489A (en) * | 2017-09-21 | 2019-03-29 | 南京大学 | A kind of DNA molecular watt or its nucleic acid nano structure and its application |
| CN109470691A (en) * | 2018-11-15 | 2019-03-15 | 郑州大学 | A kind of self assembly aptamer/protein composite nanoscale probe, preparation method, kit and its application |
| CN109675049A (en) * | 2019-02-11 | 2019-04-26 | 青岛大学 | A kind of medicament slow release DNA nanostructure and the preparation method and application thereof of pH induction |
Non-Patent Citations (4)
| Title |
|---|
| ZHIQING ZHANG ET AL.: ""Salt-Induced Assembly Transformation of DNA−AuNP Conjugates Based on RCA Origami: From Linear Arrays to Nanorings"", 《LANGMUIR》 * |
| ZHIQING ZHANG ET AL.: ""Salt-Induced Assembly Transformation of DNA−AuNP Conjugates Based on RCA Origami: From Linear Arrays to Nanorings"", 《LANGMUIR》, vol. 34, no. 2018, 26 June 2018 (2018-06-26), pages 8904 - 8909 * |
| 张子辰 等: ""DNA 纳米梯子用于抗癌药物的靶向输送"", 《中国化学会第17 届胶体与界面化学学术会议论文（摘要）集》 * |
| 张子辰 等: ""DNA 纳米梯子用于抗癌药物的靶向输送"", 《中国化学会第17 届胶体与界面化学学术会议论文（摘要）集》, 31 July 2019 (2019-07-31), pages 560 - 561 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113278607A (en) * | 2021-04-20 | 2021-08-20 | 南京大学 | Preparation method of circular single-stranded DNA integrated by nucleic acid aptamer and application of circular single-stranded DNA integrated by nucleic acid aptamer in DNA paper folding |
| CN114246951A (en) * | 2021-12-24 | 2022-03-29 | 中国石油大学(华东) | DNA nano-carrier compound and preparation method and application thereof |
| CN116804673A (en) * | 2023-06-20 | 2023-09-26 | 江南大学 | Pathogenic bacteria side-stream chromatography detection method integrating multivalent aptamer and multifunctional nano-enzyme |
| CN116804673B (en) * | 2023-06-20 | 2024-03-01 | 江南大学 | Pathogenic bacteria side-stream chromatography detection method integrating multivalent aptamer and multifunctional nano-enzyme |
| CN117224672A (en) * | 2023-08-25 | 2023-12-15 | 华东理工大学 | Cell surface universal DNA sensing tool box and preparation method and application thereof |
| CN117224672B (en) * | 2023-08-25 | 2024-05-14 | 华东理工大学 | Cell surface universal DNA sensing tool box and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111939265B (en) | 2022-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111939265B (en) | DNA nano ladder of polyvalent aptamer and preparation method and application thereof | |
| Samanta et al. | Nucleic‐acid structures as intracellular probes for live cells | |
| Lv et al. | Preparation and biomedical applications of programmable and multifunctional DNA nanoflowers | |
| US9121065B2 (en) | Nanoparticle-oligonucleotide hybrid structures and methods of use thereof | |
| KR101752812B1 (en) | High-efficiency nanoparticle-type double-helical oligo-rna structure and method for prep aring same | |
| CN101918554B (en) | Complex of polysaccharide and double-stranded RNA | |
| Bi et al. | Self-assembled multifunctional DNA nanospheres for biosensing and drug delivery into specific target cells | |
| Meng et al. | Efficient Fusion of Liposomes by Nucleobase Quadruple‐Anchored DNA | |
| JP2008220366A (en) | Modification type pna/rna complex | |
| CN104651501A (en) | Cracking activation type nucleic acid adaptor diagnosis and treatment probe and application thereof | |
| Chernikova et al. | Cucurbiturils in nucleic acids research | |
| US20190209695A1 (en) | Pharmaceutical Compositions for High-Capacity Targeted Delivery | |
| Chen et al. | DNA-supramolecule conjugates in theranostics | |
| Bhanjadeo et al. | Sequence-specific B-to-Z transition in self-assembled DNA: A biophysical and thermodynamic study | |
| Li et al. | Construction of rolling circle amplification products-based pure nucleic acid nanostructures for biomedical applications | |
| Lopez et al. | Fluorescein-stabilized i-Motif DNA and its unfolding leading to a stronger adsorption affinity | |
| WO2017127033A1 (en) | A preparation method for a dna origami based carrier system | |
| WO2015076356A1 (en) | Short-chain rna detection method | |
| Yan et al. | A pH-responsive activatable aptamer probe for targeted cancer imaging based on i-motif-driven conformation alteration | |
| Cao et al. | A general signal amplifier of self-assembled DNA micelles for sensitive quantification of biomarkers | |
| Nasiri et al. | Improving DNA nanostructure stability: A review of the biomedical applications and approaches | |
| CN101698885B (en) | Liquid-phase chip for detecting expression level of mRNAs of genes related to therapeutic effect of anti-metabolism chemotherapeutic medicament | |
| Bai et al. | Conformational conversion enhances cellular uptake of F base double-strand-conjugated oligonucleotides | |
| KR20130068032A (en) | 'stable antisense oligonucleotide conjugate and its manufacturing method' | |
| CN109295133B (en) | Construction method and application of aptamer-DNA high molecular polymer based on nonlinear hybrid chain amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |