JP2008220366A - Modification type pna/rna complex - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a complex having useful functions based on action of functional molecules and exhibiting RNA interference effect on a target gene. <P>SOLUTION: The modification type PNA/RNA complex consists of a modification peptide nucleic acid and a double-stranded RNA, and the double stranded RNA is a double stranded RNA having a sense stranded RNA composed of a base sequence which is complementary to a target sequence in a target gene and an antisense stranded RNA having a base sequence which is complementary to the sense strand and can suppress expression of the target gene, and a single-stranded DNA is bound directly or through a linker to at least either one end of the sense stranded RNA and antisense stranded RNA of the double stranded RNA. In the modification type peptide nucleic acid, a functional molecule is bound directly or through a linker to a peptide nucleic acid, and the peptide nucleic acid has a sequence hybridizable to the single-stranded DNA and the peptide nucleic acid is hybridized to the single-stranded DNA. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention is a complex of a double-stranded RNA capable of suppressing the expression of a target gene and a modified peptide nucleic acid to which a functional molecule is bound, and has a useful function based on the action of the functional molecule. And a modified PNA / RNA complex capable of producing an RNA interference effect based on the action of double-stranded RNA.

  In recent years, an RNA interference (RNAi) method using a short double-stranded RNA (siRNA) of 21 bases has attracted attention. In this RNAi method, double-stranded RNA of about 100 base pairs is introduced into the cell, and it is degraded into double-stranded RNA of about 20-25 base pairs by the action of Dicer in the cytoplasm, and then multiple proteins And an RNA / protein complex (this complex is called RICS: RNA-induced silencing complex), which binds to the homologous site of mRNA produced from the target gene and strongly suppresses gene expression. Today, the mainstream method is to use a chemically synthesized double-stranded RNA having a length of 21 bases having a dangling end of 2 bases at the 3 'end. In addition, it has become clear that double-stranded RNA consisting of 27 base pairs has an RNA interference effect that is about 100 times higher than siRNA consisting of 21 bases. (Refer nonpatent literature 1).

  The RNA interference method using such synthetic RNA is relatively easy to prepare samples, easy to handle, and has a very powerful effect, so it can be used not only in the life science field but also in the biobusiness field. It is getting a lot of attention.

  However, even with this excellent RNA interference method, further improvements are desired in terms of intracellular stability, cell introduction property, intracellular localization, gene expression suppression effect, target specificity, and the like. In addition, in a double-stranded RNA that exhibits an RNA interference effect, the intended RNA interference effect may be attenuated by simply linking functional molecules.

On the other hand, in recent years, modified PNA has attracted attention, and in particular, it has been reported that PNA bound with a functionally simple functional peptide is excellent in cell introduction (see Non-Patent Document 2). However, a molecule having both the effect of modified PNA and the RNA interference effect, and its design method have not been reported.
J. Rossi et.al. Nature Biotech., 23, 222-226 (2005) N. Bendifallah et. Al. Bioconjugate Chem., 17, 750-758 (2006)

  Conventionally, molecules having various functions such as peptides have been reported, and it is considered effective to modify RNA molecules used for RNA interference with such functional molecules. However, simply linking a functional molecule to an RNA molecule via a linker may impair the function of the functional molecule or attenuate the function of the RNA molecule. It may not be possible to effectively acquire both functions of the RNA molecule.

  Therefore, the main object of the present invention is to provide a complex that has a useful function based on the action of a functional molecule and that can exert an RNA interference effect on a target gene.

The inventors of the present invention have made extensive studies in order to solve the above-mentioned problems. As a result, RNA interference can be achieved by satisfying the following (i) to (iv) in a complex of a modified peptide nucleic acid and a double-stranded RNA. It has been found that useful effects can be exhibited based on the action of the bound functional molecule while the effect is effectively retained.
(i) the double-stranded RNA has a sense strand RNA having a base sequence complementary to a target sequence in a target gene, and an antisense strand RNA having a base sequence complementary to the sense strand, and It is a double-stranded RNA that can suppress the expression of the target gene.
(ii) Single-stranded DNA is bound to the double-stranded RNA directly or via a linker at least one end of the sense strand RNA and the antisense strand RNA.
(iii) In the modified peptide nucleic acid, the functional molecule is bound to the peptide nucleic acid directly or via a linker.
(iv) The peptide nucleic acid has a sequence capable of hybridizing to the single-stranded DNA and is hybridized to the single-stranded DNA.

  The present invention has been completed by making further improvements based on such findings.

That is, the present invention provides the following modified PNA / RNA complexes and methods for producing the same.
Item 1. A complex of a modified peptide nucleic acid and a double-stranded RNA,
The double-stranded RNA has a sense strand RNA having a base sequence complementary to the target sequence in the target gene, and an antisense strand RNA having a base sequence complementary to the sense strand, and the target gene A double-stranded RNA that can suppress expression,
In the double-stranded RNA, single-stranded DNA is bound to at least one end of the sense strand RNA and the antisense strand RNA directly or via a linker,
The modified peptide nucleic acid is one in which one or more functional molecules are bound to the peptide nucleic acid directly or through a linker,
The peptide nucleic acid has a sequence capable of hybridizing to the single-stranded DNA and is hybridized to the single-stranded DNA.
A modified PNA / RNA complex characterized in that
Item 2. Item 2. The modified PNA / RNA complex according to Item 1, wherein the sense strand RNA is composed of 19 to 30 ribonucleotides, and the antisense strand RNA is composed of the same number of ribonucleotides as the sense strand.
Item 3. Item 3. The modification according to Item 1 or 2, wherein the sense strand RNA is composed of 27 ribonucleotides, and the antisense strand RNA is composed of 27 ribonucleotides that are completely complementary to the sense strand RNA. Type PNA / RNA complex.
Item 4. Item 4. The modified PNA / RNA complex according to any one of Items 1 to 3, wherein the single-stranded DNA is composed of 5 to 20 deoxynucleotides.
Item 5. Item 5. The modification according to any one of Items 1 to 4, wherein the number of bonds of the single-stranded DNA to the double-stranded RNA is 1, and the single-stranded DNA is bound to the 5 ′ end of the sense strand. Type PNA / RNA complex.
Item 6. Item 6. The modified PNA / RNA complex according to any one of Items 1 to 5, wherein the modified peptide nucleic acid contains 5 to 20 bases.
Item 7. Item 7. The modified PNA / RNA complex according to any one of Items 1 to 6, wherein the functional molecule is a peptide.
Item 8. Item 7. The modified PNA / RNA complex according to any one of Items 1 to 6, wherein the functional molecule is a fatty acid having 6 to 50 carbon atoms.
Item 9. Item 9. The lipid-modified PNA / RNA complex according to Item 8, wherein the fatty acid is lauric acid, stearic acid, myristylic acid, or palmitic acid.
Item 10. Item 7. The modified PNA / RNA complex according to any one of Items 1 to 6, wherein the functional molecule is a saturated or unsaturated hydrocarbon having 6 to 50 carbon atoms.
Item 11. Item 6. The modified PNA / RNA complex according to any one of Items 1 to 6, wherein the modified peptide nucleic acid is a fatty acid having 6 to 50 carbon atoms and a peptide bound to the peptide nucleic acid directly or via a linker. body.
Item 12. Item 12. A method for producing a modified PNA / RNA complex according to any one of Items 1 to 11,
A double strand which has a sense strand RNA consisting of a base sequence complementary to the target sequence in the target gene, and an antisense strand RNA having a base sequence complementary to the sense strand, and which can suppress the expression of the target gene A DNA-bound double-stranded RNA, wherein a single-stranded DNA is bound to at least one end of the sense strand and the antisense strand, directly or via a linker;
A modified peptide nucleic acid in which a functional molecule is bound to a peptide nucleic acid having a sequence capable of hybridizing to the single-stranded DNA, directly or via a linker,
Mixing at a molar ratio of 1: 1.5 to 1: 5, and hybridizing the DNA region of the DNA-binding double-stranded RNA and the peptide nucleic acid region of the modified peptide nucleic acid,
A method for producing a modified PNA / RNA complex.

The modified PNA / RNA complex of the present invention can exhibit a useful effect based on a functional molecule as well as an RNA interference effect based on a double-stranded RNA, so that it can be compared with a conventional double-stranded RNA molecule that exhibits an RNA interference effect. And its practical value is enhanced. Therefore, the modified PNA / RNA complex of the present invention can be applied as a gene drug effective for the treatment of diseases such as cancer and AIDS.
Furthermore, since the modified PNA / RNA complex of the present invention exhibits excellent nuclease resistance and is highly safe, it is highly useful as a medicine.

  The modified PNA / RNA complex of the present invention has a sense strand RNA consisting of a base sequence complementary to the target sequence in the target gene and a base sequence complementary to the sense strand as a part responsible for the RNA interference effect The antisense strand RNA is hybridized and contains a double stranded RNA capable of suppressing the expression of the target gene.

  Here, the target gene is a gene whose gene expression is to be suppressed by the RNA interference effect. In the modified peptide nucleic acid / RNA complex of the present invention, the target gene is not particularly limited, and can be appropriately selected based on the use of the modified peptide nucleic acid / RNA complex.

  The target sequence in the target gene is not particularly limited as long as it is a sequence capable of suppressing gene expression due to RNA interference effect, and is appropriately determined by a known method, specifically using NCBI BLAST search or the like. Can do. For example, a region consisting of 19 to 30 bases following the base “AA” in the exon portion 50 to 100 bases downstream from the start codon of the target gene coding region (ORF) and having a GC content of around 50% May be the target sequence. Employing such a complementary strand to the target sequence has empirically revealed in the art that an excellent RNA interference effect can be obtained. Further, for example, the target sequence can be set according to the manual (Dicer Substrate RNAi Design) of IDT (Integrated DNA Technologies, INC). Recently, (i) the 5 ′ end of the antisense strand RNA is an A / U pair, (ii) the 5 ′ end of the sense strand RNA is a G / C pair, and (iii) the antisense strand RNA 5 'It has a high RNA interference effect by designing double-stranded RNA that has about 5 A / U pairs on the end side and (vi) no more than 9 G / C pairs in the double strand 2 It has been reported that single-stranded RNA can be designed (Ui-Tei et. Al, Nucleic Acids Res., 32, 936-948 (2004)).

  The number of ribonucleotides constituting the sense strand RNA is not particularly limited as long as an RNA interference effect can be expressed. For example, 19 to 30, preferably 21 to 27, and more preferably 27 can be mentioned. .

  The antisense strand RNA is RNA that can hybridize with the sense strand RNA to form a double strand. That is, the antisense strand RNA is RNA containing a nucleotide sequence complementary to the sense strand RNA. The antisense strand RNA does not necessarily have a sequence complementary to the entire length of the sense strand RNA, but has a sequence complementary to a region of 19 bases or more in the sense strand RNA. It is preferable.

  The number of ribonucleotides constituting the antisense strand is not particularly limited, and examples thereof include 19 to 30, preferably 21 to 27, and more preferably 27. The sense strand and the antisense strand may differ from each other in the number of ribonucleotides, but the number of ribonucleotides is preferably the same.

  The sense strand RNA and the antisense strand may have a dangling end (overhang) at either or both ends in a hybridized double-stranded state. For example, when both the sense strand RNA and the antisense strand are composed of 21 ribonucleotides, two ribosomes are provided at the 5 ′ end of the sense strand RNA and the 5 ′ end of the antisense strand RNA. A dangling end composed of nucleotides may be formed. That is, in the case of such a double-stranded RNA, the 1st to 19th ribonucleotide sequences from the 3 ′ end of the antisense strand RNA are 3 to 21 from the 5 ′ end of the sense strand RNA. It is a sequence complementary to the ribonucleotide.

  In the modified peptide nucleic acid / RNA complex of the present invention, as a preferable double-stranded RNA, the sense strand RNA is composed of 27 ribonucleotides, and the antisense strand RNA is combined with the sense strand RNA. Examples thereof include those composed of 27 ribonucleotides that are completely complementary.

  In the modified peptide nucleic acid / RNA complex of the present invention, the double-stranded RNA includes a single-stranded DNA directly on at least one of the four ends of the sense strand RNA and the antisense strand RNA. Alternatively, they are bonded via a linker. That is, a single-stranded DNA is present at at least one of the 5 ′ end of the sense strand RNA, the 3 ′ end of the sense strand, the 5 ′ end of the antisense strand, and the 3 ′ end of the antisense strand. Are joined. The number of bonds of the single-stranded DNA is not particularly limited, but is preferably 1 to 3, more preferably 1 or 2, particularly preferably 1 from the viewpoint of efficiently exhibiting an RNA interference effect.

  In the present invention, it is preferable that the number of binding of the single-stranded DNA to the double-stranded RNA is 1, and the single-stranded DNA is bound to the 5 'end of the sense strand RNA. Thus, when the single-stranded DNA is bound only to the 5 'end of the sense strand RNA, the RNA interference effect based on the double-stranded RNA can be made remarkable. Furthermore, when the single-stranded DNA is bound only to the 5 ′ end of the sense strand RNA, and the number of bases of the sense strand and the antisense strand of the double-stranded RNA is 27, respectively. Can be expressed with further enhanced RNA interference effect.

  The number of deoxyribonucleotides constituting the single-stranded DNA is not particularly limited as long as it can be hybridized with PNA described later, but for example 5 to 20, preferably 6 ~ 15, more preferably 9-12.

  The single-stranded DNA is used to hybridize with PNA described later, and the base sequence is not particularly limited, and an arbitrarily designed sequence can be adopted. Preferably, it is a single-stranded DNA that does not contain 60% or more of pyrimidine bases in the sequence, does not contain 5 or more consecutive pyrimidine bases, and particularly does not contain 3 or more consecutive cytosine bases.

  The single-stranded DNA may be directly bound to the terminal ribonucleotide of the sense strand RNA and / or the antisense strand RNA of the double-stranded RNA, or may be bound via a linker. Preferably, the former, i.e., those directly bonded without a linker.

  In order to directly bind the single-stranded DNA to the 5 ′ end of the RNA strand, specifically, the 5 ′ carbon atom of the ribonucleotide at the 5 ′ end of the RNA strand and the 3 ′ end of the 3 ′ end of the single-stranded DNA What is necessary is just to make an ester bond between the carbon atom of 'and an ester-bonded phosphate residue. In addition, in order to directly bind single-stranded DNA to the 3 ′ end of the RNA strand, a phosphate residue ester-bonded to the 3 ′ carbon atom of the ribonucleotide at the 3 ′ end of the RNA strand and the single-stranded DNA What is necessary is just to carry out ester bond with 5 'carbon atom of 5' terminal.

  Further, when the single-stranded DNA and the sense strand RNA and / or antisense strand RNA of the double-stranded RNA are bound via a linker, examples of the linker include a bifunctional linker.

  Here, the bifunctional linker is not particularly limited as long as it includes two functional groups. For example, N-succinimidyl = 3- (2-pyridyldithio) propinate, N-4-maleimidobutyric acid, S- (2-pyridyldithio) cysteamine, iodoacetoxysuccinimide, N- (4-maleimidobutyryloxy) succinimide, N- [5- (3′-maleimidopropylamide) -1-carboxypentyl] iminodiacetic acid, etc. Can be used.

  In addition to the above, as the bifunctional linker, one having the following structure can also be used.

  Here, in the general formulas (L-4) to (L-21), n1 represents an integer of 1 to 40, preferably an integer of 2 to 20, and more preferably an integer of 2 to 12.

  In the general formulas (L-22) to (L-24), n2 represents an integer of 1 to 20, preferably an integer of 1 to 10, and more preferably an integer of 1 to 6.

  Moreover, in the said general formula (L-25), n3 and n4 are the same or different, and show the integer of 1-20, Preferably the integer of 1-10, More preferably, the integer of 1-6 is shown.

  In the linkers represented by the general formulas (L-4) to (L-25), single-stranded DNA may be bound to either the right side or the left side. Preferably, single-stranded DNA is bound on the left side, and the ends of the sense strand RNA and / or antisense strand RNA of the double-stranded RNA are bound on the right side.

  Moreover, the binding site of the linker in the terminal ribonucleotide of the sense strand RNA and / or antisense strand RNA of the double-stranded RNA is not particularly limited. For example, the linker may be bonded to a hydrogen atom constituting the phosphate residue of the terminal ribonucleotide of the sense strand RNA and / or antisense strand RNA, and the hydroxyl group of the terminal ribonucleotide may be bonded. It may be substituted for and bonded to a constituent hydrogen atom.

  In the modified PNA / RNA complex of the present invention, a PNA (in the present specification, “modified type” in which a functional molecule is bound directly or via a linker as a portion having a desired function other than the RNA interference effect. PNA ”).

  PNA (official name: peptide nucleic acid) is a molecule having a nucleobase in the peptide backbone, specifically 2-aminoethylglycine as a backbone unit, and a nucleobase bound to this via a methylenecarbonyl group. It is a compound with a structure. In the modified PNA / RNA complex of the present invention, the base sequence of the modified PNA to be used may be set so that it can hybridize to the single-stranded DNA. For example, the single-stranded DNA Homology is 50% or more, preferably 80% or more, more preferably 100% (that is, a base sequence complementary to the base sequence of the single-stranded DNA) with respect to a base sequence complementary to the DNA base sequence. It is desirable that

  The number of bases constituting the PNA is not particularly limited as long as it can be hybridized with the single-stranded DNA, but for example, 5 to 20, preferably 6 to 15, More preferably, it is 9 to 12, particularly preferably the same number as the number of bases of the single-stranded DNA.

  Moreover, as the functional molecule bound to the modified PNA, a molecule capable of imparting desired functionality to the modified PNA / RNA complex of the present invention is appropriately selected and used. Specific examples of such functional molecules include peptides, proteins, sugars, amino acids, DNA, RNA, low molecular organic / inorganic materials, cholesterol, dendrimers, lipids, hydrocarbons, polymer materials, and the like. .

  Examples of the peptide include peptides composed of 2 to 40, preferably 2 to 30, more preferably 6 to 25 amino acids. Specifically, cell membrane permeation peptides [peptides with 2 to 10 arginine linked (particularly octaarginine (R8)), penetratin, etc.], nuclear localization signal peptide sequences (HIV-1 Tat, SV40 T antigen, etc.) , Nuclear export signal peptides (HIV-1 Rev, MAPKK, etc.), cell membrane fusion peptides (gp41, vial fusion peptides, etc.). Among them, in the present invention, a peptide having 2 to 10 arginines linked, particularly R8 is preferably used. Peptides (especially R8) in which 2 to 10 arginines are linked have the effect of promoting introduction into cells. If peptide nucleic acids to which such peptides are bound are used, the amount of gene introduction agent used can be reduced. Alternatively, there is an advantage that the modified peptide nucleic acid / RNA complex can be efficiently introduced into cells without using a gene introduction agent.

  As the protein, proteins existing in vivo, proteins having a pharmacological action, proteins having a molecular recognition action, etc. can be used. Examples of the protein include exportin / importin protein, febronectin, avidin, antibody, etc. Can be mentioned.

  Examples of the sugar include monosaccharides such as glucose, galactose, glucosamine, and galactosamine, and oligosaccharides or polysaccharides obtained by arbitrarily combining these.

  Examples of the low-molecular organic / inorganic material include fluorescent substances such as Cy3 and Cy5; biotin; quantum dots; gold fine particles.

  Examples of the dendrimer include polyamidoamine dendrimers.

  Examples of the lipid include fatty acids having 6 to 50 carbon atoms, DOPE (1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine) and the like. From the viewpoint of dramatically improving the RNA interference effect, nuclease resistance, and ability to migrate into the cell, preferably a fatty acid having 6 to 50 carbon atoms, more preferably lauric acid, stearic acid, myristylic acid, palmitic acid. Can be mentioned.

  Examples of the hydrocarbon include, for example, a saturated or unsaturated hydrocarbon having 6 to 50 carbon atoms, preferably a linear saturated or unsaturated hydrocarbon having 6 to 30 carbon atoms, and particularly preferably a linear chain having 12 to 28 carbon atoms. A saturated saturated hydrocarbon.

  Examples of the polymer material include polyethylene glycol and polyethyleneimine.

  Among the functional molecules, preferably peptides, lipids, and hydrocarbons, more preferably peptides, fatty acids having 6 to 50 carbon atoms, and saturated or unsaturated hydrocarbons having 6 to 50 carbon atoms, particularly Preferred are octaarginine and palmitic acid.

  In the modified PNA, the number of functional molecules bound to the PNA is not particularly limited, and only one functional molecule may be bound to the PNA. The above functional molecules may be bound to the PNA. A preferable modified PNA is exemplified by one or two functional molecules bound to the PNA. In addition, from the viewpoint of further improving the functionality of the modified PNA / RNA complex by further improving the RNA interference effect, nuclease resistance, and ability to migrate into the cell, a modified form in which two functional molecules are bonded. As a suitable example of PNA, PNA to which peptide and lipid are bound, preferably PNA to which peptide and fatty acid having 6 to 50 carbon atoms are bound, more preferably PNA to which octaarginine and palmitic acid are bound. Can be mentioned. In the case of a modified PNA in which a peptide and a lipid are bound to PNA in this way, the binding site of the peptide and lipid to PNA is not particularly limited, but the lipid is the C-terminal of PNA (the carboxyl group of the peptide backbone) And the peptide is preferably bonded to the N-terminus of the PNA (the amino group side of the peptide backbone).

  In the modified PNA, the functional molecule may be directly attached to the PNA, but is preferably bound via a linker. As the linker for linking the functional molecule and the PNA, the above-mentioned bifunctional linker can be preferably used. When the linkers represented by the general formulas (L-4) to (L-25) are used, the functional molecule may be bonded to either the right side or the left side of the linker. Preferably, the functional molecule is bound to the left side and the PNA is bound to the right side.

  In the modified PNA, the binding site of the functional molecule or a linker that links the functional molecule is not particularly limited. However, the functional molecule or the linker that links the functional molecule or the linker is not the peptide skeleton of the PNA. It is preferable that the hydrogen atom constituting the amino group on the N-terminal side or the hydroxyl group constituting the carboxyl group on the C-terminal side be substituted and bonded.

  In addition, when the functional molecule is a lipid, the carboxyl group of the lipid and the amide group of PNA may be directly bonded by an amide bond. From the viewpoint of simplicity of synthesis, the lipid and the PNA are bonded via lysine as a linker. May be combined. For example, to bind a fatty acid to the C-terminal of PNA through lysine as a linker, connect the carboxyl group at the C-terminal of PNA and the α-amino group of lysine with an amide bond, and then further link the ε-amino group of lysine with the carboxyl of fatty acid. A group may be bonded by an amide bond. In addition, in order to bind a fatty acid to the N-terminus of PNA via lysine as a linker, the amino group at the N-terminus of PNA and the carboxyl group of lysine are linked by an amide bond, and then the ε-amino group of lysine and the carboxyl group of fatty acid. May be bonded by an amide bond.

  In addition, when the functional molecule is a hydrocarbon, for example, by reacting a hydrocarbon having a terminal bromo (Br) with the ε-amino group of lysine by the Menstkin reaction, the hydrocarbon is converted to the ε-amino group of lysine. Two-linked lipid-linked lysine derivatives can be obtained. This hydrocarbon-bonded lysine derivative can be introduced at the end of PNA as described above.

  The modified PNA / RNA complex of the present invention is a complex formed by hybridizing the modified PNA to a single-stranded DNA linked to the double-stranded RNA. In the modified PNA / RNA complex of the present invention, in the single-stranded DNA region linked to the double-stranded RNA, the two modified PNAs hybridize to form a triple helical structure of PNA / DNA / PNA. Although it may be taken, it preferably has a DNA / PNA double helix structure.

  The modified PNA / RNA complex of the present invention can be prepared according to a known method. Specifically, the method of producing in the following steps (1) to (3) is exemplified: (1) DNA-bound double-stranded RNA in which the single-stranded DNA is bound directly or via a linker is known. (2) Separately, a modified PNA in which a functional molecule is bound directly or via a linker is prepared according to a known method. (3) Next, it is bound to DNA-bound double-stranded RNA. Single-stranded DNA and modified PNA are hybridized with each other according to a known method.

  In the step (3) of the method, the DNA-bound double-stranded RNA and the modified PNA are mixed at a molar ratio of 1: 1.5 to 1: 5, preferably 1: 1.5 to 1: 2, It is preferable to hybridize the DNA region of the DNA-binding double-stranded RNA and the PNA region of the modified PNA. By exposing DNA and PNA to hybridization conditions at such a molar ratio, it becomes possible to efficiently hybridize the two and improve the production efficiency of the modified PNA / RNA complex of the present invention. be able to.

Examples are given below to illustrate the present invention in more detail. These examples are illustrative only and do not limit the invention.
Reference Example 1: Synthesis of modified PNA All modified PNAs were obtained by the conventional Fmoc peptide solid-phase synthesis method. Fmoc PNA monomer was purchased from Applied Biosystems Japan. The amino acid monomer of Fmoc and the solvents and reagents necessary for synthesis were purchased from Watanabe Chemical Industry.

Specifically, a modified PNA having a peptide as a functional molecule was synthesized according to the following method. Fmoc-NH-SAL-PEG-resin was used as a modified PNA synthesis fat. First, the mixture was stirred for 7 minutes at room temperature in a dimethylformamide (DMF) solution containing 20% piperidine, and then washed with DMF. Next, the amino acid HATU (O- (benzotriazol-1-yl) -N, N, N ', N'-tetramethyluronium hexafluorophosphoric acid corresponding to the sequence of the desired modified PNA Salt) and DIPEA (N, N-diisopropylethylamine) were dissolved in DMF and then added to the resin. The mixture was stirred at 40 ° C for 60 minutes and then washed with DMF (this operation is hereinafter referred to as “coupling”). Subsequently, the mixture was stirred for 5 minutes at room temperature in a DMF solution containing 5% acetic anhydride and 6% lutidine, and then washed with DMF (this operation is hereinafter referred to as “capping”). Further, the resin was stirred with a DMF solution containing 20% piperidine at room temperature for 7 minutes and then washed with DFM (this operation is hereinafter referred to as “deprotection”). Coupling, capping, and deprotection operations using amino acids, PNA monomers, and NH _2- (CH ₂ CH ₂ O) ₂ --CH ₂ --COOH, respectively, until the desired sequence is modified PNA on the resin surface Was repeated. Thereafter, TFA (trifluoroacetic acid) / m-cresol (= 4/1 v / v) was added to the resin to which the target modified PNA was bound, and the mixture was stirred at room temperature for 90 minutes. As a result, a target modified PNA crude product separated from the resin was obtained. This crude product was separated and purified by reverse phase HPLC, and finally the target modified PNA was confirmed by MALDI-TOF Mass.

  A modified PNA to which palmitic acid (palmitoyl group) is bound as a functional molecule was synthesized according to the following method. First, the ε-amino group of lysine and the carboxyl group of palmitic acid were subjected to a dehydration condensation reaction to synthesize lysine having a palmitoyl group (hereinafter referred to as Lys (C16)). Using this Lys (C16), a modified PNA to which palmitic acid was bound and a modified PNA to which palmitic acid and a peptide were bound were synthesized according to the same synthesis method as described above.

Further, a modified PNA in which two straight-chain saturated hydrocarbons having 18 carbon atoms (stearyl group) are bonded to one PNA as a functional molecule was synthesized according to the method shown in the following reaction formula. Specifically, first, stearyl bromide was reacted with ε-amino group of lysine whose α-amino group was protected with Boc group in ethanol, and Boc- in which two stearyl groups were bonded to ε-amino group of lysine. A modified lysine was obtained. Thereafter, the Boc group was removed with TFA, and stearyl-modified lysine (Fmoc-Lys (C18) ₂ -OH) in which the α-amino group was converted to Fmoc using Fmoc-OSu (hydroxysuccinimide ester) was obtained. Using this Fmoc-Lys (C18) ₂ —OH, a modified PNA to which a stearyl derivative was bound and a modified PNA to which a stearyl derivative and a peptide were bound were synthesized according to the same synthesis method as described above.

The structure of the synthesized modified peptide nucleic acid is shown below.
Modified peptide nucleic acid:
R8-PNA: H-RRR RRR RR-linker (O2) − TGG TGC GAA −Gly−NH ₂
K8-PNA: H-KKK KKK KK-linker (O2) − TGG TGC GAA −Gly-NH ₂
Pen-PNA: H-RQI KIW FQN RRM KWK K-linker (O2) − TGG TGC GAA −Gly−NH ₂
PNA-R8: H− TGGTGC GAA −linker (O2) −RRR RRR RR−NH ₂
PNA-C16: H-linker (O6) -TGGTGC GAA -linker (O6) -Lys (C16) -linker (O2) -NH ₂
R2PNA-C16: H-RR-linker (O6) -TGGTGC GAA -linker (O6) -Lys (C16) -linker (O2) -NH ₂
R4PNA-C16: H-RRRR- linker (O6) - TGG TGC GAA -linker (O6) -Lys (C16) -linker (O2) -NH 2
R6PNA-C16: H-RRRRR-linker (O6) − TGG TGC GAA −linker (O6) -Lys (C16) -linker (O2) -NH ₂
C18-PNA-1: H- Lys (C18) 2 -linker (O6) - CTT -linker (O2) -NH 2
C18-PNA-2: H-Lys (C18) ₂ -linker (O6) -CTTCTT -linker (O2) -NH ₂
C18-PNA-3: H-Lys (C18) ₂ -linker (O6) -CTTCTT CTT -linker (O2) -NH ₂
C18-PNA-4: H-Lys (C18) ₂ -linker (O6) -RR-linker (O6) -CTTCTT CTT -linker (O2) -NH ₂

R, Q, I, K, W, F, N, and M represent amino acid units in a single letter notation. The chemical structure of Linker (O2) is -NH- (CH ₂ CH ₂ O) ₂ -CH ₂ -CO-, and the chemical structure of Linker (O6) is -NH- (CH ₂ CH ₂ O) ₆ -CH ₂ -CO -. A , T , G, and C represent monomer units of PNA. In the nucleobase part of PNA, A is adenine, T is thymine, G is guanine, and C is cytosine. In the modified peptide nucleic acids, that the N-terminus of each leftmost H and right NH ₂ in compound compound is free amines, indicating that the C-terminus is an amide.

Example 1: RNA complex having a modified PNA at the 5 'end of the sense strand
1. Synthesis and complex formation of modified PNA-2 double stranded RNA
36- and 30-base long DNA-RNA chimeric oligonucleotides having a 9-base DNA strand at the 5 ′ end of the 27-base and 21-base RNA strands were synthesized, respectively, and used as sense strands. A 9-base long single-stranded DNA region is synthesized by synthesizing a 27-base long antisense RNA having a complementary sequence to the RNA region in the 36-base DNA-RNA chimeric oligo and annealing the two. A double-stranded oligonucleotide (DNA-binding double-stranded RNA) having For DNA-RNA chimeric oligonucleotides with a length of 30 bases, a 21-base antisense RNA designed to have a 2 nt dangling end (overhang) at the 3 'end of the RNA region was synthesized. The two strands of RNA (two DNA-bound RNAs) have a 2 nt dangling end at the 3 'end of the sense and antisense strands and a 9-base long DNA region at the 5' end of the sense strand. Strand RNA) was synthesized. The oligonucleotide used here contains an antisense RNA having a homologous sequence with the Renilla luciferase gene, and is a double-stranded oligonucleotide designed to perform an RNA interference reaction in cells. The concentration of the synthesized single-stranded RNA was calculated by measuring the absorbance at 260 nm using a UV spectrum detector. Double-stranded annealing is performed by mixing the same molar sense and antisense strand oligonucleotides in universal buffer (Hayashi Kasei Co., Ltd.), heating at 92 ° C for 2 minutes, and then gradually lowering the temperature to 4 ° C. It was created by that.
The sequence of the DNA-RNA chimeric oligonucleotide is shown below.
Sense strand:
9D-27R1: 5'- ttc gca cca-CUGGCCUUUCACUACUCCUACGAGCAC -3 '
9D-27R2: 5'-ttc gca cca -X- CUGGCCUUUCACUACUCCUACGAGCAC -3 '
9D-21R1: 5'- ttc gca cca -GGC CUU UCA CUA CUC CUA CGA-3 '
Antisense strand:
27R: 3'-GACCGGAAAGUGAUGAGGAUGCUCGUG-5 '
21R: 3'-GACCGGAAAGUGAUGAGGAUG-5 '
In the sense strand sequence, lower case letters indicate deoxyribonucleotides. In the sense strand 9D-27R2, X represents a linker having the following structure.

  To form a complex between a modified peptide nucleic acid and DNA-bound double-stranded RNA, a PNA (modified) that has a homologous sequence with a 9-base long single-stranded DNA region and a peptide at the N-terminus or C-terminus Type PNA) was added to the DNA-bound double-stranded RNA in the same molar amount, followed by annealing.

  DR27A is a DNA-bound double-stranded RNA having 27-base long double-stranded RNA and 9-base-long single-stranded DNA, and DR27B is a DNA-bound double-stranded RNA in which DNA and RNA are bound by a disulfide bond. The modified PNA / RNA complex between DR27A and modified PNA was designated as DRP27A, and the modified PNA / RNA complex between DR27B and modified PNA was designated as DRP27B. In addition, a DNA-binding double-stranded RNA composed of 21-base RNA and 9-base DNA having a 2nt dangling end region is DR21A, and a modified PNA / RNA complex between this DR21A and the modified PNA. This was DRP21A. The modified peptide nucleic acids used were 1) octamer Arg (R8) bound to the C-terminal side of PNA 2) octamer Lys (K8) bound to the C-terminal side of PNA 3) Penetratin (Pen) bound to the C-terminal side of PNA, 4) Octamer Arg (R8) bound to the N-terminal side of PNA (see Reference Example 1). The modified PNA / RNA complexes that formed hybrids of this modified PNA and DR27A were designated as DRP27A-1 (DR27A + R8-PNA), DRP27A-2 (DR27A + K8-PNA), and DRP27A-3 (DR27A + Pen-), respectively. PNA), DR27A-4 (DRP27A + PNA-R8); the modified PNA / RNA complexes formed by hybridizing the modified PNA and DR27 were respectively DRP27B-1 (DR27B + R8-PNA) and DRP27B-2 (DR27B + K8-PNA), DRP27B-3 (DR27B + Pen-PNA), DRP27B-4 (DR27B + PNA-R8); each of the modified PNA / RNA complexes that hybridized with the modified PNA and DR21A is DRP21A-1 ( DR21A + R8-PNA), DRP21A-2 (DR21A + K8-PNA), DRP21A-3 (DR21A + Pen-PNA), and DRP21A-4 (DR21A + PNA-R8). FIG. 1 shows the structure of the composite.

  The synthesized modified PNA / RNA complex was confirmed using a 20% polyacrylamide gel. 10 μl (2 μM) of the hybrid solution was applied to a 20% polyacrylamide gel, and the sample was electrophoresed at 250 V for 70 minutes. Thereafter, the product was stained with a silver staining kit (GE Healthcare Bioscience) (see the product manual for staining conditions), and gel analysis was performed with ChemiImager 4000 (Alpha Innotech Corporation). The results are shown in FIG. In FIG. 2, “A (1-3)” is various RNA / PNA complexes of DRP27A, “B (1-2)” is various RNA / PNA complexes of DRP27B, and “C (1-4)” is DRP21A. The results of complex formation are shown for various RNA / PNA complexes.

  From the results shown in FIG. 2, DRP27A (-1, -2, -3) and DRP27B (-1, -2, -3), which are modified PNA / RNA complexes having peptides on the C-terminal side of DR27A and DR27B and PNA, ) Was found to form a complete binary complex. DRP27A-4 does not form a complete complex when the ratio of the RNA and the PNA is 1: 1, but is completely complex when the ratio of the RNA and the PNA is 1: 1.5 and 1: 2. It was suggested that the body was formed.

  On the other hand, in DRP21A (-1, -2, -3, -4), which is a complex of DR21A with 21 base RNA molecules and modified PNA, the ternary complex and modified PNA are not bound Chimeric double stranded oligonucleotides have been observed. From these results, it was shown that, when CPP-PNA is bound to the 5 'end of the antisense strand, a structure having relatively little steric hindrance such as DRP27A and DRP27B is suitable.

2. Processing of modified PNA / RNA complexes by Dicer We examined the processing of each modified PNA / RNA complex by Dicer. Dicer cleavage experiment was adjusted to a final concentration of 2 μM with 0.5 U recombinant Dicer (Gene Therapy Systems) in 20 mM Tris-HCl (pH 8.0), 15 mM NaCl, 2.5 mM Mg ₂ Cl solution. 10 μl of the tripartite complex was prepared in a sample tube and incubated in an incubator set at 37 ° C. for 12 hours. Thereafter, 2 μl of Dicer Stop Solution (Gene Therapy Systems) was added to the reaction solution, and 2 μl of loading dye was added to stop the cleavage reaction by Dicer. The obtained product was subjected to electrophoresis using a 20% polyacrylamide gel at 250 V for 70 minutes. Thereafter, the product was stained with a silver staining kit (manufactured by GE Healthcare Bioscience) (see the product manual for staining conditions), and gel analysis was performed with ChemiImager 4000 (manufactured by Alpha Innotech corporation). Further, as a control, siRNA (21 siRNA) composed of double-stranded RNA of 21 base length not treated with Dicer was used.

  The results are shown in FIG. In FIG. 3, “A (1-3)” is various RNA / PNA complexes of DRP27A, “B (1-2)” is various RNA / PNA complexes of DRP27B, and “C (1-3)” is DRP21A. It is a result of the processing by various recombinant Dicer of various RNA / PNA complex.

  As a result, DR27A, which has a 27-base long double-stranded RNA in the RNA region and a single-stranded DNA region at the 5 'end of the sense strand, is banded in the same position as the 21-base long siRNA in the presence of recombinant Dicer. It was strongly suggested that a 21-base siRNA containing a 2-base dangling end was generated by Dicer cleavage. In addition, it was strongly suggested that most RNA / PNA complexes were processed by a recombinant Dicer in the same way as DR27A, and a 21-base siRNA containing a 2-base dangling end was generated. In addition, in DRP27A-4, it was suggested that changing the number of equivalents of modified PNA does not affect the processing effect by Dicer. In addition, in DR27B and DRP27B (-1, -2, -3), processing to 21 siRNA by recombinant Dicer has been confirmed. From this result, it became clear that even when DNA or a modified peptide nucleic acid was bound to the 5 ′ end of a double-stranded RNA having a 27-base long RNA region, the processing by Dicer was not affected.

  On the other hand, DRP21A (-1, -2, -3, -4, which is a complex with DR21A or modified PNA, which has a dangling end of 2 bases and an RNA region of 21 bases in length and a single-stranded DNA region ), Even when treated with the recombinant Dicer, a product similar to a 21-base long siRNA was not obtained, and the position of the band was not changed at all. From this result, it was revealed that double-stranded and triple-stranded complexes having a 21-base long RNA region were not recognized by the recombinant Dicer.

3. Degradation enzyme resistance of the modified PNA / RNA complex The nuclease resistance of the modified PNA / RNA complex was investigated. Experiments were conducted using modified PNA / RNA complexes or double-stranded DNA-RNA chimeric oligonucleotides (DNA-bound double-stranded RNA) adjusted to a final concentration of 2 μM with 10% FBS (Sanko Junyaku Co., Ltd.). Incubate in RPMI-1640 medium (manufactured by Invitrogen) (final amount 110 μl) at 37 ° C., take 10 μl each after 0 h, 0.5 h, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, 24 h, 48 h, 2 μl Added to the sample tube containing the loading die. In order to stop the decomposition reaction, the sample was frozen in liquid nitrogen immediately after sampling and stored at -20 ° C. The obtained product was subjected to electrophoresis using a 20% polyacrylamide gel at 250 V for 70 minutes. Thereafter, the product was stained with a silver staining kit (manufactured by GE Healthcare Bioscience) (see the product manual for staining conditions), and gel analysis was performed with ChemiImager 4000 (manufactured by Alpha Innotech corporation). As a comparison, 21-base long siRNA having a 2-base dangling end at the 3 ′ end generally used in the siRNA method was also examined for resistance to the degrading enzyme by the same method.

  FIG. 4A shows the degradation enzyme resistance results of 21siRNA, DR27A, and DRP27A-1. From this result, it was confirmed that a 21-base long double-stranded RNA (21 siRNA) containing a 2-base dangling end was rapidly degraded in a medium containing 10% FBS. On the other hand, DR27A-1, which has a 27-base long double-stranded RNA region and a 9-base DNA region, and DRP27A-1 combined with a modified peptide nucleic acid were confirmed to have significantly higher resistance to degradation enzymes than 21 siRNA. In particular, it was confirmed that DRP27 A-1 conjugated with modified PNA possesses very high stability in a medium containing serum.

  Similarly, DRP27A-4 was also analyzed for degradation enzyme resistance. For DRP27A-4, the number of equivalents of PNA-CPP is changed to 1 equivalent, 1.5 equivalents, and 2 equivalents with respect to the double-stranded RNA, and the stability in the medium containing 10% FBS at the time of each complex formation is improved. evaluated. FIG. 4B shows the degradation enzyme resistance of the modified PNA double-stranded RNA complex when the PNA concentration is changed. As a result, it was clarified that DRP27A-4 has a high resistance to degrading enzymes as DRP27A-1. In addition, even when the number of equivalents of PNA was changed, no significant change was observed in the degradation enzyme resistance of the modified PNA / RNA complex.

4). RNA interference effect of modified PNA / RNA complex (reference test)
The RNA interference effect of each modified PNA / RNA complex was evaluated using Renilla luciferase as a target. Before the experiment, HeLa cells (human cervical cancer cells, Tohoku University Institute for Aging Medicine) adjusted to 1 × 10 ⁵ cells / ml were plated on a 96-well plate, and incubated at 37 ° C. overnight. The next day, remove the old medium on the wells, each 80 [mu] l added to fresh medium without containing an antibiotic to the well, a vector expressing firefly and Renilla luciferase (psiCHECK ^TM -2 Vector: manufactured by Promega) and Lipofectamine ^TM 2000 ( 10 μl of a complex solution (trade name, manufactured by Invitrogen) was added to each well containing HeLa cells. Here, the expression vector was set to 0.02 μg per well and Lipofectamine ^™ 2000 was set to 0.2 μl per well, and the required amount was adjusted with OptiMem (Invitrogen). In order to form a complex, the expression vector and Lipofectamine ^™ 2000 were mixed using OptiMem and then incubated at room temperature for 30 minutes. After adding the complex solution, the cells were incubated for 4 hours at 37 ° C. in the presence of 5% CO ₂ . Thereafter, an oligonucleotide complex containing an antisense sequence homologous to the genetic sequence of Renilla luciferase was allowed to form a complex with Lipofectamine ^TM 2000 (manufactured by Invitrogen) to a final concentration of 0.2 nM or 0.5 nM, and 10 μl The complex solution was added to HeLa cells into which the expression vector was introduced. Here, the final volume per well is 100 μl. The oligonucleotide / Lipofectamine ^™ 2000 complex solution was prepared by mixing 5 μl of the oligonucleotide aqueous solution with 5 μl of Lipofectamine ^™ 2000 (0.2 μl) OptiMem solution per well and incubating at room temperature for 30 minutes. After introducing the oligonucleotide, it was incubated for 48 hours, and the expression level of firefly and Renilla luciferase was measured with a luminometer (MicroLumat LB96p: manufactured by BERTHOLD) using Dula-Glo ^™ Luciferase Assay System (manufactured by Promega). Using the luciferase expression level as a control, the Renilla luciferase expression level (%) was calculated.

  FIG. 5 shows the results of the RNA interference effect. In FIG. 5, “A” indicates the RNA interference effect when DR27A, DRP27A-1, DRP27A-2, DRP27A-3, and DRP27A-3 are added at a concentration of 0.5 nM; “A-1” indicates that DR27A and DRP27A-1 RNA interference effect at an addition concentration of 0.2 nM; “B-1” has DR27B, DRP27B-1, DRP27B-2, and DRP27B-3 at an addition concentration of 0.5 nM; “B-2” has DR27B And DRP27B-1 at an added concentration of 0.2 nM; “C-1” includes DR21A, DRP21A-1, DRP21A-2, and DRP21A-3 at an added concentration of 0.5 nM; and “C "-2" represents the RNA interference effect when DR21A and DRP21A-1 are added at a concentration of 0.2 nM. For comparison, the results of the RNA interference effect of 21 siRNA and 27 nt dsRNA are also shown. As a result, it is clear that DRP27A (-1, -2, -3, -4) conjugated with DR27A and modified PNA has a higher RNA interference effect than 21 siRNA and 27nt dsRNA. It became. Moreover, it was found from this result that even a relatively large molecule such as modified PNA was bound, the RNA interference effect was not negatively affected. In addition, DR27B, DRP27B-1, DRP27B-2, and DRP27B-3, in which a linker having a difluide bond is introduced at the binding site between the DNA region and the RNA region, have confirmed that the RNA interference effect is reduced in DR27B compared to 21 siRNA and 27nt dsRNA. However, the RNA interference effect was improved by complexing CPP-PNA.

  In DR21A, DRP21A-1, DRP21A-2, and DRP21A-3 having a dangling end of 2 bases, a significant decrease in RNA interference effect was confirmed compared to 21 siRNA and 27 nt dsRNA.

  From these results, it is considered that it is suitable to use a DNA-RNA chimeric oligonucleotide whose RNA region has a length of 27 bases in order to fully exert the function of the modified PNA. In addition, in the case of DRP27A-1 and DRP27B-1, an excellent RNA interference effect was observed even at a low concentration of 0.2 nM. Therefore, the 5 ′ end of the sense strand RNA constituting the double-stranded RNA It was also confirmed that the modified PNA / RNA complex in which DNA is bound only to RNA can express the RNA interference effect more effectively.

For 21A (21 siRNA), 27A (27nt dsRNA), DR27A, DRP27A-1, and DRP27A-4, the cells were introduced into the cells with a gene transfer agent (Lipofectamine ^™ 2000), and the medium was changed 6 hours later. The RNA interference effect when incubated was also examined (D in FIG. 5). As a result, the result of the RNA interference effect when washing was performed after 6 hours and the result of the RNA interference effect when incubated without washing were relatively similar.

5. Persistence of RNA interference effect of modified PNA / RNA complex Next, the persistence of RNA interference effect of the modified PNA / RNA complex was examined. In order to evaluate the persistence of RNA interference effect, modified PNA / RNA complex or DNA-binding double-stranded RNA adjusted to 50 nM for 7 days, HeLa cells (human cervical cancer cells, Tohoku University aging medicine research) Where) and subsequent RNA interference effects were followed. The target used in the gene expression suppression experiment was Renilla luciferase, and a vector (psiCHECK ^TM -2 Vector: Promega) with firefly and Renilla luciferase genes 48 hours before measurement was Lipofectamine ^TM 2000 (Invitrogen) Was introduced into cells. In the gene expression suppression analysis, the expression level of firefly and Renilla luciferase was measured with a luminometer using Dula-Glo ^™ Luciferase Assay System (Promega), and the expression level of Renilla luciferase was controlled using the expression level of firefly luciferase as a control ( %) Was calculated. The expression vectors and modified PNA / RNA complexes used here were complexed with Lipofectamine ^™ 2000 in the same manner as described above, and 10 μl of each sample was added to the cells. The final volume of the cell solution was adjusted to 100 μl.

  The obtained result is shown in FIG. As a result, it was clarified that chimeric oligonucleotides (DR27A, DRP27A, DR27B, DRP27B) having a 27-base RNA chain possess higher RNA interference effects and persistence than 21-base siRNA. In addition, the modified PNA / RNA complex with PNA-peptide molecules bound has better RNA interference effects and persistence than DR27A and DR27B without PNA-peptide molecules bound. confirmed.

6). Cytotoxicity of modified PNA / RNA complex to HeLa cells The cytotoxicity of modified PNA / RNA complex to HeLa cells was evaluated. Before the experiment, HeLa cells (human cervical cancer cells, Tohoku University Institute for Aging Medicine) adjusted to 1 × 10 ⁵ cells / ml were plated on a 96-well plate, and incubated at 37 ° C. overnight. The next day, the old medium on the wells was removed and 90 μl of fresh medium without antibiotics was added to each well. Cytotoxicity of various RNAs was evaluated by positively introducing double-stranded RNA into cells with Lipofectamine ^™ 2000 (Invitrogen) in order to evaluate the intracellular toxicity of RNA. Form a complex with Lipofectamine ^TM 2000 (Invitrogen) so that the final concentration of PNA / RNA complex is 0nM, 0.2nM, 0.5nM, 1nM, 2nM, 5nM, 10nM, 20nM, 50nM, and 10μl of complex Was added to the above HeLa cells containing 90 μl of medium to make a final volume of 100 μl per well. A complex solution of RNA and Lipofectamine ^TM 2000 was prepared by mixing 5 μl of a PNA / RNA complex aqueous solution with 5 μl of Lipofectamine ^TM 2000 (0.2 μl) OptiMem solution per well and incubating for 30 minutes at room temperature. . HeLa cells introduced with the PNA / RNA complex were incubated at 37 ° C. for 48 hours in the presence of 5% CO ₂ . Then, add 50μl of CellTiter-Glo Reagent in CellTiter-Glo Luminescent Cell Viability Assay (Promega) to each well, and after stirring for about 60 min, measure the amount of Luminescence in each well with a luminometer (MicroLumat LB96p: manufactured by BERTHOLD) did. Since the measured amount of Luminescence depends on ATP in living cells, the amount of Luminescence of control cells (when RNA is 0 nM, Lipofectamine ^TM 2000 is 0 μl. This is defined as 100% survival rate) and various double strands are introduced. The survival rate in each well was calculated by calculating the relative value of the Luminescence amount of the obtained cells. (See Promega CellTiter-Glo Luminescent Cell Viability Assay manual.)
FIG. 7 shows the results of cell viability when the maximum concentration of the PNA / RNA complex used this time is 50 nM. As a result, the cytotoxicity of all PNA / RNA complexes was well tolerated.

7). Examination of modified PNA / RNA complex transduction into HeLa cells <br/> 24 HeLa cells (human cervical cancer cells, Institute of Aging Medicine, Tohoku University) adjusted to 1x10 ⁵ cells / ml before the experiment Each well was plated with 1 ml of 10% fetal calf serum (FBS: manufactured by Sanko Junyaku Co., Ltd.) and antibiotics (Kanamycin Sulfate: manufactured by Invitrogen), in the presence of 5% CO ₂ , The cells were cultured at 37 ° C.

Prior to introduction of the fluorescently labeled oligonucleotide, the medium was changed to a medium (450 μl) containing no antibiotics. Fluorescently-labeled oligonucleotides use double-stranded RNA, double-stranded DNA / RNA chimeric oligonucleotides, and 5 'ends of antisense RNA strands of modified PNA / RNA complexes, using FAM (5'-Fluorescein Phosphoramidite: Labeled by Glen Research). In order to form a complex with fluorescently labeled oligonucleotide and Lipofectamine ^TM 2000 (Invitrogen), 25 μl of a mixed solution of 12.5 μl of 20 μM fluorescently labeled oligonucleotide aqueous solution and 12.5 μl of OptiMem solution, Lipofectamine ^TM 2000 ( 50 μl of a mixed solution prepared by mixing 2 μl of the solution and 25 μl of the mixed solution of 23 μl of the OptiMem solution was incubated at room temperature for 30 minutes. When Lipofectamine ^™ 2000 (manufactured by Invitrogen) is not used (-LF2000 in Fig. 7), 2 µl of Lipofectamine ^™ 2000 solution in the above complex formation conditions is replaced with the OptiMem solution, and the sample is prepared in the same manner. It was adjusted. The adjusted 50 μl of the fluorescence-labeled oligonucleotide complex was added to 450 μl of the cells prepared above (final siRNA concentration: 500 nM) and incubated at 37 ° C. for 4 hours in the presence of 5% CO ₂ . Thereafter, the cells were washed three times with PBS (−) or a medium, and cell introduction was evaluated with a confocal fluorescence laser microscope and flow cytometry.

The confocal fluorescence laser microscope used a Radiance 2000 system (Bio Rad), and observed fluorescence using an argon laser. For flow cytometry, a coulter EPICS XL cytometer (Beckman coulter) was used to measure the cell transferability per 10,000 counts of cells. For flow cytometry analysis, XL EXPO32 ^™ software (Beckman coulter) was used.

The results are shown in FIGS. In FIG. 8, “A” indicates the result of observation of cell-entry properties of 27 nt dsRNA, DR27A, DRP27A-1, DRP27A-2, and DRP27A-3 with a confocal fluorescence microscope. In FIG. 8, “B” indicates the result of the flow cytometry analysis and the structure of the fluorescent labeled oligonucleotide used. In FIG. 9, “C” is a result of observing the cell transduction property when the number of equivalents of PNA-CPP to double-stranded RNA in DRP27A-4 was changed with a confocal fluorescence microscope, and “D” is its flow cytometry. The results of the analysis and the structure of the fluorescently labeled oligonucleotide used are shown. In FIG. 8, -LF2000 and + LF2000 in "A" and "B" respectively indicate the absence and presence of Lipofectamine ^™ 2000 (manufactured by Invitrogen) as a cell introduction agent. From the result of FIG. 8 “A”, in the absence of Lipofectamine ^™ 2000, molecules composed only of oligonucleotides such as 27 nt dsRNAf and DR27Af were not confirmed to be introduced into cells, but modified PNA was bound. DRP27A-1f and DRP27A-3f were confirmed to have fluorescence in the cells, and the cell introduction property was considered to be improved by the effect of the peptide bound to PNA. In the presence of Lipofectamine ^™ 2000, introduction of 27nt dsRNAf, DR27Af, and DRP27A (-1f, -2f, -3f) into cells to the same extent has been confirmed. Also in the result of FIG. 8 “B”, in the absence of Lipofectamine ^™ 2000, the intracellular fluorescence signal of DRP27A-f conjugated with CPP-PNA is better than the intracellular fluorescence signal of 27nt dsRNAf or DR27Af. It was shown to be large, and it was strongly suggested that the cell introduction property was improved by using the modified PNA.

It was confirmed that DRP27A-4 improved its cell introduction property as the number of equivalents of PNA-CPP to double-stranded RNA was increased. Moreover, high cell transferability was confirmed without using a gene transfer agent, and excellent cell transfer was confirmed by itself as the concentration of PNA increased. Furthermore, even when a gene transfer agent (Lipofectamine ^TM 2000) is used, confocal fluorescence indicates that DRP27A-4 combined with PNA-CPP has a much higher cell transferability than DR27A. This could be confirmed with a microscope and flow cytometry (FIG. 9).

Example 2 RNA complex having a modified peptide nucleic acid at the 3 ′ end of the sense strand
1. Synthesis and complex formation of modified peptide nucleic acid-double-stranded RNA
A 34-base DNA-RNA chimeric oligonucleotide (25R-9D) having a 9-base DNA strand at the 3 ′ end of a 25-base RNA strand (25R) was synthesized and used as a sense strand. 27-base antisense RNA (27R) designed to have a complementary sequence to the RNA region in the 34-base DNA-RNA chimeric oligo and to have a 2 nt dangling end at the 3 ′ end of the antisense strand. ) And annealing the two, a double-stranded oligonucleotide (DNA-bound double-stranded RNA) having a 9-base long single-stranded DNA region at the 3 ′ end of the sense strand was formed. The oligonucleotide used here contains an antisense RNA having a homologous sequence with the Renilla luciferase gene, and is a double-stranded oligonucleotide designed to perform an RNA interference reaction in a cell. The concentration of the synthesized single-stranded RNA was calculated by measuring the absorbance at 260 nm using a UV spectrum detector. Double-stranded annealing is performed by mixing the same molar sense and antisense strand oligonucleotides in universal buffer (Hayashi Kasei Co., Ltd.), heating at 92 ° C for 2 minutes, and then gradually lowering the temperature to 4 ° C. It was created by that.
The sequence of the DNA-RNA chimeric oligonucleotide is shown below.
Sense strand:
25R: 5'-GGCCUUUCACUACUCCUACGAGCAC-3 '
25R-9D: 5'- GGCCUUUCACUACUCCUACGAGCAC-ttc gca cca -3 '
Antisense strand:
27R: 3'-GACCGGAAAGUGAUGAGGAUGCUCGUG-5 '
In the sense strand sequence, lower case letters indicate deoxyribonucleotides.

  In order to form a complex between the modified PNA and 1 DNA-bound double-stranded RNA, a PNA having a homologous sequence with a 9-base long single-stranded DNA region and having a peptide at the N-terminus or C-terminus ( Modified PNA) was added to the above double-stranded oligonucleotide in the same molar amount and annealed.

  25/27 RNA double-stranded RNA of 25-base sense RNA and 27-base antisense RNA; DNA-bound double-stranded RNA with double-stranded RNA and 9-base single-stranded DNA DR25 / 27A; A complex between DR25 / 27A and modified PNA was designated as DRP25 / 27A. The modified PNA used was 1) the octamer Arg (R8) bound to the C-terminal side of PNA, 2) the octamer Lys (K8) bound to the C-terminal side of PNA 3) Four types of penetratin (Pen) bound to the C-terminal side of PNA, 4) Octamer Arg (R8) bound to the N-terminal side of PNA (see Reference Example 1). The modified PNA / RNA complexes hybridized with this modified PNA and DR25 / 27A were respectively converted to DRP25 / 27A-1 (DR25 / 27A + R8-PNA) and DRP25 / 27A-2 (DR25 / 27A + K8-PNA) ), DRP25 / 27A-3 (DR25 / 27A + Pen-PNA), DR25 / 27A-4 (DRP25 / 27A + PNA-R8). FIG. 10 shows the structure of the synthesized composite. The synthesized modified PNA / RNA complex was confirmed using a 20% polyacrylamide gel.

2. Processing of Modified PNA / RNA Complexes by Dicer Processing of each modified PNA / RNA complex by Dicer was examined. In the experiment, the same operation as in Example 1 was performed.

  The results are shown in FIG. As a result, DR25 / 27A, which has a single-stranded DNA region at the 3 'end of the sense strand, was confirmed to have a band in the same position as siRNA with 21 bases in the presence of recombinant Dicer. Many unprocessed RNA complexes were also confirmed. In addition, in DRP25 / 27A (-1, -2, -3, -4), which is a complex with a modified PNA, a part of the RNA complex is located at the same position as that of the 21-base siRNA as described above. A band was identified.

3. RNA interference effect of modified PNA / RNA complex (reference test)
The RNA interference effect of each modified PNA / RNA complex was evaluated using Renilla luciferase as a target. The experiment was performed in the same manner as in Example 1 above.

  FIG. 12 shows the result at 0.5 nM. As a result, DR25 / 27A to which only PNA was bound was observed to have a slightly improved RNA interference effect compared to 25/27 RNA composed of RNA alone. On the other hand, an improvement in RNA interference effect was observed in most modified PNA / RNA complexes compared to 21 siRNA, which is commonly used in RNA interference reactions.

Example 3 RNA complex having lipid-modified PNA at the 5 'end of the sense strand
1. Synthesis of lipid-modified PNA-double-stranded RNA and complex formation Lipid-binding PNA (PNA-C16; see Reference Example 1 for specific production method) into which palmitic acid was introduced as a functional PNA molecule was synthesized, and DNA binding 2 Hybridization was formed with the single-stranded RNA. In addition, lipid / peptide bond type PNA (R2PNA-C16, R4PNA) having a peptide in which arginine, which is a cationic amino acid at the same time as lipid, is linked by 2 residues (R2), 4 residues (R4) or 6 residues (R6) -C16, R6PNA-C16; refer to Reference Example 1 for the specific production method), and hybridization was similarly formed with DNA-bound double-stranded RNA. The DNA-bound double-stranded RNA used to form the complex with the lipid-modified PNA is the same as in Example 1. In addition, complex formation between lipid-bound PNA or lipid / peptide-bound PNA and DNA-bound double-stranded RNA was also produced in the same manner as in Example 1. The structures of the synthesized lipid-modified PNA / RNA complex and lipid / peptide-modified PNA / RNA complex are shown in FIG. In FIG. 13, DRP27A-5 (DR27A + PNA-C16) is a ternary complex of a 27-base long double-stranded RNA and a 9-base long PNA bound with palmitic acid on the C-terminal side. DRP27A-6 (DR27A + R2PNA-C16), DRP27A-7 (DR27A + R4PNA-C16), DRP27A-8 (DR27A + R6PNA-C16) have arginine at the N-terminal side of the PNA site of DRP27A-5, respectively. This is a combination of 4,6 residues.

  The lipid-modified PNA / RNA complex was formed by adding 1 equivalent or 2 equivalents of lipid-bound PNA or lipid / peptide-bound PNA to 1 equivalent of DNA-bound double-stranded RNA. The synthesized lipid-modified PNA / RNA complex and lipid / peptide-modified PNA / RNA complex were confirmed by 20% polyacrylamide gel electrophoresis (FIG. 14). Confirmation with 20% polyacrylamide was carried out in the same manner as in Example 1. As a result, it was clarified that PNA and DNA-bound double-stranded RNA formed a complex, and the formation of the complex was not hindered by lipids and peptides.

2. Processing of lipid-modified PNA / RNA complex with Dicer Next, processing of the synthesized lipid-modified PNA / RNA complex and lipid-peptide modified PNA / RNA complex into 21nt siRNA by Dicer was confirmed. The Dicer cleavage experiment was carried out in the same manner as in Example 1.

  The results are shown in FIG. As a result, processing by Dicer was confirmed in all lipid-modified PNA / RNA complexes and lipid / peptide-modified PNA / RNA complexes (DRP27A-5, -6, -7, -8). It was confirmed that it was processed into double-stranded RNA. From these results, it was confirmed that the processing by intracellular Dicer is not hindered even when lipids or peptides are bound to PNA.

3. Degradation enzyme resistance of lipid modified PNA / RNA complex The degradation enzyme resistance of lipid modified PNA / RNA complex and lipid / peptide modified PNA / RNA complex was examined. The degradation enzyme resistance experiment was performed in the same manner as in Example 1.

  The results are shown in FIG. As a result, the lipid-modified PNA / RNA complex and the lipid / peptide-modified PNA / RNA complex (DRP27A-5, -6, -7, -8) were hardly degraded even after 72 hours in 10% serum. It was revealed that it possesses a very high resistance to degrading enzymes. It is also presumed that the lipid site (C16) bound to the end of PNA forms a complex with serum proteins, which suggests a phenomenon that is highly retentive in blood and advantageous for RNA interference reactions. It was suggested that it was expressed.

4). RNA interference effect of lipid-modified PNA / RNA complex The RNA interference effect of lipid-modified PNA / RNA complex and lipid / peptide-modified PNA / RNA complex was evaluated using Renilla luciferase as a target. The cells used were HeLa cells (human cervical cancer cells, Tohoku University Institute of Aging Medicine) and SH10-TC cells (human gastric cancer cells, Tohoku University Institute of Aging Medicine). In experiments using HeLa, MEM medium (Invitrogen) was used as the medium, and kanamycin (Invitrogen) was used as the antibiotic. In experiments using SH10-TC, RPMI-1640 medium (Invitrogen) was used as a medium, and penicillin and streptomycin (Invitrogen) were used as antibiotics. The experimental procedure for the RNA interference effect was performed in the same manner as in Example 1.

  The results are shown in FIG. In FIG. 17, A is the RNA interference effect (0.5 nM) of the lipid-modified PNA / RNA complex on HeLa cells, and B is the RNA interference effect (1 nM) of the lipid-modified PNA / RNA complex on SH10-TC cells. . As a result, the lipid-modified PNA / RNA complex and the lipid / peptide-modified PNA / RNA complex showed the same or higher suppression of gene expression than the unmodified 27nt dsRNA (27A). In particular, DRP27A-5, DRP27A-6 and DRP27A-8 were observed in HeLa cells, and DRP27A-5 and DRP27A-8 showed excellent gene expression suppression ability in SH10-TC cells. In addition, they show an RNA interference effect superior to 21nt siRNA which is generally widely used. From these results, it was revealed that an excellent RNA interference effect can be achieved by using a lipid-modified PNA / RNA complex and a lipid / peptide-modified PNA / RNA complex.

5. Cell transduction properties of lipid-modified PNA / RNA complexes Cell transduction properties of lipid-modified PNA / RNA complexes and lipid / peptide-modified PNA / RNA complexes were examined using HeLa cells and SH10-TC cells. In experiments using HeLa cells, MEM medium (Invitrogen) supplemented with kanamycin (Invitrogen) was used as the medium. In experiments using SH10-TC cells, RPMI-1640 medium (Invitrogen) supplemented with penicillin and streptomycin (Invitrogen) was used as the medium. The cell introduction experiment of the lipid-modified PNA / RNA complex was performed in the same manner as in Example 1.

  The results are shown in FIG. In FIG. 18, the results of cell introduction into HeLa cells are shown in A and B, and the results of cell introduction into SH10-TC cells are shown in C and D. Here, A and C show the results of confocal fluorescence microscope analysis, and B and D show the results of flow cytometry analysis. Further, + LF2000 when a gene introduction agent was used and -LF2000 when it was not used.

  As a result, when the gene introduction agent was used, high cell introduction property was confirmed in all the complexes by confocal fluorescence microscopy and flow cytometry. It was also confirmed that the cell introduction property of the PNA / RNA complex was improved as the number of Arg residues increased. In particular, the effect was remarkable in SH10-TC cells. It was also observed that the PNA / RNA complex introduced into the cells was positively localized in the cytoplasm.

  When no gene introduction agent was used, DRP27A-5 having no cationicity was hardly introduced into the cells. However, as the number of Arg residues increased, introduction into cells was confirmed in a small amount, and DRP27A-8, which has the largest Arg number, has a certain degree of cell introduction ability even without the use of a gene introduction agent. Observed in the metric.

  These results indicate that lipid-peptide modified PNA / RNA complex conjugated with lipid and peptide conjugated at the same time has high cell transmissibility and may solve the problems of RNA interference method. It suggests.

FIG. 3 is a diagram showing the structure of a modified PNA / RNA complex synthesized in Example 1 and having a modified PNA at the 5 ′ end of the sense strand. In Example 1, it is a figure which shows the result of having confirmed the presence or absence of formation of a modified PNA / RNA complex. In Example 1, it is a figure which shows the result of having evaluated the nuclease tolerance of a modified PNA / RNA complex. In Example 1, it is a figure which shows the result of having examined the processing by Dicer of a modified PNA / RNA complex. In Example 1, it is a figure which shows the result of having evaluated the RNA interference effect of the modified PNA / RNA complex. In Example 1, it is a figure which shows the result of having evaluated the durability of the RNA interference effect of a modified PNA / RNA complex. In Example 1, it is a figure which shows the result of having evaluated the cytotoxicity of the modified PNA / RNA complex. In Example 1, it is a figure which shows the result of having evaluated the cell introduction property with respect to the HeLa cell of a modified PNA / RNA complex. In Example 1, it is a figure which shows the result of having evaluated the cell introduction property with respect to the HeLa cell of a modified PNA / RNA complex. FIG. 3 is a diagram showing the structure of a modified PNA / RNA complex synthesized in Example 2 and having a modified PNA at the 3 ′ end of the sense strand. In Example 2, it is a figure which shows the result of having examined the processing by Dicer of a modified PNA / RNA complex. In Example 2, it is a figure which shows the result of having evaluated the RNA interference effect of the modified PNA / RNA complex. In Example 3, it is a figure which shows the structure of the lipid modification type PNA / RNA complex which has lipid modification type PNA in 5 'terminal of a sense strand. In Example 3, it is a figure which shows the result of having confirmed the presence or absence of formation of a lipid modification type PNA / RNA complex. In Example 3, it is a figure which shows the result of having examined processing by Dicer of a lipid modification type PNA / RNA complex. In Example 3, it is a figure which shows the result of having evaluated the nuclease tolerance of a lipid modification type PNA / RNA complex. In Example 3, it is a figure which shows the result of having evaluated the RNA interference effect of a lipid modification type PNA / RNA complex. In Example 3, it is a figure which shows the result of having evaluated the cell introduction property of the lipid modification type PNA / RNA complex.

Claims (12)

A complex of a modified peptide nucleic acid and a double-stranded RNA,
The double-stranded RNA has a sense strand RNA having a base sequence complementary to the target sequence in the target gene, and an antisense strand RNA having a base sequence complementary to the sense strand, and the target gene A double-stranded RNA that can suppress expression,
In the double-stranded RNA, single-stranded DNA is bound to at least one end of the sense strand RNA and the antisense strand RNA directly or via a linker,
The modified peptide nucleic acid is one in which one or more functional molecules are bound to the peptide nucleic acid directly or through a linker,
The peptide nucleic acid has a sequence capable of hybridizing to the single-stranded DNA and is hybridized to the single-stranded DNA.
A modified PNA / RNA complex characterized in that   The modified PNA / RNA complex according to claim 1, wherein the sense strand RNA is composed of 19 to 30 ribonucleotides, and the antisense strand RNA is composed of the same number of ribonucleotides as the sense strand. .   The sense strand RNA is composed of 27 ribonucleotides, and the antisense strand RNA is composed of 27 ribonucleotides that are completely complementary to the sense strand RNA. Modified PNA / RNA complex.   The modified PNA / RNA complex according to any one of claims 1 to 3, wherein the single-stranded DNA is composed of 5 to 20 deoxynucleotides.   The number of bonds of the single-stranded DNA to the double-stranded RNA is 1, and the single-stranded DNA is bound to the 5 ′ end of the sense strand. Modified PNA / RNA complex.   The modified PNA / RNA complex according to any one of claims 1 to 5, wherein the modified peptide nucleic acid contains 5 to 20 bases.   The modified PNA / RNA complex according to any one of claims 1 to 6, wherein the functional molecule is a peptide.   The modified PNA / RNA complex according to any one of claims 1 to 6, wherein the functional molecule is a fatty acid having 6 to 50 carbon atoms.   The lipid-modified PNA / RNA complex according to claim 8, wherein the fatty acid is lauric acid, stearic acid, myristylic acid, or palmitic acid.   The modified PNA / RNA complex according to any one of claims 1 to 6, wherein the functional molecule is a saturated or unsaturated hydrocarbon having 6 to 50 carbon atoms.   The modified PNA / RNA according to any one of claims 1 to 6, wherein the modified peptide nucleic acid has a fatty acid having 6 to 50 carbon atoms and a peptide bound to the peptide nucleic acid directly or via a linker. Complex. A method for producing a modified PNA / RNA complex according to any one of claims 1 to 11,
A double strand which has a sense strand RNA consisting of a base sequence complementary to the target sequence in the target gene, and an antisense strand RNA having a base sequence complementary to the sense strand, and which can suppress the expression of the target gene A DNA-bound double-stranded RNA, wherein a single-stranded DNA is bound to at least one end of the sense strand and the antisense strand, directly or via a linker;
A modified peptide nucleic acid in which a functional molecule is bound to a peptide nucleic acid having a sequence capable of hybridizing to the single-stranded DNA, directly or via a linker,
Mixing at a molar ratio of 1: 1.5 to 1: 5, and hybridizing the DNA region of the DNA-binding double-stranded RNA and the peptide nucleic acid region of the modified peptide nucleic acid,
A method for producing a modified PNA / RNA complex.

Images