CN106637422B - Method for constructing Hi-C high-throughput sequencing library - Google Patents
Method for constructing Hi-C high-throughput sequencing library Download PDFInfo
- Publication number
- CN106637422B CN106637422B CN201611166469.8A CN201611166469A CN106637422B CN 106637422 B CN106637422 B CN 106637422B CN 201611166469 A CN201611166469 A CN 201611166469A CN 106637422 B CN106637422 B CN 106637422B
- Authority
- CN
- China
- Prior art keywords
- dna
- beads
- buffer
- solution
- completed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2535/00—Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
- C12Q2535/122—Massive parallel sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for constructing a Hi-C high-throughput sequencing library. The method provided by the invention can be concretely a method I, which sequentially comprises the following steps: (1) taking the uncrosslinked DNA, and purifying and enriching; (2) performing a transposition reaction; (3) performing PCR amplification to obtain a library. The method provided by the invention can be concretely a second method, which sequentially comprises the following steps: (1) taking the uncrosslinked DNA and purifying; (2) ultrasonic treatment, enrichment is carried out; (3) performing a transposition reaction; (4) PCR amplification to obtain a library. Experiments show that compared with the conventional method, the Hi-C high-throughput sequencing library constructed by the method provided by the invention has the advantages of stable and reliable result, higher data quality, easier standardization, fewer steps, shorter time and more resource saving. Therefore, the method for constructing the Hi-C high-throughput sequencing library has important application value.
Description
Technical Field
The invention belongs to the field of biochemistry, and particularly relates to a method for constructing a Hi-C high-throughput sequencing library.
Background
Classical chromatin conformation capture (Chromosome conformation capture, 3C) is a technique that is a qualitative and quantitative technique for investigating the presence or absence of interactions between DNA by quantitative means (presence or absence of PCR products, high or low yield) and the intensity of interactions, and is mainly performed by formaldehyde crosslinking, cleavage, ligation, de-crosslinking, DNA purification, PCR identification and quantification. By performing PCR amplification with a pair of primers respectively paired with the two selected DNA fragments, the presence or absence of interaction and the strength of interaction can be determined based on the presence or absence of PCR products, the yield, etc. High throughput chromatin conformation capture technology (Hi-C technology) is a derivative of chromatin conformation capture and refers to capture of whole genome chromatin conformation based on high throughput sequencing. In Hi-C technology, the whole cell nucleus is taken as a research object, and the spatial three-dimensional higher structure of the relation of the whole chromatin DNA on the spatial position in the whole genome range is researched by utilizing a high-throughput sequencing technology and combining a bioinformatics method; the three-dimensional structural information of the chromatin is obtained by capturing all DNA interaction modes in the chromatin, the gene expression regulation and control is introduced into a spatial and global research level, and a new opportunity is opened for comprehensively analyzing the mechanism of a biological process related to the DNA.
The Hi-C technology has been improved such as from solution to in-situ connection since 2009, but there are still many disadvantages such as not easy standardization, unstable results, complicated steps of library construction, long library construction time, poor data quality, etc.
Disclosure of Invention
The technical problem to be solved by the invention is how to construct a high-quality Hi-C high-throughput sequencing library.
In order to solve the technical problems, the invention firstly provides a method for constructing a Hi-C high-throughput sequencing library.
The method for constructing the Hi-C high-throughput sequencing library provided by the invention specifically comprises the following steps:
(1) Taking the DNA after the uncrosslinking, and purifying and enriching;
(2) Performing transposition reaction;
(3) PCR amplification was performed to obtain a library.
The method for constructing the Hi-C high-throughput sequencing library provided by the invention can be concretely a second method, and sequentially comprises the following steps:
(1) Taking the uncrosslinked DNA and purifying;
(2) Carrying out ultrasonic treatment and enrichment;
(3) Performing transposition reaction;
(4) PCR amplification was performed to obtain a library.
In the above method, the reaction system of the transposition reaction may include: the DNA and transposase of the previous step are completed.
The DNA subjected to the last step can be specifically DNA obtained by purifying and enriching the uncrosslinked DNA.
The DNA after the last step is specifically that the uncrosslinked DNA is purified; then, carrying out ultrasonic treatment and enrichment to obtain the DNA.
In the first or second method, the reaction system for the transposase reaction may consist of the enriched DNA, transposase and transposase buffer.
In the first or second method, the reaction system for the transposase reaction may consist of the enriched DNA, transposase and transposase buffer and water.
The transposase may be Tagment DNA Enzyme. The transposase buffer may be 2 x Tagment DNA buffer. Said 2 x Tagment DNA buffer and said Tagment DNA Enzyme are each components of Nextra DNA prep kits; nextra DNA prep kits is a product of Illumina corporation and has a catalog number of FC-121-1030.
25. Mu.L of the reaction system of the transposition reaction consists of 12.5. Mu.L of 2X Tagment DNA buffer, 1. Mu. L Tagment DNA Enzyme and 11.5. Mu.L of ddH completing the enrichment of DNA 2 O composition.
In the first or second method, the transposable reaction conditions may be: 3min at 37 ℃.
In the first or second method, the method further comprises the step (A) of: isolating DNA from the system in which the transposition reaction is completed.
In the first or second method, the specific steps of "performing PCR amplification to obtain a library" may be as follows:
(a) Preparing a reaction system A; the reaction system A consists of buffer solution and ddH 2 O is formed;
(b) Taking the reaction system A, and treating for 40-50s at 95-100 ℃;
(c) Preparing a reaction system B; the reaction system B consists of a system for completing the step (b), an upstream primer, a downstream primer and DNA separated from the system for completing the transposition reaction;
(d) And taking the reaction system B, and carrying out PCR amplification.
In the step (a), the buffer may be 2× KAPA HiFi hotstart mix. 38. Mu.L of the reaction system A can be composed of 25. Mu.L of 2X KAPA HiFi hotstart mix and 13. Mu.L of ddH 2 O composition.
The step (b) may specifically be: and taking the reaction system A, and treating the reaction system A at 98 ℃ for 45s.
In the step (c), the upstream Primer may be a Nextra Primer 1.0:5'
-AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG-3', the downstream Primer can be a Nextra Primer 2.1:5'-CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT-3' or Nextra Primer 2.2:5'
CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT-3'. 50. Mu.L of the reaction system B may specifically consist of 38. Mu.L of the system for completing step (b), 1. Mu.L of Nextra Primer 1.0 at a concentration of 25. Mu.M, 1. Mu.L of Nextra Primer 2.1 or Nextra Primer 2.2 at a concentration of 25. Mu.M, and 10. Mu.L of an aqueous solution of DNA isolated from the system for completing the transposition reaction.
In the step (d), the PCR amplification reaction program is as follows: extending at 72 ℃ for 5min; denaturation at 98℃for 30s; 15 cycles of denaturation at 98 ℃ for 15s, annealing at 65 ℃ for 30s and extension at 72 ℃ for 30s; extending at 72℃for 1min.
In the second method, the parameters of the ultrasonic treatment may be: ultrasonic frequency 35%; the ultrasonic treatment is carried out for 1s and stopped for 1s, and the total ultrasonic treatment time can be 200s.
In the first or second method, the preparation method of the 'uncrosslinked DNA' sequentially comprises the following steps:
(1) Fixing the chromatin of the biological cell nucleus with formaldehyde;
(2) Lysing the biological cells, and collecting nuclei;
(3) Restriction enzyme digestion;
(4) Adding biotinylated deoxyribonucleotide, and connecting;
(5) Proteinase K was added to the solution to crosslink the polymer.
The organism may be a bacterium, a plant or an animal. The bacteria may specifically be sulfolobus iceps REY15A.
The restriction enzyme may be the restriction enzyme HindIII.
The biotinylated deoxyribonucleotide may be Bio-16-dCTP. Bio-16-dCTP is specifically available from Trilink corporation under the product catalog number N5002.
The invention also protects a kit containing the transposase; the kit can be used for constructing a Hi-C high-throughput sequencing library. The transposase can be the Tagment DNA Enzyme.
Experiments show that the Hi-C high-throughput sequencing library constructed by the method provided by the invention has stable and reliable results, higher data quality (the number of available connecting fragments is larger, the number of available connecting fragments in enzyme-cut fragments is larger, and the like), easier standardization and fewer steps (the Hi-C high-throughput sequencing library constructed by the method provided by the invention can be identified by PCR only through transposition reaction, and the Hi-C high-throughput sequencing library constructed by the conventional method can be identified by PCR through the steps of terminal filling, A adding, connecting connectors, and the like), shorter time (the time for constructing the Hi-C high-throughput sequencing library by the conventional method is 1-2d, the time for constructing the Hi-C high-throughput sequencing library by the method provided by the invention is about 3 h), and more resource saving (the Hi-C high-throughput sequencing library constructed by the conventional method has more steps, so that DNA sample loss is more). Therefore, the method for constructing the Hi-C high-throughput sequencing library has important application value.
Drawings
FIG. 1 shows the number and proportion of fragments available for ligation and redundancy in DNA sequencing solution A.
FIG. 2 is a comparison statistic based on restriction enzyme fragments in DNA sequencing solution A.
FIG. 3 is a statistical representation of the alignment of fragments in DNA sequencing solution A.
FIG. 4 is the resolution of DNA sequencing solution A.
FIG. 5 shows the number and proportion of fragments available for ligation and redundancy in DNA sequencing solution B.
FIG. 6 is a comparison statistic based on the restriction enzyme fragments in the DNA sequencing solution B.
FIG. 7 is a statistical analysis of the alignment of fragments in DNA sequencing solution B.
FIG. 8 shows the resolution of the DNA sequencing solution B.
FIG. 9 is a graph showing the number and proportion of fragments available for ligation and redundancy in DNA sequencing solution C.
FIG. 10 is a comparison statistic based on the restriction enzyme fragments in the DNA sequencing solution C.
FIG. 11 is a statistical plot of the fragments in the DNA sequencing solution C after alignment.
FIG. 12 shows the resolution of the DNA sequencing solution C.
FIG. 13 is a chromatin coverage consistency analysis of DNA sequencing solution A and DNA sequencing solution C.
FIG. 14 is a chromatin coverage consistency analysis of DNA sequencing solution B and DNA sequencing solution C.
FIG. 15 is a chromatin coverage consistency analysis of DNA sequencing solution A and DNA sequencing solution B.
FIG. 16 is an analysis of the consistency of the interaction of DNA sequencing solution A with DNA sequencing solution C.
FIG. 17 is a graphical representation of the interaction consistency analysis of DNA sequencing solution B with DNA sequencing solution C.
FIG. 18 is an analysis of the consistency of the interaction of DNA sequencing solution A with DNA sequencing solution B.
Detailed Description
The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof.
The experimental methods in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
DSM88 Medium: will (NH 4) 2 SO 4 1.300g、KH 2 PO 4 0.280g、MgSO 4 ·7H 2 O 0.250g、FeCl 3 ·6H 2 O 0.020g、Na 2 MoO 4 ·2H 2 O 0.025mg、CaCl 2 ·2H 2 O 0.070g、Na 2 MoO 4 ·2H 2 O 0.025mg、FeCl 3 0.280mg、CuSO 4 0.016mg、MnSO 4 ·H 2 O 2.200mg、H 3 BO 3 0.500mg、ZnSO 4 ·7H 2 O0.500mg、CoCl 2 ·6H 2 O 0.046mg、CaSO 4 ·H 2 60.000mg of O, 1.000g of Tryptone and 1.000g of Yeast extract are dissolved in 1L of distilled water, and the pH value is adjusted to 3.5; sterilizing at 121deg.C for 15min.
The iceberg sulfolobus REY15A is described in the following literature: li Guo., et al genome Analyses OF Icelandic Strains OF Sulfolobus islandicus, model Organisms for Genetic and Virus-Host interactions Studies, JOURNAL OF BACTERIOLOGY, apr.2011, p.1672-1680 (the name OF Zosterum icebergii REY15A in the literature is S.islandicus strain REY 15A). The public may obtain from the institute of biological engineering (i.e., applicant) of the national institute of military medical science, the liberation army of people, to repeat the experiment.
The preparation method of the 1 XPBS buffer with pH of 7.4 comprises the following steps: to 800mL of deionized water, 0.27g of potassium dihydrogen phosphate, 1.42g of disodium hydrogen phosphate, 8.00g of sodium chloride and 0.20g of potassium chloride were added, and the mixture was thoroughly stirred and dissolved, then concentrated hydrochloric acid was added to adjust the pH to 7.4, and finally deionized water was added to a constant volume of 1L.
The restriction enzyme HindIII is a product of NEB company. 10 XNEB 2.1buffer, 2 Xquick-connect enzyme buffer and DNA quick-connect enzyme are all products of NEB company, and the product catalog numbers are B7202S, B6058S and M2200S respectively. 10×T4DNA ligase buffer, T4DNA ligase and RNase A were Thermo Fisher Scientific.MyOne TM Strepitavidin C1 is a product of Thermo Fisher company with a catalog number of 65001.QIAGEN PCR purification kit, QIAGEN MinElute PCR purification kit and QIAGEN MinElute gel recovery kit are all products of QIAGEN company, and the product catalog numbers are 28104, 28004 and 28604 respectively. Ready-Lyse TM Lysozyme is a product of Epicentre company with a catalog number of R1804M.6×The loading buffer is a product of TransGen company, and the product catalog number is GH101-01. The sequencer is a product of Illumina company, and the model number of the sequencer is HiSeq X Ten.2 x Tagment DNA buffer and Tagment DNA Enzyme are each components in Nextra DNA prep kits; nextra DNA prep kits is a product of Illumina corporation and has a catalog number of FC-121-1030. 2X KAPA HiFi hotstart mix is KAPABIOSYSTEMS company, product with catalog number KK2601. The trade name of DNA Polymerase I (Klenow Large Fragment) is "DNA Polymerase I, large (Klenow) Fragment", specifically NEB company product, catalog number M0210L. The trade name of T4DNA Polymerase is called T4DNA Polymerase, specifically NEB company product with the product catalog number of M0203L. The Klenow Fragment (3 '. Fwdarw.5' exo-) is known under the trade name Klenow Fragment (3 '. Fwdarw.5' exo-), and is specifically a product of NEB company, and the product catalog number is M0212L. Bio-16-dCTP is a product of Trilink corporation, catalog number N5002.
1 XB & W buffer was pH7.5, 5mM Tris-HCl buffer containing 2M NaCl and 0.5mM EDTA. 2 XB & W buffer is pH7.5, 10mM Tris-HCl buffer containing 4M NaCl and 1mM EDTA. Stop reaction buffer: a pH8.0, 10mM Tris-HCl buffer containing 0.2% (0.2 mg/mL) SDS and 1mM EDTA.
Example 1 comparison of two methods of construction of Hi-C high throughput sequencing library of Zostera Marinae REY15A
1. The method provided by the invention is adopted to construct a Hi-C high-throughput sequencing library of the sulfolobus Iceland REY15A
1. Cross-linking of formaldehyde
(1) Taking bacterial liquid of the sulfolobus iceberg REY15A, and inoculating (the inoculum size is 1% (v/v)) to a DSM88 culture medium to obtain an initial bacterial liquid (the volume is 50 mL); in the initial bacterial liquid, the concentration of the iceberg sulfolobus REY15A is 1.0x10 5 cfu/mL。
(2) Taking the initial bacterial liquid obtained in the step (1), and carrying out shaking culture at 78 ℃ and 220rpm for 6 hours to obtain OD 600nm The value of the culture bacterial liquid is 0.4-0.6.
(3) Adding 1.39mL of 37% (v/v) formaldehyde aqueous solution into the culture bacteria solution obtained in the step (2) to obtain a mixed solution A (the concentration of formaldehyde in the mixed solution A is 1% (v/v)); then placing at 78 ℃ and standing for 10min to obtain a crosslinking system.
(4) Adding 3.2mL of glycine aqueous solution with the concentration of 2M into the crosslinking system obtained in the step (3) to obtain a mixed solution B (the concentration of glycine in the mixed solution B is 0.125M); and then standing for 5min at room temperature to obtain a termination system.
(5) And (3) taking the termination system obtained in the step (4), centrifuging at room temperature for 10min at 2500g, collecting thalli and transferring to Kang Ningguan (15 mL in specification).
(6) 10mL of pH7.4, 1 XPBS buffer solution is added into the corning tube after the completion of the step (5), the mixture is gently sucked and mixed, and the mixture is centrifuged at 2500g for 10min at room temperature, and the supernatant is discarded.
(7) 10mL of pH7.4, 1 XPBS buffer solution is added into the corning tube after the completion of the step (6), the mixture is gently sucked and mixed, and the mixture is centrifuged at 2500g for 10min at room temperature, and the supernatant is discarded.
(8) To the corning tube after completion of step (7), 1mL of pH7.4, 1 XPBS buffer was added for resuspension to obtain a resuspension. The cells in the resuspended phase were counted using a Bio-RAD cytometer.
2. Cleavage of
(1) 100. Mu.L of the resuspension obtained in step 1 (8) (containing 1X 10) 9 Cells), the supernatant was centrifuged at 2500rpm at room temperature, and then dissolved in 100. Mu.L of 1 XTE buffer (pH 8.0 containing 1mM EDTA, 10mM Tris-HCl buffer) to obtain cells to be lysed.
(2) Adding 1 mu L of Ready-Lyse with a concentration of 2000U/. Mu.L to the thallus to be lysed obtained in the step (1) TM Lysozyme, then cleaved at room temperature for 15min to give cleavage system a.
(3) 2.5 mu L of 20% (20 g/100 mL) SDS aqueous solution was added to the first cleavage system to obtain a second cleavage system (SDS concentration in the second cleavage system was 0.5% (0.5 g/100 mL)); then cracking for 10min at room temperature to obtain a cracking system C.
(4) Taking the cracking system C, centrifuging at room temperature and 2500g for 10min, and collecting the precipitate.
3. Enzyme cutting
(1) Preparing an enzyme cutting system. 1mL of the cleavage System 100. Mu.L of the precipitate collected in step 2 (4) was 10% (10 g/100 mL) of TX-100 aqueous solution, 100. Mu.L of 10 XNEB 21buffer, 40. Mu.L of HindIII restriction enzyme solution at a concentration of 20000U/mL and 760. Mu.L of ddH 2 O composition.
(2) After the step (1) is completed, the enzyme digestion system is taken to react for 5 hours at 37 ℃ and 50 rpm/min.
(3) Taking the enzyme digestion system after the step (2) is completed, centrifuging at room temperature and 2500g for 10min, and collecting the precipitate.
4. Obtaining of Bio-DNA
(1) Preparing a reaction system. 240. Mu.L of the reaction System from the precipitate collected in step 3 (3), 1.44. Mu.L of dATP aqueous solution at a concentration of 10mM, 1.44. Mu.L of dGTP aqueous solution at a concentration of 10mM, 1.44. Mu.L of dTTP aqueous solution at a concentration of 10mM, 2.88. Mu.L of Bio-16-dCTP at a concentration of 5mM, 24. Mu.L of 10 XNEB 2.1buffer, 8. Mu.L of DNA polymerase I (Klenow large fragment) solution at a concentration of 5000U/mL and 200.8. Mu.L of ddH 2 O composition.
(2) After the completion of the step (1), the reaction system was taken and reacted at 37℃and 50rpm/min for 1.5 hours.
(3) Adding 6 mu L of 20% (20 g/100 mL) SDS aqueous solution to the system after the completion of the step (2) to obtain a termination system (in which the concentration of SDS is 0.5% (0.5 g/100 mL)); then, the mixture was allowed to stand at room temperature for 10 minutes to obtain Bio-DNA.
5. Connection
(1) Preparing a connecting system. 2.4mL of ligation System from 240. Mu.L of 10% (10 g/100 mL) TX-100 aqueous solution, 240. Mu.L of 10 XT 4DNA ligase buffer, 240. Mu.L of Bio-DNA obtained in step 4 (3), 12. Mu.L of 10mg/mL BSA aqueous solution, 80. Mu.L of 5weiss U/. Mu.L T4DNA ligase solution and 1588. Mu.L ddH 2 O composition.
(2) And (3) after the step (1) is completed, taking the connecting system, and standing at 16 ℃ for reaction for 8 hours.
(3) Adding 48 mu L of RNase A solution with the concentration of 10mg/mL into the system after the step (2) is completed to obtain an RNA treatment system (in the RNA treatment system, the concentration of RNase A is 200 mu g/mL); then treated at 37℃for 45min.
6. Decrosslinking
Adding 24 mu L of proteinase K aqueous solution with the concentration of 20mg/mL into the system of the step 5 to obtain a decrosslinking system (in the decrosslinking system, the concentration of proteinase K is 200 mu g/mL); then reacted at 65℃for 10 hours.
7. DNA purification
(1) Adding equal volume of phenol/chloroform/isoamyl alcohol (volume ratio is 25:24:1) into the system of the step 6, mixing the mixture upside down, and centrifuging the mixture at room temperature and 5000g for 10min to obtain an upper water phase A and a lower organic phase A.
(2) After the step (1) is completed, a new EP pipe is taken, an upper layer water phase A and an equal volume of chloroform are added, the mixture is mixed up and down, and the mixture is centrifuged at room temperature and 5000g for 10min, so as to obtain an upper layer water phase B and a lower layer organic phase B.
(3) After the step (2) is completed, a new EP pipe is additionally taken, 10 parts by volume of upper water phase B, 1 part by volume of NaAc aqueous solution (pH value is 5.2) and 12 parts by volume of isoamyl alcohol are added, the mixture is uniformly mixed upside down, and then sedimentation is carried out for 1h at the temperature of minus 80 ℃.
(4) After the step (3) is completed, taking the EP tube, centrifuging for 20min at 4 ℃ and 12000g, discarding the supernatant, adding 500 mu L of 75% (v/v) ethanol water solution into the precipitate, and mixing the mixture upside down; then, the mixture was centrifuged at 12000g for 5min at 4℃and the supernatant was discarded, and the precipitate was dried at room temperature, and then 95. Mu.L of ddH was added 2 O, to obtain a DNA solution.
(5) The system with single fragments removed is prepared. 120. Mu.L of the single fragment removal System consists of 95. Mu.L of DNA solution, 12. Mu.L of 10 XNEB 2.1buffer, 1. Mu.L of aqueous BSA solution at a concentration of 10mg/mL, 1. Mu.L of aqueous dGTP solution at a concentration of 10mM, 1. Mu.L of aqueous dATP solution at a concentration of 10mM, 3. Mu.L of T4DNA polymerase at a concentration of 3000U/mL and 7. Mu.L of ddH 2 O composition.
(6) After the step (5) is completed, the single fragment removing system is taken and reacted for 2 hours at the temperature of 12 ℃.
(7) Taking the system after the step (6), purifying the DNA by using a QIAGEN PCR purification kit, and using 60 mu L of ddH 2 O elution to obtain Bio-Hi-C DNA solution.
8. Ultrasonic treatment liquid
(1) 40. Mu.L of the Bio-Hi-C DNA solution obtained in step 7 (7) was taken, and 560. Mu.L of ddH was added 2 O, obtaining a diluent; the dilutions were placed on ice and then sonicated. Specific parameters of ultrasound are: ultrasonic frequency 35%; ultrasonic treatment is carried out for 1s, stop for 1s, and the total ultrasonic treatment time is 200s.
(2) Taking the system after the step (1), purifying the DNA by using a QIAGEN PCR purification kit, and using 40 mu L of ddH 2 Eluting with O to obtain ultrasonic treatment liquid.
9. Enrichment of Bio-Hi-C DNA
(1) Take 20. Mu.LMyOne TM Streptavidin C1 was placed on a magnetic rack for 1-2min, and the beads stock solution was discarded.
(2) After completion of step (1), the beads were taken, washed three times with 100. Mu.L of 1 XB & W buffer containing 0.05% (0.05 mg/100 mL) Tween, and then the supernatant was discarded.
(3) After step (2) is completed, the beads are taken and washed once with 100. Mu.L of 1 XB & W buffer.
(4) After the step (3) is completed, adding 20 mu L of the Bio-Hi-C DNA solution obtained in the step (7) and 20 mu L of 2 XB & W buffer into the beads, uniformly mixing, and then placing the mixture on a uniformly mixing instrument for reacting for 15min at room temperature; the supernatant was discarded.
(5) After the step (4) is completed, the beads are taken and washed once with 100 mu L of 1 XB & W buffer containing 0.05% (0.05 mg/100 mL) Tween; then cleaning once again with 100 mu L of 1 XB & W buffer; finally, the solution was washed once with pre-chilled Tris-HCl buffer, pH8.0, 10 mM.
10. Transposition reaction
(1) Preparing a transposition reaction system. A25. Mu.L transposition reaction system was prepared from the beads, 12.5. Mu.L 2X Tagment DNA buffer, 1. Mu. L Tagment DNA Enzyme and 11.5. Mu.L ddH completing step 9 (5) 2 O composition.
(2) After the step (1) is completed, the transposition reaction system is taken and placed on a mixing instrument to react for 3min at 37 ℃.
(3) After the completion of step (2), the supernatant was discarded, and 100. Mu.L of stop buffer was added thereto for 2 minutes.
(4) After completion of step (3), the supernatant was discarded, and then washed twice with pre-chilled pH8.0, 10mM Tris-HCl buffer, the beads were transferred to a fresh EP tube, and 10. Mu.L ddH was added 2 O is dissolved, and the liquid phase is the template solution.
11. PCR identification
(1) And preparing a PCR amplification reaction system A. 38. Mu.L of PCR amplification reaction System A was composed of 25. Mu.L of 2X KAPA HiFi hotstart mix and 13. Mu.L of ddH 2 O composition.
(2) And (3) after the step (1) is completed, taking the PCR amplification reaction system A, and treating the PCR amplification reaction system A at 98 ℃ for 45s.
(3) And preparing a PCR amplification reaction system B. 50. Mu.L of PCR amplification reaction System B from 38. Mu.L of the system for performing step (2), 1. Mu.L of Nextra Primer 1.0 (nucleotide sequence: 5 ') at a concentration of 25. Mu.M'
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG-3'), 1 μl of Nextra Primer 2.1 (nucleotide sequence: 5'
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT-3') and 10. Mu.L of the template solution obtained in the step 10 (4).
(4) And (3) after the step (3) is completed, taking the PCR amplification reaction system B, and carrying out PCR amplification to obtain a PCR amplification product.
The PCR reaction procedure was: extending at 72 ℃ for 5min; denaturation at 98℃for 30s; 15 cycles of denaturation at 98 ℃ for 15s, annealing at 65 ℃ for 30s and extension at 72 ℃ for 30s; extending at 72℃for 1min.
(5) After completion of step (4), the PCR amplification product was taken, DNA was purified using QIAGEN MinElute PCR purification kit, and 20. Mu.L of ddH was used 2 Eluting with O to obtain eluent.
(6) After the completion of the step (5), 4. Mu.L of 6×loading buffer was added to 20. Mu.L of the eluate, and the mixture was homogenized, followed by 2% agarose gel electrophoresis (voltage set at 100V, electrophoresis time 60 min).
(7) After the completion of the step (6), the gel pieces with the band size of 200-500bp were cut under an ultraviolet lamp, then recovered using QIAGEN MinElute gel recovery kit, and 10. Mu.L ddH was used 2 O is eluted to obtain DNA sequencing solution A.
And (4) obtaining a PCR amplification product, namely the Hi-C high-throughput sequencing library of the sulfolobus reesei REY15A constructed by the method.
12. High throughput sequencing
And (3) carrying out high-throughput sequencing on the DNA sequencing solution A obtained in the step (7) by adopting a sequencer, and then analyzing Hi-C data by utilizing software.
According to the method of the steps 9 to 11, the Bio-Hi-C DNA solution obtained in the step 7 of the step 4 is replaced by the ultrasonic treatment solution obtained in the step 8 of the step 4, the Nextra Primer 2.1 of the step 3 is replaced by the Nextra Primer 2.2 (the nucleotide sequence is 5'-CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT-3'), and the other steps are unchanged, so that a DNA sequencing solution B is obtained; and (3) carrying out high-throughput sequencing by adopting a sequencer DNA sequencing solution B, and then analyzing Hi-C data by utilizing software.
2. Hi-C high-throughput sequencing library of sulfolobus Iceland REY15A is constructed by adopting conventional method
1. The same as 1 in the first step.
2. As in step one, 2.
3. The same as in step 3.
4. As in step one 4.
5. The same as in step one 5.
6. As in step one 6.
7. As in step one 7.
8. The same as in step one 8.
9. Terminal filling
(1) Preparing a terminal filling system. 50. Mu.L of the end-fill System A10. Mu.L (about 100 ng) of the sonicate solution obtained in step 8, 5. Mu.L of 10 XT 4DNA ligase buffer, 0.5. Mu.L of dATP at a concentration of 10mM, 0.5. Mu.L of dTTP at a concentration of 10mM, 0.5. Mu.L of dCTP at a concentration of 10mM, 1. Mu.L of T4DNA polymerase at a concentration of 5weiss U/. Mu.L, 1. Mu.L of DNA polymerase I (Klenow large fragment) diluent at a concentration of 1U/. Mu.L, 1. Mu.L of T4 polynucleotide kinase at a concentration of 10U/. Mu.L and 30. Mu.L of ddH 2 O composition.
The dilution of DNA polymerase I (Klenow large fragment) was obtained by diluting DNA polymerase I (Klenow large fragment) to 5-fold volume with sterile water.
(2) And (3) after the step (1) is completed, taking a terminal filling system, and reacting for 30min at 20 ℃.
(3) Taking the tail end filling system after the step (2), adopting a QIAGEN PCR purification kit to purify DNA, and using 34 mu L ddH 2 Eluting with O to obtain the terminal filling solution.
10. Add "A" to react
(1) Preparing an additive A system. The 50. Mu.L addition "A" system consisted of 34. Mu.L of the end fill solution, 5. Mu.L of 10 XNEB 2.1buffer, 10. Mu.L of dATP at a concentration of 1mM and 1. Mu.L of Klenow fragment (3 '. Fwdarw.5' exo-) at a concentration of 5U/. Mu.L.
(2) After the step (1) is completed, the system of adding A is taken and reacted for 30min at 37 ℃.
(3) Taking the system of adding "A" after completing the step (2), adopting QIAGEN PCR purification kit to purify DNA, and using 9 mu L ddH 2 O is eluted, and the solution of A is added at the tail end.
11. Connecting joint
(1) Preparing a joint reaction system. The 25. Mu.L linker reaction consisted of 9. Mu.L of the "A" solution at the end, 12.5. Mu.L of 2 Xthe quick ligase buffer, 1. Mu.L of the adapter mixture dilution and 2.5. Mu.L of DNA quick ligase.
The adaptor mixture diluent is obtained by diluting the adaptor mixture to 20 times of the volume with water. The adaptor mixture was primer Top adaptor: 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATC-3' and primer Bottom adapter: 5'-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3'. In the adaptor mixture, the concentrations of the primer Top adaptor and the primer Bottom adaptor were 25. Mu.M. Both primer Top adapter and primer Bottom adapter were synthesized by Invitrogen corporation.
(2) And (3) after the step (1) is completed, taking a joint reaction system, and reacting for 15min at 22 ℃.
(3) Taking the joint reaction system after the step (2), purifying the DNA by using a QIAGEN PCR purification kit, and using 10 mu L of ddH 2 Eluting with O to obtain eluent.
(4) After the completion of the step (3), 4. Mu.L of 6×loading buffer was added to 10. Mu.L of the eluate, and the mixture was homogenized, followed by 2% agarose gel electrophoresis (voltage set at 100V, electrophoresis time 60 min).
(5) After the step (4) is completed, atThe gel pieces with the band size of 200-500bp were cut under an ultraviolet lamp, then recovered using QIAGEN MinElute gel recovery kit, and 20. Mu.L ddH was used 2 O is eluted to obtain the terminal connection joint solution.
12. Enrichment of Bio-Hi-C DNA
(1) Take 20. Mu.LMyOne TM Streptavidin C1 was placed on a magnetic rack for 1-2min, and the beads stock solution was discarded.
(2) After completion of step (1), the beads were taken, washed three times with 100. Mu.L of 1 XB & W buffer containing 0.05% (0.05 mg/100 mL) Tween, and then the supernatant was discarded.
(3) After step (2) is completed, the beads are taken and washed once with 100. Mu.L of 1 XB & W buffer.
(4) After the step (3) is completed, adding 20 mu L of terminal connection joint solution and 20 mu L of 2 XB & W buffer into the beads, uniformly mixing, and then placing the mixture on a uniformly mixing instrument for reacting for 15 minutes at room temperature; the supernatant was discarded.
(5) After the step (4) is completed, the beads are taken, washed once with 100. Mu.L of 1 XB & W buffer containing 0.05% (0.05 mg/100 mL) Tween, washed once with 100. Mu.L of 1 XB & W buffer, and finally washed once with pre-chilled pH8.0 and 10mM Tris-HCl buffer.
(6) After completion of step (5), the beads were transferred to a fresh EP tube and 10. Mu.L of ddH was added 2 O is dissolved, and the liquid phase is the template solution.
13. PCR identification
(1) Preparing a PCR amplification reaction system. 50. Mu.L of PCR amplification reaction System from 25. Mu.L of 2X KAPA HiFi hotstart mix, 1. Mu.L of Illumina Primer 1.0 (nucleotide sequence: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3') at a concentration of 25. Mu.M, 1. Mu.L of Illumina Primer Index 12 (nucleotide sequence: 5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG-3') at a concentration of 25. Mu.M, 10. Mu.L of the template solution obtained in step 12 (6), and 13. Mu.L of ddH 2 O composition.
(2) And (3) after the step (1) is completed, taking the PCR amplification reaction system, and carrying out PCR amplification to obtain a PCR amplification product.
The PCR reaction procedure was: denaturation at 98℃for 2min45s; 15 cycles of denaturation at 98 ℃ for 15s, annealing at 65 ℃ for 30s and extension at 72 ℃ for 30s; extending at 72℃for 5min.
(3) After completion of step (2), the PCR amplification product was taken, DNA was purified using QIAGEN MinElute PCR purification kit, and 20. Mu.L of ddH was used 2 Eluting with O to obtain eluent.
(4) After the completion of the step (3), 4. Mu.L of 6×loading buffer was added to 20. Mu.L of the eluate, and the mixture was homogenized, followed by 2% agarose gel electrophoresis (voltage set at 100V, electrophoresis time 60 min).
(5) After the completion of the step (4), the gel pieces with the band size of 200-500bp were cut under an ultraviolet lamp, then recovered using QIAGEN MinElute gel recovery kit, and 10. Mu.L ddH was used 2 O is eluted to obtain DNA sequencing solution C.
And (2) obtaining a PCR amplification product, namely the Hi-C high-throughput sequencing library of the sulfolobus reesei REY15A constructed by a conventional method.
14. High throughput sequencing
And (3) carrying out high-throughput sequencing on the DNA sequencing solution C obtained in the step (5) by adopting a sequencer, and then analyzing Hi-C data by utilizing software.
Hi-C data analysis results of the DNA sequencing solution A, the DNA sequencing solution B and the DNA sequencing solution C are shown in FIGS. 1 to 18. The results show that compared with Hi-C data of the DNA sequencing solution C, the number of available connecting fragments of the DNA sequencing solution A and the DNA sequencing solution B is more (namely, the number of redundant fragments is less), and the number of available connecting fragments in enzyme cutting fragments is more (namely, the number of unavailable connecting fragments is less); the consistency of chromatin coverage and interaction of the DNA sequencing solution A and the DNA sequencing solution B are higher than those of the DNA sequencing solution A and the DNA sequencing solution C and the DNA sequencing solution B and the DNA sequencing solution C.
The results show that the method provided by the invention has stable and reliable results, higher data quality and easier standardization, fewer steps (the method provided by the invention can carry out PCR identification only by transposition reaction, and the conventional method can carry out PCR identification only by the steps of terminal filling, A adding, connecting joint and the like, the time is shorter (the time for constructing the Hi-C high-throughput sequencing library by the conventional method is 1-2d, the time for constructing the Hi-C high-throughput sequencing library by the method provided by the invention is about 3 h), and resources are saved (the steps for constructing the Hi-C high-throughput sequencing library by the conventional method are more, so that DNA sample loss is more).
Claims (7)
1. A method for constructing a Hi-C high throughput sequencing library, comprising the steps of, in order:
(1) Fixing the chromatin of the biological cell nucleus with formaldehyde;
(2) Lysing the biological cells, and collecting nuclei;
(3) Restriction enzyme digestion, wherein the restriction enzyme is HindIII;
(4) Adding biotinylated dCTP to obtain biotinylated DNA, namely Bio-DNA, and connecting;
(5) Adding proteinase K, and performing crosslinking;
(6) Purifying the uncrosslinked DNA to obtain a Bio-Hi-C DNA solution;
(7) Enriching;
(8) Performing transposition reaction;
(9) Performing PCR amplification to obtain a library;
the enrichment comprises the following steps:
(a) Take 20. Mu.LMyOne TM Streptavidin C1 is placed on a magnetic rack for 1-2min, and the beads stock solution is discarded; said->MyOne TM Strepitavidin C1 is a product of Thermo Fisher company, and the product catalog number is 65001;
(b) After completion of step (a), the beads were taken, washed three times with 100. Mu.L of 1 XB & W buffer containing 0.05% (0.05 mg/100 mL) Tween, and then the supernatant was discarded;
(c) After step (B) is completed, taking the beads, and cleaning the beads once by using 100 mu L of 1 XB & W buffer;
(d) After the step (C) is completed, adding 20 mu L of the Bio-Hi-C DNA solution obtained in the step (6) and 20 mu L of 2 XB & W buffer into the beads, uniformly mixing, and then placing the mixture on a uniformly mixing instrument for reacting for 15 minutes at room temperature; discarding the supernatant;
(e) After step (d) is completed, the beads are taken and washed once with 100 mu L of 1 XB & W buffer containing 0.05% Tween; then cleaning once again with 100 mu L of 1 XB & W buffer; finally, washing the mixture once by precooled Tris-HCl buffer solution with pH of 8.0 and 10 mM;
a25. Mu.L transposition reaction system was prepared from the beads of step (7), 12.5. Mu.L 2X Tagment DNA buffer, 1. Mu. L Tagment DNA Enzyme and 11.5. Mu.L ddH 2 O composition.
2. A method for constructing a Hi-C high throughput sequencing library, comprising the steps of, in order:
(1) Fixing the chromatin of the biological cell nucleus with formaldehyde;
(2) Lysing the biological cells, and collecting nuclei;
(3) Restriction enzyme digestion, wherein the restriction enzyme is HindIII;
(4) Adding biotinylated dCTP to obtain biotinylated DNA, namely Bio-DNA, and connecting;
(5) Adding proteinase K, and performing crosslinking;
(6) Purifying the uncrosslinked DNA to obtain a Bio-Hi-C DNA solution;
(7) Performing ultrasonic treatment;
(8) Enriching;
(9) Performing transposition reaction;
(10) Performing PCR amplification to obtain a library;
the enrichment comprises the following steps:
(a) Take 20. Mu.LMyOne TM Streptavidin C1 is placed on a magnetic rack for 1-2min, and the beads stock solution is discarded; said->MyOne TM Strepitavidin C1 is a product of Thermo Fisher company, and the product catalog number is 65001;
(b) After completion of step (a), the beads were taken, washed three times with 100. Mu.L of 1 XB & W buffer containing 0.05% (0.05 mg/100 mL) Tween, and then the supernatant was discarded;
(c) After step (B) is completed, taking the beads, and cleaning the beads once by using 100 mu L of 1 XB & W buffer;
(d) After the step (c) is completed, adding 20 mu L of the ultrasonic treatment DNA solution obtained in the step (7) and 20 mu L of 2 XB & W buffer into the beads, uniformly mixing, and then placing the mixture on a uniformly mixing instrument for reacting for 15 minutes at room temperature; discarding the supernatant;
(e) After step (d) is completed, the beads are taken and washed once with 100 mu L of 1 XB & W buffer containing 0.05% Tween; then cleaning once again with 100 mu L of 1 XB & W buffer; finally, washing the mixture once by precooled Tris-HCl buffer solution with pH of 8.0 and 10 mM;
a25. Mu.L transposition reaction system was prepared from the beads of the completion of step (8), 12.5. Mu.L 2X Tagment DNA buffer, 1. Mu. L Tagment DNA Enzyme and 11.5. Mu.L ddH 2 O composition.
3. A method according to claim 1 or 2, characterized in that: the conditions of the transposition reaction are as follows: 3min at 37 ℃.
4. A method according to claim 1 or 2, characterized in that: after the "transposition reaction", before the "PCR amplification to obtain library", step (A) is further included: isolating DNA from the system in which the transposition reaction is completed.
5. The method of claim 4, wherein: the specific steps of the PCR amplification and library acquisition are as follows:
(a) Preparing a reaction system A; the reaction system A is bufferedFluid and ddH 2 O is formed;
(b) Taking the reaction system A, and treating for 40-50s at 95-100 ℃;
(c) Preparing a reaction system B; the reaction system B consists of a system for completing the step (b), an upstream primer, a downstream primer and DNA separated from the system for completing the transposition reaction;
(d) And taking the reaction system B, and carrying out PCR amplification.
6. The method of claim 2, wherein: the parameters of the ultrasonic treatment are as follows: ultrasonic frequency 35%; ultrasonic treatment is carried out for 1s, stop for 1s, and the total ultrasonic treatment time is 200s.
7. A method according to claim 1 or 2, characterized in that: the organism is a bacterium, a plant or an animal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611166469.8A CN106637422B (en) | 2016-12-16 | 2016-12-16 | Method for constructing Hi-C high-throughput sequencing library |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611166469.8A CN106637422B (en) | 2016-12-16 | 2016-12-16 | Method for constructing Hi-C high-throughput sequencing library |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106637422A CN106637422A (en) | 2017-05-10 |
| CN106637422B true CN106637422B (en) | 2023-10-13 |
Family
ID=58822754
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611166469.8A Active CN106637422B (en) | 2016-12-16 | 2016-12-16 | Method for constructing Hi-C high-throughput sequencing library |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106637422B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107217309A (en) * | 2017-07-07 | 2017-09-29 | 清华大学 | Build the method and its application in the DNA sequencing library of testing gene group |
| CN109056078A (en) * | 2018-09-18 | 2018-12-21 | 武汉菲沙基因信息有限公司 | A kind of Hi-C high-flux sequence banking process suitable for bacterium |
| CN109735900A (en) * | 2019-03-20 | 2019-05-10 | 嘉兴菲沙基因信息有限公司 | A kind of small fragment DNA library construction method suitable for Hi-C |
| CN110607352A (en) * | 2019-08-12 | 2019-12-24 | 安诺优达生命科学研究院 | Method for constructing DNA library and application thereof |
| CN110527715A (en) * | 2019-09-16 | 2019-12-03 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | A kind of sequencing approach of functional genome clone word bank |
| CN111364105B (en) * | 2020-04-30 | 2021-09-07 | 华中农业大学 | Simple and effective construction method of plant long fragment in situ DLO Hi-C sequencing library |
| CN116755692B (en) * | 2023-08-18 | 2023-11-24 | 山东为农信息科技有限公司 | Infinite hierarchy selection method and system related to android system |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103710323A (en) * | 2012-10-01 | 2014-04-09 | 安捷伦科技有限公司 | Immobilized transposase complexes for DNA fragmentation and tagging |
| CN103938277A (en) * | 2014-04-18 | 2014-07-23 | 中国科学院北京基因组研究所 | Trace DNA-based next-generation sequencing library construction method |
| CN104561362A (en) * | 2015-02-03 | 2015-04-29 | 北京诺禾致源生物信息科技有限公司 | High-throughput sequencing library and construction method thereof |
| CN105525357A (en) * | 2014-09-30 | 2016-04-27 | 深圳华大基因股份有限公司 | Sequencing library construction method, and kit and application thereof |
| CN105839196A (en) * | 2016-05-11 | 2016-08-10 | 北京百迈客生物科技有限公司 | Hi-C high-throughput sequencing and database building method for eukaryote DNA |
-
2016
- 2016-12-16 CN CN201611166469.8A patent/CN106637422B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103710323A (en) * | 2012-10-01 | 2014-04-09 | 安捷伦科技有限公司 | Immobilized transposase complexes for DNA fragmentation and tagging |
| CN103938277A (en) * | 2014-04-18 | 2014-07-23 | 中国科学院北京基因组研究所 | Trace DNA-based next-generation sequencing library construction method |
| CN105525357A (en) * | 2014-09-30 | 2016-04-27 | 深圳华大基因股份有限公司 | Sequencing library construction method, and kit and application thereof |
| CN104561362A (en) * | 2015-02-03 | 2015-04-29 | 北京诺禾致源生物信息科技有限公司 | High-throughput sequencing library and construction method thereof |
| CN105839196A (en) * | 2016-05-11 | 2016-08-10 | 北京百迈客生物科技有限公司 | Hi-C high-throughput sequencing and database building method for eukaryote DNA |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106637422A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106637422B (en) | Method for constructing Hi-C high-throughput sequencing library | |
| US10669571B2 (en) | Compositions and methods for targeted depletion, enrichment, and partitioning of nucleic acids using CRISPR/Cas system proteins | |
| US20210047635A1 (en) | Transposase compositions for reduction of insertion bias | |
| CN113166797A (en) | Nuclease-based RNA depletion | |
| CN109593757B (en) | Probe and method for enriching target region by using same and applicable to high-throughput sequencing | |
| CN106754811A (en) | A kind of saltant type Tn5 transposases and its preparation method and application | |
| WO2023202030A1 (en) | Method for constructing high-throughput sequencing library of small rna | |
| CN108265104B (en) | Chromosome configuration capture library and construction method thereof | |
| CN112941635A (en) | Second-generation sequencing library building kit and method for improving library conversion rate | |
| CN111909983A (en) | Hi-C high-throughput sequencing database building method applicable to microbial metagenomics and application | |
| CN110158157B (en) | Method for synthesizing DNA library with fixed length and specific terminal sequence based on template material | |
| AU6314801A (en) | Sequence based screening | |
| CN108251515A (en) | A kind of method for building FFPE sample DNAs library | |
| CN113227370B (en) | Single-stranded DNA synthesis method | |
| CN113667714B (en) | Target area capturing method, kit and sequencing method | |
| JP2002537821A (en) | A method for large-scale cDNA cloning and sequencing by repeating subtraction | |
| CN111440843A (en) | Method for preparing chromatin co-immunoprecipitation library by using trace clinical puncture sample and application thereof | |
| CN111893170B (en) | Method for detecting CRISPR-Cas off-target effect in whole genome range in vitro | |
| CN112080555A (en) | DNA methylation detection kit and detection method | |
| CN115851876A (en) | Sequencing method for simultaneously obtaining whole genome transcription and protein-DNA binding information | |
| CN116218811A (en) | High throughput screening method for adverse resistant DNA polymerase by PCR enrichment amplification method | |
| CN114703173A (en) | Lambda phage DNA extraction kit and extraction method | |
| JP2002253237A (en) | Method of preparing normalized and/or subtracted complementary dna library | |
| WO2020135650A1 (en) | Method for constructing a gene sequencing library | |
| CN114410813B (en) | Method for identifying cytosine quadruplet site of plant genome DNA at whole genome level |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhao Zhihu Inventor after: Shen Wenlong Inventor after: Ye Bingyu Inventor after: He Chao Inventor before: Ye Bingyu Inventor before: He Chao Inventor before: Zhao Zhihu Inventor before: Shen Wenlong |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |