JP2002253237A - Method of preparing normalized and/or subtracted complementary dna library - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method of efficiently preparing normalized and/or subtracted long-chain and full-length coding or full length cDNA libraries. SOLUTION: A method of preparing normalized and/or subtracted cDNA wherein the normalized and/or subtracted cDNA is the reverse transcript of mRNA, namely uncloned cDNA (cDNA tester), is provided. The method of preparing the cDNA libraries comprises the step (a) is which the cDNA tester is prepared; the step (b) in which the normalized and/or subtracted RNA driver are prepared; the step (c) where the resultant normalized and/or subtracted RNA driver are mixed with the cDNA tester; the step (d) in which an enzyme capable of cleaving the single strand sites among the normalized and/or subtracted drivers nonspecifically binding to the cDNA tester; the step (e) in which the single strand RNA driver cleaved is removed from the tester and the tester/driver hybrids are also removed; and the step (f) in which the objective normalized and/or subtracted cDNA are collected.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

FIELD OF THE INVENTION The present invention relates to improved normalized and / or subtracted cDNAs or cDNAs.
The present invention relates to a method for preparing a DNA library. The invention further relates to a method for improving the normalization and subtraction steps by removing non-specific binding hybrids.

[0002]

2. Description of the Related Art cDNAs
Methods for preparing libraries have been previously disclosed and are well known in the art. For example, Ederly I.,
Kato S., et al., 1995, Mol Cell Biol, 15: 3363-3371;
1994, Gene, 150: 243-250; or K. Maruyama et al., 199.
5, Gene, 138: 171-174.

[0003] Among them, Carninci et al., 1996, Genom
ics 37: 327-336; Carninci et al., 1997, DNA Research, 4:
61-66; and Carninci and Hayashizaki, 1999, Methods
Enzymol, 303: 1-44 describes an efficient method for preparing cDNAs. These methods are based on tagging the cap structure, followed by long, full coding and / or full length cDNA.
all specific coding sequences and their 3 'and 5' untranslated regions, including a modified "tagged cap trapper" for selecting a library
Long chain, including (UTRs), full coding and / or full length
Enables preparation of a cDNAs library. Such a library contains cloned (truncated) clones.
(EST sequence), long chain, full coding chain and / or full length (full-coding / lengt
h)) Particularly useful in large-scale sequencing projects where clone recovery is essential.

However, long chains, complete coding /
Preparation of a full-length cDNAs library has several problems. Preparation of long, full-coding / full-length cDNAs can be performed more efficiently for short mRNAs (transcripts) than for long mRNAs. In addition, cloning and amplification are more difficult with long cDNAs than with short cDNAs, further creating a length bias. Retrieving full-length cognate using truncated cDNAs is not practical on a genomic scale. However, in the standard library, the cDNAs can be cloned in long, full-coding / full-length or truncated form, regardless of their length, and at least one EST in any gene. It is advantageous to discover.

[0005] Another problem relates to the nature of cellular mRNA. mRNA is "very dominant" based on its expression.
(Or high expression level) mRNA '', `` mR with moderate expression level
NA "and" mRNA whose expression level is low ". In a typical cell, 5-10 highly dominant m
RNA contains at least 20% of the total mRNA amount, and 500 to 2,000 species have moderate expression mRNA is 40 to 60% of the total mRNA amount
Included and low expression of 10,000 to 20,000 mRN
A is present in less than 20 to 40% of the total mRNA amount. The average distribution varies greatly from tissue source to tissue distribution, and further varies with the presence of highly expressed genes. In the cDNA sequencing of a standard cDNA library, a gene having a low expression level cannot be efficiently found because a medium-expression cDNA and a high-expression cDNA are sequenced more than once.

[0006] As described above, when a very predominant mRNA and a moderately expressed mRNA are identified, the level of redundancy (red
andancy level) is expected to exceed 60%. Therefore,
In order to solve this problem, a hybridization normalization method was proposed. The principle of normalization is to reduce the frequency of the most highly expressed clones while increasing the frequency of non-dominant cDNAs. Some of the normalization methods for the preparation of EST cDNAs are described in Soares et al., 1994, Proc. Natl.
Acad. Sci. 91: 9228-9232. This method involves reassociation of the amplified plasmid library.
(reassociation). However, amplified plasmid libraries to be normalized are not suitable for preparing long, full-coding / full-length cDNAs. Because the plasmid library
Short-chain cDNAs are cloned efficiently with cloning bias on the size of the cDNA, but the longer the longer, the lower the cloning efficiency. In fact, Soar
In es et al., 1994, DNA was cloned into a plasmid and subsequently converted to tester single-stranded DNA, and after ligation to the plasmid, long cDNAs were less likely to be recovered (i.e., longer cDNAs). Is easily lost).

Furthermore, in the amplification of a library performed prior to normalization, the ease of growth of a cDNA clone varies depending on the length of the plasmid. Therefore, long, full-coding / full-length clones are underrepresented after bulk amplification of the library (u
nderrepresent) tend. Recovery of long, full-coding / full-length clones is more difficult with amplified plasmid libraries.

Other references, such as Tanaka et al., 1996, Genomics, 35: 231-235, disclose methods for preparing EST sequences in which mRNA first anneals to oligo dT conjugated to a solid matrix. This method uses mRNA prior to cDNA synthesis.
Due to degradation, it is not suitable for producing normalized long, full-coding / full-length cDNAs. Furthermore,
The rate of hybridization of the nucleic acid immobilized on the solid phase is lower than the rate of liquid hybridization. Libraries generated by PCR and solid-phase matrix-based normalization techniques known in the prior art have sequence redundancy similar to the non-normalized cDNA libraries used in the ESTs project. ).

[0009] Furthermore, for the purpose of preparing a cDNA library or encyclopedia (for example, a mammalian full-length cDNA encyclopedia), or recovering at least one long chain, full-coding / full-length cDNAs per expressed gene regardless of tissue origin. Another problem with the preparation of a library is that in order to find new, long, full-coding / full-length cDNAs more quickly, it is not only necessary to remove only redundant (overlapping) cDNAs in the library, but also It is desirable to also remove cDNAs already contained in the library.

In order to solve this problem, a hybridization subtraction method has been proposed. Sagerstr
om, et al., Annu. Rev. Biochem., 1997, 66: 751-83,
The whole picture of the subtraction method known in the prior art is reported. The idea behind the subtraction is that the nucleic acid of the expressed sequence (tracer or tester) that remains as a result of the subtraction to be isolated hybridizes to a complementary nucleic acid (driver) that is thought not to contain the sequence in question. In some cases, the driver is present at a much higher concentration than the tester. When the tester and driver nucleic acid populations are ready to hybridize, only sequences that are common in the two populations form a hybrid. After hybridization, the driver-tester hybrid and the unhybridized driver are removed and the remaining nucleic acid is used to prepare a library rich in tester-specific clones, or
It can be used to generate probes used for library screening for tester specific clones.

On the other hand, the subtraction method has problems associated with technologies based on PCR and solid-phase matrices as described in the normalization,
Suitable for preparing EST sequences, but cannot be used for long, full coding / full length cDNAs.

[0012] Bonaldo et al., 1996, Genome Research, 6:79.
No. 1-806 discloses subtractive hybridization specifically applied to reduce the expression of clonal populations already sequenced from a normalized library that needs further consideration. I have.

[0013] However, while this normalization and subtraction technique (Bonaldo et al. 1996) is useful for large-scale gene discovery through EST studies, the amplification technique disclosed in Soares et al., 1994, is useful. The shortcomings already shown in cDNA cloned on plasmids that have been shown), long and full coding / full length cDNA
Not suitable for inserts.

In particular, as described above, in the amplification of the library prior to the normalization and subtraction steps, the amplification of the cDNA clone varies with the length of the plasmid, and after bulk amplification of the library, the expression of long clones Decreases. That is, the expression of cloning of long cDNAs is relatively reduced, and the cloning becomes difficult.

Another problem with the normalization and subtraction steps disclosed by Bonaldo et al. Is that both the normalization and the subtraction steps result in disruption of the plasmid, especially large plasmids (including long cDNAs). It requires incubation and an incubation period, and the number of long clones is very limited or completely lost due to the normalization and subtraction steps.

It is also evident from this that this method is not suitable for the preparation of normalized and subtracted long, full-coding / full-length cDNAs. A further problem with the normalization and / or subtraction methods is related to the formation of non-specific binding tester / driver hybrids during these steps due to incomplete sequence complementarity binding. Removal of such hybrids can be achieved by using the target
NA, which results in misrecognition of abundant cDNA and / or cDNA already sequenced in other libraries, and is in fact a cDNA that is neither predominant nor already sequenced, The target cDNA will be removed from the tester.

It is therefore an object of the present invention to solve some of the problems in the prior art, and to provide a method for efficiently preparing a normalized and / or subtracted long and full coding / full length cDNA library. It is to provide.

[0018]

SUMMARY OF THE INVENTION The present invention provides a procedure (methodology) that not only can normalize cDNA but also can subtract cDNA already revealed in other libraries. Therefore, according to the present invention, the normalized and / or subtracted
An efficient method for producing cDNA, preferably long, and / or full coding / full length cDNA or cDNA libraries is provided, which solves problems based on PCR and solid matrices. You.

That is, one embodiment of the present invention relates to a method for producing a normalized and / or subtracted cDNA, wherein the normalized and / or subtracted cDNA is used.
Non-cloned cD mRNA reverse transcript
NA (hereinafter referred to as cDNA tester). This method solves the problems in the prior art caused by a cloned cDNA tester amplified with a plasmid.

Still another embodiment of the present invention includes the following steps. I) a step of preparing an uncloned cDNA tester, preferably a cDNA not cloned into a plasmid; II) a step of preparing a polynucleotide driver for normalization and / or subtraction; III) a step of normalization and / or subtraction (One or more steps), a tester obtained from normalization and / or subtraction /
Removing the driver hybrid and removing the unhybridized polynucleotide driver IV) recovering the normalized and / or subtracted cDNA. The cDNA tester is preferably a long chain, full coding / full length cDNA.

[0021] The method of the present invention further comprises the steps of:
A step of preparing NA and cloning the recovered double-stranded cDNA can be included.

According to another aspect, the present invention relates to a method for producing a cDNA, preferably a long, full-coding / full-length cDNA, wherein the normalization and subtraction drivers are mixed and the normalization and subtraction are singly performed. It is performed in one step (normalization / subtraction).

According to a further aspect of the present invention, the non-specifically bound RNA / DNA hybrid is treated with an enzyme capable of cleaving a single-stranded site of the RNA driver to provide a non-specifically bound RNA / DNA hybrid. By removing the RNA (driver) bound to the cDNA (tester), a method is provided for improving normalization and / or subtraction. This enzyme is a nuclease, especially single-stranded RNA
Can be cleaved, or a mixture thereof. Preferably, RNas
eI (also indicated as RNase 1) can be used.

However, this treatment is not limited to normalization and subtraction hybrids in the method for producing cDNA, but also applies to any type of non-specifically bound RNA / DNA hybrid.
RN partially single-stranded as a result of non-specific binding
Cleavage of the A site, which results in non-specifically bound RNA /
Can be used to selectively remove DNA hybrids.

Therefore, by treating the non-specifically bound RNA / DNA hybrid with an enzyme capable of cleaving single-stranded RNA (cleaving the site of partially single-stranded RNA) , A method for preparing single-stranded and / or double-stranded cDNA, a method for removing the cleaved RNA, and a method for recovering cDNA.

The normalized and / or subtracted cDNA prepared by any of the methods according to the present invention is single-stranded.
It can be either cDNA or double-stranded cDNA.

[0027]

According to one aspect of the present invention, a normalized and / or subtracted cDNA or cDNA
Efficient methods of making NA libraries, preferably long, and / or full coding / full length cDNA libraries are provided.

This method eliminates the need for a PCR cloning step prior to the normalization and / or subtraction step (one or more steps) and the binding of oligo-dT to a solid matrix, resulting in long chains, And / or full coding cDNA / full length cDNA is recovered. Thus, the method according to the invention may comprise only the normalization step, only the subtraction step, or both the normalization step and the subtraction step in no particular order, or the normalization and the subtraction may be performed simultaneously in a single step.

These normalized and / or subtracted cDNAs, if single-stranded, are processed for the synthesis of a complementary second strand and are finally cloned. Therefore, this method includes the following steps. I) a step of preparing an uncloned cDNA (tester); II) a step of preparing a polynucleotide (driver) for normalization and / or subtraction; III) a step of normalization and / or subtraction (one or more). Step) to remove the resulting tester / driver hybrid and unhybridized polynucleotide driver; IV) Normalized and / or subtracted cDNA
Recovering (rare and / or novel cDNA).

Furthermore, the method according to the present invention comprises, if the cDNA tester is single-stranded, V) preparing and cloning the second strand of the cDNA. The above steps I) to V) can be repeated appropriately several times (for example, twice, three times, etc.). The uncloned cDNA tester of step I) can be a cDNA that has not been cloned into a plasmid. Uncloned cDN of step I)
The A tester is designed for cloning cDNA
It can be a reverse transcript of the mRNA. Preferably, the uncloned cDNA tester of step I) is a long chain and / or a full coding cDNA / full length cDNA.

For the purposes of the present invention, the term full-length cDNA refers to 5 'and 3' UTR sequences and T-primer oligonucleotides (complementary to mRNA containing poly-A). A complete coding cDNA is a cDNA sequence that contains at least start and stop codons. A long cDNA is a nearly full-coded and / or full-length cDNA strand that is complementary at its 3 ′ end (corresponding to the 5 ′ end of an mRNA), or tentatively, to a cDNA that is complementary to that mRNA ( That is, considering that the cDNA strand has the same direction as the gene), it is understood that the cDNA sequence has one or more bases deleted at the 5 'end.
This initial stop (stop before reaching the 5 'end)
This can be caused by forming a secondary structure at the level of the Cap structure, and will hinder cDNA synthesis.

[0032] The cDNA tester according to the present invention can be single-stranded or double-stranded. If it is double-stranded,
It is treated by known techniques that dissociate the double strand into single strands and form a cDNA / RNA hybrid in the presence of an RNA driver. One example of this technology is the tester duplex
Mixing the cDNA with an RNA driver in the presence of formamide at a concentration of 50%, preferably more than 80%, at a temperature of 40-60 ° C, preferably 50 ° C, in a conventional hybridization buffer. The cDNA tester in step I)
Any method of preparing cDNA known in the art, preferably long, and / or full-coding full-length cDNA
Can be performed using any method known as the preparation of For example, Ederly et al .; Kato et al .; or Maruyama et al. (Oligo-capping method).

In particular, this oligo-capping method
Incomplete cDNA phosphates without 5'Cap are removed by using alkaline phosphatase, and then all cDNAs are converted to tobacco as a decapping enzyme so that only full-length cDNAs have phosphate. Processed by mosaic virus (TAP).

Preferably, Carninci et al. 1996, Genomics 3
7: 327-336, and Carninci and Hayashizaki 1999, Method
Enzymol, 303: 1-44, using the CAP-capture technique. An example of this method is shown schematically in section A of FIG.

The mRNA is isolated from the tissue, and the RNA-DNA hybrid is prepared by using the mRNA as a template.
It is made by a primer such as oligo dT, or by a reverse transcriptase initiated from a random or specific primer-adapter. The tag molecule is then chemically bound to the diol structure of the 5'CAP ( ^7MeG _ppp N) site of the mRNA forming the hybrid. Finally, from the hybrid with the tag molecule, an RNA-DNA hybrid having a DNA corresponding to the long, full-coding / full-length mRNA is isolated by binding the tag molecule.

Tag molecules bound to Cap after RNA-DNA hybridization are particularly useful. Because RNA-DNA
This is because the hybrid structure of (1) can avoid chemical cleavage of the mRNA in the aldehyde conversion of the diol structure required for the mRNA labeled with the tag molecule. as a result,
The efficiency of full coding / full length cDNA synthesis is increased.

The binding of the tag molecule to the 5 'Cap site is
For example, to form a dialdehyde, an oxidizing agent such as sodium periodate can be used to proceed by an oxidative ring-opening reaction of the 5 'Cap site diol structure, followed by a reaction of the hydrazine-terminated tag molecule with the dialdehyde. .

Examples of the tag molecule having a hydrazine terminal include biotin, avidin or streptavidin, and a digoxigenin molecule having a hydrazine terminal. Molecules that exhibit reaction specificity, such as antigens or antibodies, can also be used as tag molecules. In particular, the labeling molecule used as the tag molecule is not particularly limited.

Thus, the generation of the cDNA used to perform any of the methods according to the present invention involves the following steps. (1) a step of synthesizing a first-strand cDNA by a reverse transcriptase that forms an mRNA / cDNA hybrid; (2) 5′CAP ( ^7MeG ) of the mRNA forming the hybrid;
(3) a step of chemically binding a tag molecule to the diol structure of the _ppp N) site; (3) a step of capturing a long-chain, full-coding, full-length cDNA hybrid; and (4) an enzyme capable of cleaving a single-stranded mRNA. A step of removing single-stranded mRNA by digestion using (preferably using RNase H) or using an alkali (preferably NaOH).

As a more specific method of the above method (a more specific example for producing cDNA), (1) synthesis of the first cDNA strand, (7) full-length double-stranded cDNA / full-length cDNA (for example, biotin ) As a tag molecule). (1) Synthesis of first-strand cDNA (synthesis of RNA-DNA hybrid); (2) Biotinylation of mRNA of RNA-DNA hybrid; (3) Digestion of ribonuclease I (RNase I); (4) (Avidin or streptavidin beads) (5) removal of RNA hybrids (RNase H digestion); (6) G tail addition by terminal deoxynucleotidyl transferase; (7) oligo C Preparation of the second strand (double stranded full coding / full length cDNA) starting with

Alternatively, step (5) can be performed by using an alkali (preferably NaOH). The cDNA prepared in step (6) can be used as a cDNA tester for the purpose of the present invention. Steps after normalization and / or subtraction
(7) can also be performed. Obtained by the method of step I)
The cDNA was obtained from various c-types as shown in section B of FIG.
The DNA population consists of superprevalent (ie, highly expressed or class I), intermediate (ie, class II) and rare cDNA (ie, class III) (intermediate and superprevalent together). , As an abundant in section B). Some of these cDNAs have already been previously recovered in libraries elsewhere and have been shown in section B.
The cDNA must be considered as already recovered cDNA. The resulting cDNA is shown in Section B as "tester".

In step II), a "driver" for normalization and / or subtraction is prepared. A normalization driver is RNA or DNA obtained from the same tissue and / or the same population as the population to be removed. The normalization driver can be, for example, a cellular mRNA of the same library, which is an aliquot of the mRNA used initially for cDNA library preparation (starting mRNA). Normalization drivers are cDNAs obtained from the same library to be normalized.
Can also be In this case, a single-stranded cDNA is prepared from the cDNA library, for example, by using PCR.

The subtraction driver was obtained from a different organization than the one trying to do the subtraction.
RNA or DNA, RNA or DNA obtained from the same or different strain (strain) as the one to be substracted, or belonging to the same but different tissue from the population to be removed Can be. In vitro transcribed RNA from a DNA library, preferably a cap trap (Ca
Clones from different tissues or from different tissues but from the same tissue, created by the p-trap) method, can be used for the subtraction step. But Sa
Subtraction drivers prepared by any known method, such as those described in Gerstrom et al. 1997, Annu. Rev. Biochem., 66: 751-83, can be used for the purposes of the present invention.

The subtraction driver is, for example,
It can be a run-off transcript from a mini-library containing the expressed genes, rearranged clones and, in some cases, but not necessarily, previously sequenced cDNA. Subtraction run-off transcripts are obtained by RNA polymerase (eg, T7, T3, SP6 or K11 RNA polymerase) from a DNA template having a suitable promoter, such as, for example, DNA sequences flanking the promoter, plasmids, phages and the like. Can be In the case of a plasmid, the subtraction transcript is
It can be prepared by amplifying a cDNA library, a rearranged library by a solid phase or a liquid phase. Preferably, subtraction transcripts are prepared by spotting colonies from a well plate (e.g., a 384 well plate) on LB + ampicillin agar plates and growing at a temperature of 30-37 [deg.] C. Can be scraped off and used for bulk plasmid preparation.

DNA can also be used for subtraction drivers. In this case, single-stranded DNA isolated from clones obtained from different tissues or different DNA populations but obtained from the same tissue can be used. A mini-library is a library that contains a portion of a clone of a source tissue or a portion of a clone of a different tissue.

A schematic example of a driver for normalization and / or subtraction is prepared as shown in section C of FIG. However, the method according to the invention may comprise only the normalization step, only the subtraction step, the normalization step and the subtraction step in no particular order, or the normalization / subtraction in a single step. These drivers can be associated with tag molecules. The (first) tag molecule can be bound to the driver as any molecule or tag that can be bound, or can be bound to a matrix that allows for the removal of the driver. A tag molecule can bind to yet another tag molecule (which can be the same as the first tag molecule or a different molecule), and this second tag molecule can bind to a matrix or one layer of tag molecules . The tag molecule can preferably be biotin, avidin, streptavidin, digoxigenin or any antibody, preferably an anti-biotin antibody, anti-avidin antibody, anti-strept or anti-digoxigenin, or any anti-antigen antibody. However, tag molecules are not limited to these substances.

With respect to steps III) and IV), they can be performed in different orders depending on whether the normalization and subtraction steps are performed sequentially or in a single step. According to the first approach, the normalization step III) is performed by mixing a normalization driver, followed by removal of the hybrids and recovery of the normalized single-stranded cDNA (step IV). These single-stranded cDNAs are then mixed with a further subtracting driver (step III) to remove hybrids and (normalized and) the subtracted single-stranded cDNAs.
(Step IV) is performed. Single-stranded cDNA recovered
Contains rare and novel cDNAs as illustrated in section D of FIG. The above normalization and subtraction steps can be performed in the reverse order.

According to another approach, the normalization driver prepared in step II) and the subtracting driver are mixed, and step III) is performed as a single normalization / subtraction step. Performing the normalization / subtraction in a single step has the advantage that it can be performed in a single incubation step. Performing normalization / subtraction in two separate and distinct steps raises the problem of performing two incubation steps, and as the number of each incubation step increases, longer chains and / or full coding / full length cDNAs
It is an advantage that this can be done in a single incubation step, as the number tends to decrease.

However, if necessary before the final recovery of rare and novel cDNA and the synthesis of the second strand of cDNA, the normalization and / or subtraction step and the single normalization / subtraction step may be repeated. it can. Thus, the present invention provides
Preparing a NA tester (which is not, but not limited to, cloned by the first form above), I
I) a step of preparing a polynucleotide normalization driver and a polynucleotide subtraction driver (normalization / subtraction driver), III) performing normalization and subtraction in a single step by mixing a tester and a normalization / subtraction driver, and IV. Also disclosed is a method of preparing a normalized and subtracted cDNA, comprising a step of recovering the normalized and subtracted cDNA. This method comprises the steps of adding an enzyme capable of cleaving a single-stranded RNA driver, for example, RNase I,
And recovering the cleaved single-stranded RNA driver. This RNase I or other enzyme capable of cleaving a single-stranded RNA driver will be described in detail later.

The preparation of the driver for normalization and / or subtraction, the hybridization step (one or more steps), and the hybrid and the single driver (hybrid forming) made by the normalization and / or subtraction step Removal of “unwanted cDNA” (eg, no driver) is described, for example, in Bonaldo et al. 1996, Sagerstrom et al. 1997, Annu. Rev. Bi.
ochem. 66: 751-783 (from page 765; also see Table 1) can be performed using any of the known techniques.

As specific examples, Barr FG and Beverly S.
Emanuel (1990, Analytical Biochemistry, 186: 369-3
73) or Hazel L. Sive and Tom St John (1988, Nucleic
Acids Research, Vol. 16, number 22, pages 10937), and hybridization techniques involving photoactive biotin, streptavidin binding and organic extraction can be used. However, for example, Sagerstrom et al. 19
Known techniques such as those described in 97 can also be used.

After normalization and / or subtraction, the tester / driver hybrid
For example, it is removed using any known technique, as described in Sagerstrom et al. 1997 (from page 765). For example, matrices such as beads, preferably magnetic beads or agarose beads, may be used. The beads are preferably covered with or associated with the tag molecule as described above. Preferably, beads covered with streptavidin (generally referred to as streptavidin beads), more preferably, magnetic porous glass (MPG) and streptavidin beads (manufactured by CPG). Beads covered or bound with avidin, biotin, digoxigenin, antibodies or antigens may also be used. Antibodies that cover or bind the beads (one or more beads) are generally tag molecules, preferably antibodies that recognize the antibody bound to the driver, or biotin, avidin, streptavidin or digoxigenin bound to the driver bar. May be an anti-biotin antibody, an anti-avidin antibody, an anti-streptavidin antibody, or an antibody capable of recognizing an anti-digoxigenin antibody.

Examples of magnetic beads that are bound to or covered with biotin are shown in FIG. 1, section F, as tag molecules that form a tester / driver hybrid assembly. Instead of magnetic beads, streptavidin or avidin / phenol can also be used to remove hybrids (Sive HL and St. John).
T., 1988, Nuceic Acids Res., 16: 10937; and Sagers
trom et al., 1997). For removal of tester / driver hybrids, hydroxyapadite (HAP) and unlabeled RNA can also be used. For example, Sagerstro
It is described in Table 1 on page 765 of M et al.

The removal of the tester / driver using the subtraction method according to the present invention can remove almost 100% as is apparent from the electrophoresis of FIG. 6 and Example 3. Removed tester / driver hybrid
The cDNA can be used to create a cDNA mini-library for use as a further subtraction step, as shown in section F of FIG.

The normalized and subtracted cDNAs (rare and novel cDNAs) recovered in step IV) were obtained as described schematically in section E of FIG.
It is processed for DNA second strand synthesis, restriction enzymes, ligation reactions and cloning into vectors. An advantage of the method according to the invention is that the ratio of long, full-coding / full-length cDNA in the subtracted / normalized library can be kept high. In addition, the method uses standard full-length cDNA generated by prior art.
The discovery of new genes can be enhanced compared to the results obtained using the library. That is, in the method of the present invention, the normalized and / or subtracted
cDNA that has not been cloned (tester cDNA)
It is. Preferably it has not been cloned into a plasmid. Preferably, the tester of the invention is a reverse transcript of the mRNA in the form of an uncloned cDNA. This cDNA is preferably single-stranded. Therefore, it is possible to avoid the problem of the cloning bias with respect to the size of cDNA in the plasmid library and the problem of the library generated by the normalization technique based on PCR and solid-phase matrix in the conventional method, and to provide a novel gene. There is an advantage that the discovery can be enhanced.

As mentioned in the prior art section, another problem with the normalization and / or subtraction methods is that non-specific tester / driver A hybrid is formed. For example, this is due to cross-reactivity between similar but not identical sequences between the tester and the driver. Removal of such hybrids can result in erroneous abundant and / or
Or to eliminate cDNAs that are already considered to be sequences already contained in other libraries, or cDNAs of other desirable sequences, which is a serious drawback of normalized / subtracted libraries. .

This problem is schematically illustrated in FIG. On the left-hand side of FIG. 2, the normalized and / or subtracted driver (mRNA, upper strand) is new and / or rare but was incorrectly believed to be abandoned and / or was already collected Non-specifically binds to cDNA (lower strand) (some of mRNA does not bind to cDNA). The cDNA tester that has bound to the driver, even with non-specific binding, is removed during normalization and / or subtraction, as shown in FIG. Therefore, if the cDNA tester is a new and / or rare cDNA, they will also be lost. In the method of the present invention, such non-specific binding is, for example, as shown on the right side of FIG. 2, the driver that binds to the cDNA tester in a non-specific state is RNase I
Alternatively, the RNA is removed by digesting the RNA with another enzyme as described below, and the new and / or rare cDNA is recovered.

According to one embodiment of the present invention, as shown in FIG. 2, an enzyme that cleaves single-stranded RNA (cleaves a single-stranded site in an RNA driver nonspecifically bound to a cDNA tester). Non-specifically bound by an enzyme capable of
Treat (digest) the NA / DNA hybrid and non-specifically
The single-stranded site of RNA (driver) bound to DNA (tester) is cut, and then the cDNA tester and the cut RN
Eliminating (denaturing) the hybrids between A removed the cleaved RNA from the system and improved the efficiency of normalization and subtraction by leaving the cDNA tester (i.e., the intention from the rare cDNA system). (Reduced elimination).

The method of removing RNA fragments from non-specifically bound RNA / DNA hybrids treated with an enzyme that cleaves single-stranded RNA is not limited, for example, as shown in FIG. By treating the hybrid at an appropriate temperature, the hybrid between the cDNA tester and the cleaved RNA is eliminated, i.e., denatured and RN released from the cDNA tester.
A can be removed using, for example, a tag bound to RNA. The elimination of the hybrid between the cDNA tester and the cleaved RNA does not affect the hybrid in the specifically bound RNA / DNA hybrid, but the hybrid in which the chain length of the cleaved and hybridized portion is reduced. Conditions for selectively denaturing are appropriately selected.
Denaturation conditions depend not only on temperature but also on the pH and salt concentration of the system (aqueous solution containing the hybrid). The denaturation temperature condition is, for example, a treatment at a temperature of 25 to 100 ° C. (that is, up to the boiling point), preferably 37 to 70 ° C., more preferably 65 ° C. For example, the above-mentioned temperature denatures the hybrid in which the RNA is partially cleaved, the RNA constituting the hybrid is dissociated from the cDNA, and the dissociated R
The NA is bound to the beads using the tag bound to the RNA, and the RNA fragments bound to the beads can be removed using a magnet in a conventional manner. Also, the specifically bound RNA / DNA hybrid can be maintained under the above-mentioned denaturing conditions, and can be removed by binding to the beads using the tag bound to RNA in the same manner as described above. That is, original normalization and / or subtraction is performed.

The enzymes for cleaving the single-stranded RNA include:
For example, a single-strand-specific RNA endonuclease (ribonuclease) can be used. For example, RNase A specific for pyrimidines (U and C), RNase I specific for U
V, G specific RNase T1, U specific RNase II or
RNase III or RNase I capable of degrading any type of ribonucleoside can be used (Hyone-Myong
Eun, Chapter for "Nucleases"; Sorrentino Salvator
e and Libonati Massimo, 1997, FEBS Letters, 404: 1-
Five). Alternatively, RNaseT2 with almost no base specificity
Can also be used as an enzyme to cleave single-stranded RNA (BioTec
hniques, 232, Vol. 12, No. 2, 1992).

As an enzyme that cleaves single-stranded RNA, RNase I is more preferably used. Mixtures of the ribonucleases exemplified above may also be used. Single-strand-specific RNA
The endonuclease can act on the hybrid according to a conventional method. For example, 0.01 to 1 unit of single-strand-specific RNA endonuclease can act on 1 μg of driver. The step of degrading the mRNA driver non-specifically bound to the cDNA tester can be performed in the step of normalization / subtraction according to the present invention.
Alternatively, it can be performed after performing the subtraction step or after performing the single normalization / subtraction step. A cDNA tester according to the present method can be a cloned or uncloned cDNA. An uncloned tester can be, for example, a cDNA that has not been cloned in a plasmid. This cDNA tester is a reverse transcript of mRNA, preferably in the form of an uncloned cDNA. The cDNA tester is preferably a long, full-coding and / or full-length cDNA prepared by the cap-trapping method described above.

One embodiment of the present invention is a method specifically including the following steps. (a) preparing a cDNA tester; (b) preparing a normalization and / or subtraction RNA driver; (c) normalization and / or subtraction as two steps, in no particular order, or normalization / subtraction as one step. Mixing a normalization / subtraction RNA driver with the cDNA tester; (d) adding an enzyme capable of cleaving a single-stranded site in the RNA driver nonspecifically bound to the cDNA tester; (E) removing the single-stranded RNA driver cleaved in step d) from the tester and removing the tester / driver hybrid; (f) normalized and / or subtracted cDNA
(G) a step of preparing the second strand of cDNA and cloning the recovered cDNA.

The above-described treatment method for removing the single-stranded RNA driver can be applied to methods other than normalization and subtraction hybrid in the method for producing cDNA. For example, any kind of non-specific
It can also be used to remove partially single-stranded RNA in RNA / DNA hybrids.

That is, the present invention relates to non-specifically bound RNA
/ A method of removing non-specifically bound RNA by treating the DNA hybrid with an enzyme capable of degrading single-stranded RNA. In this method, a non-specifically bound RNA / DNA hybrid is treated with an enzyme capable of degrading single-stranded RNA, and the RNA that is non-specifically bound to DNA is degraded to obtain DNA and / or DNA. Alternatively, it is a method of removing from a mixture of DNA and an RNA / DNA hybrid specifically bound. This method can be used for the purpose of recovering DNA nonspecifically bound to RNA, or for recovering only DNA hybrids specifically bound to RNA. In this method, the enzymes capable of degrading single-stranded RNA are RNaseI, RNase
A, RNaseIV, RNaseT1, RNaseT2, RNaseII and RNaseIII
Or a mixture thereof, and is preferably RNase I.

The RNA / DNA hybrid containing the non-specifically bound RNA / DNA hybrid may be a product obtained by a normalization method, a product obtained by a subtraction method, a method comprising normalization and a subtraction step performed in any order, Alternatively, it can be the result of a single-step method of normalization / subtraction. That is, RNA / DN obtained by conventional normalization and / or subtraction methods
Non-specifically bound RNA / DNA hybrids can be removed from the A hybrids to improve the recovery efficiency of long or rare cDNAs. Accordingly, the cDNA that forms the non-specifically bound RNA / DNA hybrid can be a long, full-coding and / or full-length cDNA.

Further, the present invention provides a method for isolating a single-stranded cDNA, wherein the hybrid containing RNA nonspecifically bound to the cDNA is treated with an enzyme capable of degrading single-stranded RNA, The degraded single-stranded RNA is removed, and the D
A method comprising recovering NA. In this method, single-stranded RNA (degraded) produced by treatment with an enzyme capable of degrading single-stranded RNA is removed from the system containing the hybrid, and as a result, the single-stranded cDNA is removed. Is collected. According to this method, cDNA that nonspecifically binds to a certain RNA can be selectively recovered. Also in this method, as described above, enzymes capable of degrading single-stranded RNA include Rnase I, RNase A, RNase IV, R
NaseT1, RNaseT2, RNaseII and RNaseIII can be selected from the group consisting of, or a mixture thereof, RN
It is preferably aseI. In addition, the cDNA can be a long chain, full coding and / or full length cDNA.

Further, the present invention provides a normalization method comprising adding an enzyme capable of degrading a single-stranded RNA driver non-specifically bound to a cDNA tester, and removing the degraded single-stranded RNA driver. And / or a method for producing a subtracted cDNA. in this way,
A single-strand R hybrid consists of a cDNA tester and a single-stranded RNA driver nonspecifically bound to this cDNA tester.
Degraded by the action of an enzyme capable of degrading the NA driver, after degradation, the degraded single-stranded RNA driver,
It is a method of removing from a system containing the hybrid. Also in this method, as described above, enzymes capable of degrading single-stranded RNA are RNaseI, RNaseA, RNaseIV, RNaseT.
1, selected from the group consisting of RNaseT2, RNaseII and RNaseIII, or a mixture thereof;
It is preferred that In addition, the cDNA can be a long chain, full coding and / or full length cDNA.

The method of the present invention may comprise one or more cD
Can be used to create NA libraries,
The present invention can be obtained by these methods of the present invention.
Includes cDNA or cDNA libraries.

Finally, the method according to an embodiment of the present invention allows: (i) high efficiency removal of mRNA drivers; (ii) no reduction in relevant cDNA size that can affect the frequency of long, full-coding, full-length cDNAs; (iii) both normalization and subtraction. (Iv) low cross-reactivity between similar but not identical sequences; and (v) both high levels of reproduction in terms of the size and number of libraries generated and easy to handle .

[0070]

The methods and embodiments of the present invention are further described with reference to the following examples. Example 1 Preparation of RNA Slices (0.5-1 g) of brain tissue (or other tissues described in Example 2) were prepared in solution D (Chomczynski, P. and Sacchi, N.,
1987, Annal. Biochem., 162: 156-159) and homogenized in 10 ml and extracted with 1 ml of 2M sodium acetate (pH 4.0) and the same volume of phenol / chloroform mixture (5: 1 by volume). After extraction, the same amount of isopropanol was added to the aqueous phase to precipitate RNA. The sample was incubated on ice for 1 hour and centrifuged at 4000 rpm for 15 minutes with cooling to collect the precipitate. 70% of sediment
Washed with ethanol and dissolved in 8 ml of water. 2ml 5M
16 ml aqueous solution containing NaCl and 1% CTAB (cetyltrimethylammonium bromide), 4 M urea, and 50 mM Tris
Addition of 16 ml (pH 7.0) precipitated the RNA and removed the polysaccharide (CTAB precipitate). After centrifugation at 4000 rpm for 15 minutes at room temperature, the resulting RNA was dissolved in 4 ml of 7M guanidine-Cl. Then, 2 volumes of ethanol were added to the solution, incubated on ice for 1 hour, and
Centrifuged for minutes. The obtained precipitate was washed with 70% ethanol and collected. The precipitate is again dissolved in water,
RNA purity was determined by measuring the OD ratios 260/280 (> 1.8) and 230/260 (<0.45).

CDNA synthesis 10 to 10 μg of this RNA, 5 μg of first-strand primer (5 ′-(GA) ₅ AGGATCCAAGAG) containing BamHI and SstI restriction enzyme sites
CTC (T) ₁₆ VN-3 ′) (SEQ ID NO: 1) and 11.2 μl of 80% glycerol were mixed to a total volume of 24 μl. This RNA primer mixture was denatured at 65 ° C. for 10 minutes. In parallel,
18.2 μl 5X first strand synthesis buffer, 9.1 μl 0.1 M DTT,
6.0 μl of 10 mM (respectively) dTTP, dGTP, dATP and 5-
Methyl-dCTP (instead of dCTP), 29.6 μl of saturated trehalose (about 80%, low metal content; Fluka Biochemika), and 10.
0 μl of reverse transcriptase Superscript II (200 U / μl) was mixed to a final volume of 76 μl. To the third tube 1.0
μl of [α- ³² P] dGTP was added. The mRNA, glycerol and primer were mixed with the solution containing Superscript II on ice, and an aliquot (20%) was quickly added to a tube containing [α- ³² P] dGTP. First strand cDNA synthesis was performed in a thermocycler with a heated lid (eg, MJ Research) using the following program: first step, 2 minutes at 45 ° C .; second step, gradient annealing: 35 ° C. Cooling for 1 minute;
Third step, complete annealing, 35 ° C for 2 minutes; Fourth step, 50 ° C for 5 minutes; Fifth step, 0.1 ° C / sec to 60 ° C; Sixth step, 55 ° C for 2 minutes; Seventh step At 60 ° C for 2 minutes;
Return to the 8th and 6th stages for another 10 cycles. The yield of cDNA can be estimated by radioactivity incorporation (Car
ninci and Hayashizaki, 1999). The resulting cDNA was treated with proteinase K, phenol / chloroform and chloroform extracted, and ethanol precipitated using ammonium acetate as a salt (Carninci and Hayashiza).
ki, 1999).

Biotinylation of mRNA Prior to biotinylation, the diol group of the cap and the 3 ′ of the mRNA were
Ends are suspended mRNA / first strand cDNA hybrid, 66
mM sodium acetate (pH 4.5), and oxidized in a final volume of 50μl containing a 5 mM NaIO _4. The samples were incubated on ice for 45 minutes in the dark. The mRNA / cDNA hybrid was subsequently treated with 0.5 μl of 10% SDS, 11 μl of 5M NaCl,
And precipitation by the addition of 61 μl of isopropanol. 45 minutes on ice in the dark, or -20 or -80
After incubating at 30 ° C for 30 minutes, the sample is
Centrifuged at 5,000 rpm. Finally, the mRNA / cDNA hybrid was washed twice with 70% ethanol and resuspended in 50 μl of water. Subsequently, the cap was filled with 5 μl of 1 M sodium acetate (pH 6.1), 5 μl of 10% SDS, and 150 μl of 10 mM biotin hydrazide long-arm (Vector Biosystem)
Was biotinylated in a final volume of 210 μl.

After overnight (10 to 16 hours) incubation at room temperature (22 to 26 ° C.), the mRNA / cDNA hybrid
μl 1 M sodium acetate (pH 6.1), 5 μl 5 M NaC
and precipitated by the addition of 750 μl of absolute ethanol and incubated on ice for 1 hour or at -20 to -80 ° C. for 30 minutes. 15,000 rpm for mRNA / cDNA hybrid
The pellet was washed once with 70% ethanol and once with 80% ethanol. 70 μl mRNA / cDNA hybrid
Resuspended in 0.1X TE (1 mM Tris [pH 7.5], 0.1 mM EDTA).

Capture and Separation of Full-Length cDNA 500 μl MPG-Streptavidin Beads and 100 μg DNA
Free tRNA was mixed and the mixture was incubated on ice for 30 minutes with occasional agitation. The beads were separated using a magnetic stand for 3 minutes and the supernatant was removed. The beads were then washed with 500 μl of wash / binding solution (2 M NaCl, 50 mM EDT
A, pH 8.0).

At the same time, m in the buffer provided to the manufacturer
Per 1 μg of raw material mRNA to RNA / cDNA hybrid sample
One unit of RNase I (Promega) was added (final volume 200 μl
l); samples were incubated at 37 ° C for 15 minutes. To stop the reaction, place the sample on ice and add 100 μg of tRN
A and 100 μl of 5M NaCl were added. To capture the full coding / full length mRNA / cDNA hybrid, the biotinylated mRNA / cDNA treated with RNaseI and the washed beads were mixed and resuspended in 400 μl of the wash / binding solution. After mixing, the tube was gently rotated for 30 minutes at room temperature. Full coding / full length cDNA remained on the beads and no shortened cDNAs. Beads were separated from the supernatant with a magnetic stirrer. Nonspecifically adsorbed cDNA
Beads were gently washed to remove s from the beads: twice with wash / binding solution; 0.4% SDS, 50 μg / ml
Once with tRNA; 10 mM Tris-HCl (pH 7.5), 0.2 mM EDT
A, once with 40 μg / ml tRNA, 10 mM NaCl, and 20% glycerol; once with 50 μg / ml tRNA in water. cDNA is 50 μ
The beads were released from the beads by the addition of 1 l of 50 mM NaOH, 5 mM EDTA, and by incubation at room temperature for 10 minutes with occasional shaking. The beads were subsequently removed using magnetism, and the extracted cDNA was added to 50 μl 1 M Tris on ice.
-Transferred to a tube containing HCl, pH 7.5. The elution cycle is 50 mM until most of the cDNA is recovered from the beads (80% to 90% while monitoring radioactivity on a manual monitor).
1 or 2 using 50 μl aliquots of NaOH, 5 mM EDTA
Repeated times.

Next, the RNA biotinylated in the subsequent step
Quickly add 100 μl of 1 M Tris-HCl to the recovered cDNA on ice to remove any RNA residues that may interfere with
pH 7.0 and 1 μl of RNase I (10 U / μl) were added and the samples were subsequently incubated at 37 ° C. for 10 minutes.
The cDNA was treated with proteinase K, phenol / chloroform extracted, and back-extracted. Then 2-3 μg in siliconized tube
Was added and the sample was ethanol precipitated. Alternatively, samples can be run on Micr at 2000 rpm for 40-60 minutes.
Concentrated by one ultrafiltration using ocon 100 (Millipore). If precipitated with ethanol, 20 μl of cDNA
Redissolved in 0.1X TE.

In this experiment, RNase H digestion was not performed, but hydrolysis was performed with NaOH, which can simultaneously hydrolyze and denature the double strand.

CL-4B Spin Column Filtration of cDNA cDNA samples were purified by CL-4B chromatography (Carninci and Hayashiza) essentially as described by the manufacturer.
ki, 1999) or S-400 spin column (Amersham-Pharmacia)
Processed by

Oligo-dG tailing of first strand cDNA cDNA sample, 5 μl of 10 × TdT buffer (2 M potassium cacodylate [pH 7.2], 10 mM MgCl ₂ , 10 mM 2-mercaptomethanol), 5 μl of 50 μM dGTP, 5 μl 10 mM CoC
l ₂ and 40 U terminal deoxynucleotidyl transferase were mixed to a final volume of 50 μl.
The samples were incubated at 37 ° C. for 30 minutes. Finally, the reaction was stopped with 20 mM EDTA, the cDNA was treated with proteinase K, extracted with phenol-chloroform and ethanol precipitated. The samples were finally redissolved in TE (10 mM Tris pH 7.5-8.0, EDTA 1 mM). As described (Carninc and Hayashizak
i, 1999) After confirming the tail length, the cDNA is used in second strand synthesis for use in library validation (see below) or normalization and / or
Alternatively, it was used as a cDNA tester to be used for subtraction.

Normalization Driver An mRNA driver containing an aliquot of the raw material mRNA is called a "normalizing or normalization driver". To calculate the concentration of the normalizing driver, the rate of first strand synthesis incorporation reflects the actual mRNA concentration, i.e., the priming and elongation efficiency is 100%.
%, The ribosome in the raw material mRNA /
Structural RNA impurities were estimated. Also, the percentage of mRNA that is converted to first-strand cDNA is excluded from the calculation as it corresponds to the actual mRNA concentration, and less than full-length cDNA is excluded from the calculation; usually not all mRNAs are primed, A slight excess of normalization drivers is unlikely to have the dramatic effects of driver shortages. Therefore, the amount of mRNA in the sample
It was assumed to be the same as the amount of cDNA.

Subtraction Driver The subtractive driver is a non-overlapping RIKEN cDNA by using T7 and T3 RNA polymerase.
It contained bulk run-off transcripts prepared from rearranged libraries prepared from encyclopedias and cloned mini-libraries.

The mini-library contains in this sample the cDNA of about 1000 to 2000 clones from the normalization experiment carried out in the same way as described in this example. Mini-libraries were prepared from aliquots (high-expressing cDNA fractions) that were by-products of the normalization experiments using standard protocols. After normalization, the abundant cDNA fraction was removed from the beads using 50 mM NaOH / 5 mM EDTA; after neutralization, the second strand cDNA was prepared. Cloning was performed in a manner similar to that described above (Carninci and Hayashizaki, 1999). Plasmids were subsequently bulk-excised and 1000-
2000 clones were amplified on agarose / ampicillin. For driver preparation, plate 20,000 to 50,000 colonies on SOB agarose / ampicillin (150 mm plate size radius) (Sambrook et al. 1989, "Mol
ecular Cloning: A laboratory Manual "Cold Spring H
arbor Laboratory Press, Cold Spring Harbor, N
Y), the plates were incubated overnight at 37 ° C. and the bacterial cells were stripped from the plates in the presence of a resuspension solution (Wizard DNA extraction kit; Promega), following the manufacturer's protocol.

Preparation of a cDNA Library Driver Without Overlapping Single clones from full-length cDNAs obtained in previous experiments performed in a similar manner as described in this example were rearranged for subtraction. Was. From 384-well plates, rearranged cDNAs were subsequently plated on SOD agarose / ampicillin plates. Plasmid extraction, DNA cleavage and RNA preparation were performed as for the minilibrary.

When the library was cloned into the SstI site, the extracted plasmid was treated with SstI at multiple cloning sites at the 3 ′ end. (mRN
If A was extracted from liver and lung, instead, the mini-library was cloned with XhoI at the 3 'end site and processed with PvuI. RNA is either T3 or T7 RNA, depending on the map of the construct used for driver preparation, sense run-off RNAs preparation.
Prepared using any of the polymerases (Life Technologies). T3 for mini-libraries cut with PvuI
The polymerase was used, and T7 polymerase was used for the mini-library cut with SstI. RNA is from RNA polymerase (Life Technologies) according to the manufacturer's instructions.
Was prepared using 1 to 2 μl of DNaseI (RQ1, RNase-fr
ee, Promega) for 30 minutes. This is followed by a proteinase K digestion, followed by extraction with phenol / chloroform and chloroform, cD
NA was precipitated.

Normalizing / Subtracting RN
Biotin labeling of A driver To further purify the RNA driver before labeling, the RNeasy kit (QIAGEN) was used according to the manufacturer's instructions. Subsequently, the Mirus nucleic acid biotinylation kit (Panvera) was used essentially as described by the manufacturer. 10 μg RN
A mixture, according to kit protocol instructions, 10 μl labeled IT reagent and 10 μl to a final volume of 100 μl
Was labeled by mixing with the labeling buffer A. The reaction was performed by incubating at 37 ° C. for 1 hour, after which the biotinylated RNA was added to 1/20 volume of 5M NaCl
And precipitation by addition of 2 volumes of 99% ethanol.
After standard ethanol precipitation, the pellet was washed once with 80% ethanol, resuspended in 20 μl of “1X Mirus labeling buffer A”, and stored at −80 ° C. until use (alternatively, manufacturer Follow the instructions in the psoralen-biotinylation kit (Ambio
mRNA can also be labeled using n)).

Normalization / Subtraction The RNA driver and cDNA were deproteinized using proteinase K, followed by phenol / chloroform extraction, chloroform extraction and ethanol precipitation.
The oligo-dG-tailed cDNA is used as a substrate, and hybridizes with the C stretch present in the RNA driver and subtracting driver.
Blocking oligonucleotide (-d from biotin -dG ₅
G _30, wherein biotin-dG ₁₆ was used), oligo dT primer to block the poly A sequence was mixed. However, any oligonucleotide that can block the common sequence between the driver and cDNAs can be used.

Hybridization was performed with 80% formamide (from deionized stock) 250 mM NaCl, 25 mM HEP
In a buffer containing ES (pH 7.5) and 5 mM EDTA, typically at a RoT value of 1 to 500 (RoT was determined by Sagerstrom et al., 19
97 as defined in the examples). Hybridization was performed in a drying oven at 42 ° C .; as little as 5 μl, no mineral oil coating was required. After hybridization, samples were precipitated by the addition of 2.5 volumes of absolute ethanol and incubated on ice for 30 minutes. Samples were centrifuged at 15,000 rpm for 10 minutes and washed once with 70% ethanol; cDNA (both single-stranded cDNA and mRNA / single-stranded cDNA hybrid) was
Carefully resuspended on ice in μl water.

Treatment with RNase I If necessary, the tester / driver hybrid obtained in the above step may be treated with Rnase I to remove mRNA normalization and subtraction driver non-specifically bound to the tester cDNA. Can be. After removing the supernatant from the sample precipitated after the hybridization, the pellet was placed on ice.
45 μl (to minimize non-specific reannealing)
Double distilled water or TE 0.1 X (1 mM Tris, 0.1 mM EDT
A, pH 7.5). It was completely redissolved before proceeding to the next step.

Then, 5 μl of 10 × RNase I buffer (Pro
mega), and 0.5 units of RNa per 10 μg of driver RNA
se 1 was added. The mixture was incubated at 37 ° C. for 10 minutes. It was then heated at 65 ° C. for 10 minutes and transferred on ice (if necessary, the sample can be treated with proteinase K, phenol / chloroform, chloroform and precipitated with ethanol before proceeding to the next step) .

Removal of Hybrids The following steps can be applied to normalized / subtracted mixtures that have been treated or not with RNase I as indicated in the above steps. In parallel, one
50 μl of MPG-MP for each μg of biotinylated driver RNA
Streptavidin magnetic beads (CPG Inc.) were prepared;
5 μl of beads were able to bind more than 400 ng of biotinylated driver. To each 50 μl bead, 10 μg of tRNA was added as a blocking reagent, after which the beads were incubated with occasional shaking at room temperature for 10 to 20 minutes or on ice for 30 to 60 minutes. Use a magnetic stand to remove the beads, and use
Washed three times with M NaCl, 10 mM EDTA and resuspended in 1 M NaCl, 10 mM EDTA, equivalent to the original volume of the bead suspension.

Mix the blocked beads with the redissolved tester / driver mixture and allow all samples to
Incubate for 15 minutes with occasional gentle agitation.
After removing the beads using a magnetic stand for 3 minutes, the supernatant containing the single-stranded normalized / subtracted cDNA was recovered. Beads were washed with an excess of binding buffer (1 M NaCl, 10 mM EDTA) to recover remaining ssDNA.
Washed twice. To evaluate the normalization / subtraction yield, the radioactivity of the labeled samples before and after the run was measured.

Microcon 100 ultrafiltration was used as described by the manufacturer (Millipore) to concentrate the cDNA solution to about 50 μl. Subsequently, the cDNA was pelleted using a standard isopropanol procedure; the pellet was 44 μl of 0.1 ×
Resuspend in TE and add 5 μl RNase I buffer and 1 U
Of RNase I was added to a volume of 50 μl. The samples were subsequently incubated at 37 ° C. for 20 minutes, after which 400 μl of 0.2% SDS was added to inactivate RNase I. Degraded RNA residues, blocking oligonucleotides, SDS and buffer were removed at 2000 rpm, 25 min using a Microcon 100 filter until the volume was less than 20 μl.
Ultrafiltration at 0 ° C. removed. 400 μl sample
Desalted by addition of 0.1X TE, followed by centrifugation as above for a total of three washes. The filter was transferred upside down to a new tube and centrifuged at 9000 rpm for 1 minute to recover the cDNA.

Second Strand cDNA Synthesis The second strand synthesis and cloning steps were the same for the normalized / subtracted cDNA, the standard reference library and the mini-library. As with the first strand cDNA primer, a primer containing XhoI 5 '-(GA) ₇ TTCTCGAG
XhoI containing TTAATTAAATTAATC ₁₃ -3 ′ (SEQ ID NO: 2) was prepared and purified using standard techniques.

To prepare for the second strand reaction, oligo-dG-tailed cDNA was ligated with 6 μl of 100 ng / μl second strand primer adapter, 6 μl of EX-Taq second strand buffer (Takar).
a) and 6 μl of 2.5 mM (respectively) dNTPs were mixed. To ensure high priming specificity, reagents should be at 50 ° C
(Usually 45 ° C. to about 80 ° C.) and mixed with the enzyme (called Hot start). Priming was then performed in a thermocycler by adding 3 μl of 5 U / μl ExTaq polymerase (Takara) at 65 ° C. After mixing, the annealing temperature is ramped down (neg
The temperature was 45 ° C. for the XhoI primer by an ative ramp (35 ° C. for the SstI primer in the case of the liver and lung library of Example 2). After continuing the annealing temperature for 10 minutes, the second strand cDNA was extended during a 20 minute incubation at 68 ° C. The annealing extension cycle was repeated once, followed by a final extension step at 72 ° C. for 10 minutes. At the beginning of the hot start, 0.5
μl of [α- ³² P] dGTP or [α- ³² P] dCTP was mixed with 5 μl of aliquot for incorporation. At the end of the reaction, labeled aliquots were used to measure cDNA and calculate second strand yield (Carninci and Hayashizaki, 1999).

CDNA cloning Second strand cDNA was treated with proteinase K, extracted with phenol-chloroform and chloroform, and ethanol precipitated by standard procedures. After that, cDNA
Cleavage was performed with 25 U / μg BamHI and XhoI (or SstI and XhoI for the lung and liver libraries of Example 2).
After digestion, the cDNA was treated with proteinase K, extracted with phenol-chloroform, and stored on a CL-4B column (P
harmacia). After ethanol precipitation, the cDNA was cloned essentially as described (Carninci and Hayashizaki, 1999).

Methods and Equipment Used Plaque hybridization was performed with random primers and labeled specific probes according to standard procedures (Sambrook et al., 1989). Alkali electrophoresis was performed as described (Sambrook et al. 1989). All autoradiographic signals were visualized using a Bas 2000 imaging system (Fuji).

Bacteria are commercially available picking machines (Q-bot
And Q-pix; Genetics, UK) and transferred to 384 microwell plates. Two identical plates were used for plasmid DNA preparation. Plasmid DNA from each 384-well plate was split and grown in four 96-deep-well plates. After overnight growth, the plasmid was manually transferred (Itoh et al. 1997, Nucleic Acids Res 25: 1315
-1316) or automatic (Itoh et al. 1999, Genome Res. 9: 463-470)
Extracted with

[0098] Typically, the sequence is a RISA sequencer (Shi
madzu, JAPAN) or Perkin Elmer-Ap
Using plied Biosystems ABI 377, for example, Hillier
Et al., 1996, Genome Research, 6: 807-828. Sequencing primers were M13 forward and reverse primers (SEQ ID NO:
5 and SEQ ID NO: 6).

Example 2 Lung and Liver Tissue A cDNA normalized / subtracted library (and mini-library) was prepared from lung and liver tissue as described for the brain of Example 1. Where m
When RNA is extracted from lung and liver, a primer having an XhoI site (5 ′ (GA) ₈ ACTCGAG (T) ₁₆ VN-3 ′) (SEQ ID NO:
4) and SstI containing primer 5 '-(GA) ₉ GAGCTCACTAGTTTAATT
There is a difference that AAATTAATC ₁₁ -3 '(SEQ ID NO: 3) is used. The other steps are the same as described for the brain.

Example 3 Removal Efficiency of Driver / Tester Capture Preparation of RNA Template Reeler cDNA (Hirots
Une et al., Nature Genetics, 1995, May, 10 (: 77-83)) were used. From 2.5 μl of template plasmid DNA (cut at the NotI restriction enzyme site), RNA was transcribed in vitro using the following standard conditions: 20 μl Gibco-BRL 5X buffer, 5 μl rNTPs
(10 mM each), 5 μl of 0.1 M DTT, 20 units of T7 RNA polymerase to a final volume of 100 μl. The reaction is performed at 37 ° C for 3
Performed by incubating for hours. 2 μl
Α- ³² P-rUTP was added to the reaction to label the RNA.

Subsequently, 20 units of RQ1 DNase (Promega) were added to remove a trace amount of template DNA (plasmid), and the obtained sample was incubated at 37 ° C. for 15 minutes. To the sample so that the final concentration is 250 mM
NaCl was added, and the resulting sample was once proteolyzed with phenol (equilibrated with Tris) / chloroform and once with chloroform, followed by two volumes of ethanol.
RNA was precipitated by addition to NA. After centrifugation at 15,000 rpm for 20 minutes, the precipitated RNA was separated from the supernatant, and the precipitate was washed once with 70% ethanol and then centrifuged. The pellet was finally redissolved in water.

Preparation of cDNA (Tester) Primers specific to this clone were SK primer (5′C
GCTCTAGAACTAGTGGATC3 ′) (SEQ ID NO: 7), and
CDNA except that alpha-32P dGTP is used for first-strand labeling in later tracing
Was prepared from an RNA template as specified in the instructions for Superscript II (Gibco BRL-Life Technology). After phenol / chloroform extraction and ethanol precipitation using standard procedures, the cDNA was subsequently treated with alkali (50 mM NaOH for 30 minutes) to remove the hydrolyzed hybridized RNA and 200 mM Tris pH
Neutralized at 7.00 and 20 U of RNase I was added.
Finally, the DNA is again subjected to phenol /
Extracted with chloroform and precipitated with ethanol.

Biotinylation of RNA RNA templates were also used as drivers. 500
Aliquots of ng RNA are from the Biotin-Psoralen kit (Ambi
on) on ice (corresponding to samples 1-3) or at room temperature (used for samples 4-6) for 30 minutes (1, 4), 45 minutes (2, 5) and 60 minutes
(3, 6) min (see FIG. 6).

After biotinylation, 150 ng of biotinylation driver (prepared in conditions 1-6, ie 6 tubes) (21,000
(Counted by CPM), 50 ng of cDNA was added (6,00
0 CPM), 10 μg of tRNA was added. Standard phenol /
After chloroform extraction and ethanol precipitation, the sample is
Redissolved in 5 μl of hybridization buffer (80% formamide, 250 mM NaCl, 25 mM Hepes pH 7.5, 5 mM EDTA) and incubated at 42 ° C. overnight (14 hours).

After ethanol precipitation (performed as in the other examples), the samples (6 tubes) were subsequently mixed with streptavidin / magnetic (the subtraction step described in Example 1). The supernatant (unbound) was subsequently subjected to ethanol precipitation by adding 4 μg of glycogen to ensure standardized precipitation in addition to the standard conditions, and after resuspension, standard RNA / formaldehyde minigel (lane 1- 6). After 1 hour of electrophoresis at 60 V, the gel was dried and
s Exposed to a 2000 image analyzer (Fuji). This indicates the driver + tester removal efficiency. On lanes 7-9,
Untreated samples (mRNA / cDNA) corresponding to 100 starting counts, 10% and 2% respectively, were used.
The strength of the signal indicates the efficiency of removing the driver / tester mixture.

Example 4 Evaluation Method of the Invention Reducing the Frequency of Highly Expressed cDNAs To reduce unnecessary resequencing of pre-existing clones, the same method as described for the brain, prepared in the previous examples. Some normalized / subtracted from pancreatic tissue using mini-libraries and RNA drivers derived from rearranged non-redundant cDNAs
A cDNA library was prepared.

Second strand cDNA obtained from a standard pancreatic cDNA library (without normalization / subtraction)
Was compared with its normalized / subtracted counterpart (FIG. 3). Normalized / subtracted cDN
A was prepared by a single normalization / subtraction step. Normalization is RoT =
Subtraction was performed at 10 in each of the mini-libraries prepared as described above for liver, lung, brain or pancreas.
Using a set containing 1000 to 2000 predominantly abundant major clones, the subtraction was performed at RoT = 20 (subtractions can be performed if the RoT value is at least up to about 500). Normalized cDN prepared earlier
The mini-library was generated by cloning the fraction with high expression in the A library. Amplified
The cDNA minilibrary was subsequently used (as described above) to prepare subtracting drivers. RoT of subtracting driver is 200 each
Equal to one unit for clones (eg, RoT = 5 if 1000 clones were used). The average size of normalized and subtracted cDNAs is longer and longer than unnormalized and unsubtracted cDNAs
s (moving slower) suggests that it is expressed more rarely than the shortest one. Furthermore, mR with high expression level
No band corresponding to NA cDNAs is observed in the normalized-subtracted library.

FIG. 3 shows the electrophoresis of the unnormalized / unsubtracted (standard cDNA), in which a very distinct band from the abundantly expressed abundant RNAs is slightly visible, while ,
No bands were observed in the normalized-subtracted cDNA, suggesting a reduction in the cDNA. Furthermore, in the normalized / subtracted cDNA, the comparative intensity of cDNAs corresponding to long mRNA (> -3 Kb) size is increased when compared to the standard library. Another way to demonstrate the benefits of normalization / subtraction is shown in FIG.

Lung first-chain cDN prepared as described above
A was used as a template. Normalized c
Genes with high expression levels from plaque hybridization corresponding to the DNA library were reduced in the normalized library. If 10,000 plaques of the normalized lung library were screened, elongation factor 1-alpha was 90% in the reference library.
Was, but in the normalized library
Carbonyl reductase to about 70 to 3
Uteroglobin was reduced to about 510 to 2 plaques. When plaques were counted, there were more plaques in the standard cDNA library (~ 10-fold in the standardized library compared to the normalized library). These results demonstrated that the number of highly expressed cDNAs in the normalized library was lower than that of the reference.

Example 5 Increasing the frequency of finding low expressed genes Gene enrichment of libraries is the most appropriate test for enriching low expressed cDNAs. According to the above method, several libraries (Table 1) were prepared from several mouse tissues, and the average size of cDNA insert (insert size), sequence path (Seq.), Cluster (Sp.),
Degree of duplication (Red.), Appearance of new clone (unique), first
The presence of the full-coding / full-length cDNA was evaluated by examining the% of the sequence having the ATG codon (% coding).

[0111]

【table 1】

Evaluation of the degree of sequence redundancy is the final evaluation of the efficiency of the normalization / subtraction process. Standard library prepared from aliquots of raw cDNA
(Indicated as reference numbers 22-000, 23-000, 26-000, and 31-000) are shown as comparisons (Table 1).

Successfully Normalized-Subtracted c
In one of the DNA libraries (eg, library 49-304 from mouse testis tissue), the degree of 3 ′ terminal sequence redundancy was 1.6.
It was as low as 3 (calculated by dividing the total number sequenced in the sequencing of 8900 clones by the number of different clusters 5444). A degree of redundancy of less than 2.0 in 10,000 to more than 15,000 3'-end sequences is significant for complex tissues (e.g.,
It was expected to be successful for cDNA libraries obtained from testes, brain, and thymus.

The normalized / subtracted cDNA library efficiently increased the recovery of unknown genes.
For example, libraries 22-100, 23-100, 26-100, and 31
-100 is the standard library counterpart 22-100, 23-100, 26
-100, and had higher data generation values per sequencing reaction than 31-100 (FIG. 5). Sequence of several cDNAs from several libraries shows reduced sequence duplication in normalized / subtracted libraries compared to standard cDNA libraries
(FIG. 5).

In FIG. 5, 100% of new gene discoveries correspond to a redundancy of 1, 50% to a redundancy of 2, 25% to a redundancy of 4, and so on. Normalization increases the frequency of new gene discovery during a given sequencing test as compared to a standard library.

Example 6 Comparative Example of Normalization-Subtraction Method of the Present Invention The importance of using an enzyme that cleaves single-stranded RNA (driver) nonspecifically bound to cDNA (tester) was examined. Therefore, sublibraries prepared using the normalization / subtraction method of the present invention were compared with sublibraries prepared using the normalization / subtraction method and the non-specific hybrid removal step.

The normalized / subtracted cDNAs prepared by the first part of Example 1 (up to the part containing the normalization / subtraction step)
It was split into two subtraction libraries. For the first sub-library, perform second strand cDNA synthesis and cloning (i.e., without removing non-specific binding hybrids), while for the second sub-library, R
Example 1 Nase I treatment (removal of non-specific binding hybrid)
Performed as described in. The mouse tissues prepared were as follows: medulla oblongata in library 63, olfactory brain in library 64, colon in library 90 and cecum in library 91. Data is reported in Table 2

[0118]

[Table 2]

Sublibraries 63-304-R, 64-304-R, 90
-300-R, 90-304-R, and 91-300-R indicate sublibraries not treated with RNase I. Sub-library 63-305
-R, 64-305-R, 90-302-R, 90-306-R, 91-302-R are RNas
eI Indicates the processed sublibrary.

The combination of sub-libraries belonging to the same library is as follows: 63-304-R and 63-305-R, 64-304-R and 64-3
05-R, 90-300-R and 90-302-R, 90-304-R and 90-306-R, 91-
They are 300-R and 91-302-R. The number of clusters in each sublibrary indicates the number of different clones (ie, clusters) contained in the sublibrary. Each cluster can include clones that have one or more identical sequences (the same sequences that are taken multiple times).

“Unique clones” indicates the number of new clones obtained from each sublibrary cluster that have not yet been sequenced. "% Unique clones" (e.g., a value of "8.4" for sublibrary 63-304-R) is the number of unique clones found ("252" for sublibrary 63-304-R) of the cluster. Number (sub library 63-30
For 4-R, it is shown by dividing by "2987").

The data in Table 2 indicate that all RNase I treatment studies yielded high numbers of% unique clones (eg, 15.4% for sublibraries 63-304-R and 63-305R) Several undiscovered clones (unique) that nonspecifically bound to the mRNA driver by RNase I treatment were released from the hybrids, indicating recovery and discovery.

The clone sequence was analyzed using a RISA sequencer (Shima
dzu, JAPAN). Sequencing primers were M13 forward and reverse primers. Order: M13 oligo
(5 'TGTAAAACGACGGCCAGT 3') (SEQ ID NO: 5); reverse: 1233
REV oligo (5 'AGCGGATAACAATTTCACACAGGA 3') (SEQ ID
NO: 6). The sequencing method is based on known standard sequencing protocols.
(Hillier et al., 1996, Genome Res., 6: 807-828).

[Sequence List] SEQUENCE LISTING <110> The Institute of Physical and Chemical Research (RIKEN), Hayashiza ki, Yoshihide <120> Method for the preparation of normalized and / or subtracted cDNAs <130> A05097H / 1-12 <160> 7 <170> PatentIn Ver. 2.1 <210> 1 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: first-strand primer comprising BamHI and SstI restriction sites <220> <221 > misc # feature <222> (42) <223> Nucleotide 42 is v, v = g or c or a <220> <221> misc # feature <222> (43) <223> Nucleotide 43 is n any nucleotide <400> 1 gagagagaga aggatccaag agctcttttt tttttttttt tvn 43 <210> 2 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer comprising the XhoI restriction site <400> 2 gagagagaga gagattctcg agttaattaa attaatcccc ccccccccc 49 <210> 3 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer comprising the SstI restriction site <400> 3 gagagagaga gagagagaga gctcactagt ttaattaaat taatcccccc ccccc 55 <210> 4 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer comprising the XhoI restriction site <220> <221> misc # feature <222> (40) <223> Nucleotide 40 is v, v = g or c or a <220> <221> misc # feature <222> (41) <223> Nucleotide 41 is n defined n = any nucleotide < 400> 4 gagagagaga gagagaactc gagttttttt tttttttttv n 41 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: M13 forward primer <400> 5 tgtaaaacga cggccagt 18 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: 1233REV reverse primer <400> 6 agcggataac aatttcacac agga 24 <210> 7 <211> 20 <212> DNA <213 > Artificial Sequence <220> <223> Description of Artificial Sequence: SK primer <400> 7 cgctctagaa ctagtggatc 20

[Brief description of the drawings]

FIG. 1 is an overview of a suitable normalized and / or subtracted cDNA production protocol. A) General diagram for preparation of long-chain, full-coding / full-length single-stranded cDNA; B) Representation of different populations of cDNA testers;
C) Normalizing driver (cell mRNA) and subtracting driver (run-off transcript); D) hybridization; E) rare / new cDNA is used for the preparation of second strand cDNA (normalized / subtracted) CDNA library); F) Abundant cDNA
/ Unnecessary cDNA is removed and can be used to create mini-libraries to perform subtraction.

[Fig. 2] RNA (driver) in which the use of RNase I can be recognized and RNase I is nonspecifically bound to cDNA (tester).
(On the right side of the figure). New and / or rare cDNAs used in this method are recovered. on the other hand,
As shown on the left side of the figure, when RNase I treatment is not performed, new and / or rare testers that can nonspecifically bind to the driver are captured and removed by the beads.

FIG. 3. Normalized / unsubtracted pancreas
The pattern of electrophoresis of pancreatic cDNA normalization / subtraction performed in a single step compared to the cDNA example is shown on the right. This example of normalization / subtraction visualizes the removal of considerable extra full-length cDNA, which is clearly shown in the example of cDNA that has not been normalized or subtracted (indicated by arrows).

FIG. 4: Genes EF-1 alpha, carbonyl reductase, and uteroglobin including a standard (non-normalized and unsubtracted) long cDNA library (left) or a normalized length cDNA library (right) Replica plaque hybridization for (uteroglobin). In the right panel (normalized), the arrow indicates the measured plaque.
Plaque counts (clones) counted as a normalized library are more sensitive than the standard library
(sensitively) less.

FIG. 5. Increased sequencing redundancy (or decreased discovery of new genes) increases sharply in a standard cDNA library (−000 library), but not in normalizers /
In the subtracted full-length cDNA library (-100 library), the increase in the degree of duplication is considerably slow. New genes (%) are shown as singletons (%) in the given cDNA library.

FIG. 6 shows an electrophoresis test to evaluate the removal efficiency of driver / tester capture using the subtraction method according to the present invention. Single clone (cDN
A) Only the tester was used and was subtracted with a driver made of the same cDNA. Lanes 1-3 show subtracted cDNAs that were biotinylated on ice, and lanes 4-6 represent those performed at room temperature (RT).
Lanes 7-9 consist of 100%, 10% and 2% residual, respectively, of the unbeaded (and therefore not removed) tester and driver. Lane 9
It shows that even small amounts of 2% are still evident. Rather, in lanes 1-6, it is clear that there is no tester / driver hybrid indicating that the subtraction was almost 100%.

Claims (88)

[Claims] 1. A method for preparing a normalized and / or subtracted cDNA, comprising the steps of: I) preparing an uncloned cDNA (tester); II) a polynucleotide (driver) for normalization and / or subtraction III) performing a normalization and / or subtraction step to remove the resulting tester / driver hybrid and unhybridized polynucleotide driver; IV) recovering the normalized and / or subtracted cDNA The method comprising the steps of: 2. The method according to claim 1, wherein the cDNA tester in step I) is a reverse transcript of mRNA and is an uncloned cDNA. 3. The method according to claim 1, wherein said cDNA tester is single-stranded. 4. The method according to claim 1, wherein step III) comprises first a normalization step and then a subtraction step. 5. The method according to claim 1, wherein step III) comprises first a subtraction step and then a normalization step. 6. The method according to claim 1, wherein in step III), the tester and the driver are mixed and normalization and subtraction are performed in a single step. 7. The method according to claim 1, wherein the normalized and / or subtracted cDNA is a long-chain, full-coding and / or full-length cDNA. 8. In step III), adding an enzyme capable of cleaving a single-stranded RNA driver non-specifically bound to a single-stranded cDNA tester, and adding the cleaved single-stranded RN
The method according to any one of claims 1 to 7, comprising removing an A driver. 9. The method according to claim 8, wherein the enzyme is a single-strand-specific RNA endonuclease. 10. The method according to claim 10, wherein the enzymes are RNaseI, RNaseA, RNase
9. A method selected from the group consisting of IV, RNaseT1, RNaseT2, RNaseII and RNaseIII, or a mixture thereof.
The method described in. 11. The method according to claim 8, wherein said enzyme is RNaseI. 12. The cDNA tester according to claim 5, wherein the 5 ′ end of the RNA is
The method according to any one of claims 1 to 11, which is prepared by capturing CAP. 13. The method according to claim 1, wherein the preparation of the cDNA tester comprises the following steps. (1) a step of synthesizing a first-strand cDNA by a reverse transcriptase that forms an mRNA / cDNA hybrid; (2) 5′CAP ( ^7MeG ) of the mRNA forming the hybrid;
(3) a step of chemically binding a tag molecule to a diol structure at a _ppp N) site; (3) a step of capturing a long-chain, full-coding, full-length cDNA hybrid; and (4) an enzyme capable of cleaving a single-stranded mRNA. A step of removing single-stranded mRNA by digestion using 14. The tag molecule is digoxigenin,
14. The method according to claim 13, which is biotin, avidin or streptavidin. 15. The polynucleotide for normalization and / or subtraction is RNA and / or
The method according to any one of claims 1 to 14, which is DNA. 16. The method according to claim 15, wherein said DNA driver is cDNA. 17. The normalization driver, wherein the cell mRNA from the same library as the one to be normalized, the cell mRNA from the same tissue as the one to be normalized, or the same as the one to be normalized. The method according to any one of claims 1 to 15, which is a cellular mRNA from a cDNA population of 18. The method according to claim 1, wherein the normalization driver is a single-stranded cDNA obtained from the same library, tissue, or cDNA population as the one to be normalized. Method. 19. The subtraction driver,
A cell mRNA from a library, tissue or cDNA population different from the one to be subtracted.
16. The method according to any one of 15 above. 20. The subtraction driver,
The method according to any one of claims 1 to 16, which is a single-stranded cDNA obtained from a library, a tissue, or a cDNA population different from the one for which the normalizer is to be performed. 21. The method according to claim 1, further comprising the step of preparing and cloning a second-strand cDNA of the recovered cDNA.
21. The method according to any one of claims 20 to 20. 22. A method for producing a normalized and / or subtracted cDNA, comprising: I) a step of preparing a cDNA (tester) not cloned into a plasmid; II) a polynucleotide for normalization and / or subtraction. (Driver) preparation step; III) Performing a normalization and / or subtraction step to remove the obtained tester / driver hybrid and unhybridized polynucleotide driver; IV) Normalized and / or subtracted cDNA The method comprising the step of recovering. 23. The method according to claim 22, wherein step III) comprises first a normalization step and then a subtraction step. 24. The method according to claim 22, wherein step III) comprises first a subtraction step and then a normalization step. 25. The method according to claim 22, wherein in step III) the tester and the driver are mixed and normalization and subtraction are performed in a single step. 26. The method according to any one of claims 22 to 25, wherein the normalized and / or subtracted cDNA is a long-chain, full-coding and / or full-length cDNA. 27. In step III), adding an enzyme capable of cleaving a single-stranded RNA driver nonspecifically bound to a single-stranded cDNA tester, and adding the cleaved single-stranded RNA driver
27. The method according to claim 22, further comprising removing an RNA driver.
The method according to any one of claims 1 to 4. 28. The method according to claim 27, wherein the enzyme is a single-strand-specific RNA endonuclease. 29. The method according to claim 29, wherein the enzyme is RNaseI, RNaseA, RNase.
3. A method selected from the group consisting of IV, RNaseT1, RNaseT2, RNaseII and RNaseIII, or a mixture thereof.
7. The method according to 7. 30. The method according to claim 27, wherein said enzyme is RNaseI. 31. The cDNA tester according to claim 5, wherein the 5 ′ end of the RNA is
31. A method according to any one of claims 22 to 30 prepared by capturing CAP. 32. The normalization driver, wherein the cell mRNA from the same library as the one to be normalized, the cell mRNA from the same tissue as the one to be normalized, or the same as the one to be normalized The method according to any one of claims 22 to 31, which is a cellular mRNA from a cDNA population of 33. The method according to any one of claims 22 to 31, wherein the normalization driver is a single-stranded cDNA obtained from the same library, tissue, or cDNA population as that to be normalized. Method. 34. The subtraction driver,
23. Cell mRNA from a library, tissue or cDNA population different from the one to be subtracted.
32. The method according to any one of -31. 35. The subtraction driver,
The method according to any one of claims 22 to 31, wherein the method is a single-stranded cDNA obtained from a library, a tissue, or a cDNA population different from the one for which normalization is to be performed. 36. The method according to any one of claims 22 to 35, further comprising a step V) of preparing and cloning the second strand cDNA of the recovered cDNA. 37. A method for producing a normalized and / or subtracted cDNA, comprising: I) a step of preparing a cDNA (tester); II) a step of preparing a polynucleotide (driver) for normalization and / or subtraction. III) performing the normalization and subtraction as a single step by mixing a tester and a driver; IV) recovering the normalized and / or subtracted cDNA. 38. The method according to claim 37, wherein the cDNA tester is a cloned or uncloned cDNA. 39. The method according to claim 37, wherein the cDNA tester of step I) is a reverse transcript of mRNA and is an uncloned cDNA. 40. The method according to claim 37, wherein said cDNA tester is single-stranded. 41. The method according to any one of claims 37 to 40, wherein the normalized and / or subtracted cDNA is a long-chain, full-coding and / or full-length cDNA. 42. In step III), adding an enzyme capable of cleaving a single-stranded RNA driver nonspecifically bound to a single-stranded cDNA tester;
42. The method of claim 37, further comprising removing the RNA driver.
The method according to any one of claims 1 to 4. 43. The method according to claim 42, wherein the enzyme is a single-strand-specific RNA endonuclease. 44. The enzyme, wherein the enzyme is RNaseI, RNaseA, RNase
5. A method selected from the group consisting of IV, RNaseT1, RNaseT2, RNaseII and RNaseIII, or a mixture thereof.
3. The method according to 2. 45. The method according to claim 42, wherein said enzyme is RNaseI. 46. The cDNA tester according to claim 5, wherein the 5 ′ end of the RNA is
46. The method according to any one of claims 37 to 45, prepared by capturing CAP. 47. The method according to any one of claims 37 to 45, wherein the preparation of the cDNA tester comprises the following steps. (1) a step of synthesizing a first-strand cDNA by a reverse transcriptase that forms an mRNA / cDNA hybrid; (2) 5′CAP ( ^7MeG ) of the mRNA forming the hybrid;
(3) a step of chemically binding a tag molecule to a diol structure at a _ppp N) site; (3) a step of capturing a long chain, full coding, full length cDNA hybrid; and (4) an enzyme capable of cleaving a single-stranded mRNA. A step of removing single-stranded mRNA by digestion using 48. The tag molecule is digoxigenin,
48. The method of claim 47, which is biotin, avidin or streptavidin. 49. The polynucleotide for normalization and / or subtraction is RNA and / or
49. The method according to any one of claims 37 to 48, wherein the method is DNA. 50. The method according to claim 49, wherein said DNA driver is cDNA. 51. The normalization driver, wherein the cell mRNA from the same library as the one to be normalized, the cell mRNA from the same tissue as the one to be normalized, or the same as the one to be normalized 50. The method according to any one of claims 37 to 49, which is a cellular mRNA from a cDNA population of 52. The method according to any one of claims 37 to 50, wherein the normalization driver is a single-stranded cDNA obtained from the same library, tissue, or cDNA population as the one to be normalized. Method. 53. The subtraction driver comprises:
38. Cellular mRNA from a library, tissue or cDNA population different from the one to be subtracted.
50. The method according to any one of -49. 54. The subtraction driver,
51. The method according to any one of claims 37 to 50, wherein the method is a single-stranded cDNA obtained from a library, a tissue, or a cDNA population different from the one for which normalization is to be performed. 55. The method according to any one of claims 37 to 54, further comprising a step V) of preparing and cloning the second strand cDNA of the recovered cDNA. 56. A method for producing a normalized and / or subtracted cDNA, comprising: (a) a step of preparing a cDNA (tester); (b) a step of preparing a normalization and / or a subtracted RNA (driver); c) a step of performing normalization and / or subtraction in two steps in random order, or performing normalization / subtraction as one step by mixing a normalization / subtraction RNA driver with the cDNA tester; (d) non-specific to a cDNA tester (E) removing the single-stranded RNA driver cleaved in step d) from the tester; and Removing the tester / driver hybrid; (f) no Maraizu and / or subtracted cDNA was
The method comprising the step of recovering. 57. The method according to claim 56, wherein the cDNA tester is a cloned or uncloned cDNA. 58. The method according to claim 56, wherein the cDNA tester is a reverse transcript of mRNA and is an uncloned cDNA. 59. The method according to claim 56, wherein said cDNA tester is single-stranded. 60. The method according to any one of claims 56 to 59, wherein step c) comprises first a normalization step and then a subtraction step. 61. The method according to any one of claims 56 to 59, wherein step c) comprises first a subtraction step and then a normalization step. 62. The method according to any one of claims 56 to 59, wherein in step c) the tester and the driver are mixed and normalization and subtraction are performed in a single step. 63. The method according to any one of claims 56 to 62, wherein the normalized and / or subtracted cDNA is a long-chain, full-coding and / or full-length cDNA. 64. The enzyme, wherein the enzyme is RNaseI, RNaseA, RNase
6. A method selected from the group consisting of IV, RNaseT1, RNaseT2, RNaseII and RNaseIII, or a mixture thereof.
The method according to any one of claims 6 to 63. 65. The method according to any one of claims 56 to 63, wherein the enzyme in step d) is RNaseI. 66. The cDNA tester according to claim 5, wherein the 5 ′ end of the RNA is
66. The method according to any one of claims 56 to 65, prepared by capturing CAP. 67. The method of claim 56, further comprising the step of preparing and cloning the second strand of the recovered cDNA.
7. The method according to any one of 6. 68. The method according to claim 1, wherein the tester / driver hybrid is associated with a tag molecule. 69. The method of claim 68, wherein said tag molecule is avidin, streptavidin, biotin, digoxigenin, an antibody or an antigen. 70. The method according to claim 1, wherein the tester / driver hybrid is removed by using a matrix. 71. The method of claim 70, wherein said matrix is a magnetic bead or agarose bead. 72. The method of claim 71, wherein said magnetic beads or agarose beads are covered or bound by any tag molecule capable of binding to a tag molecule bound to a tester / driver hybrid. 73. The magnetic bead or agarose bead is covered or bound by a tag molecule capable of binding to avidin, streptavidin, biotin, digoxigenin, antibody or antigen bound to a driver / tester hybrid. the method of. 74. An antibody covering the beads or an antibody binding to the beads, wherein the antibody is an anti-antigen antibody or an anti-biotin antibody;
74. The method according to claim 72 or 73, which is an anti-avidin antibody, an anti-streptavidin antibody or an anti-digoxigenin antibody. 75. The method of any one of claims 1 to 74, wherein said tester / driver hybrid is removed by using streptavidin / phenol. 76. The method of any one of claims 1 to 75, wherein hydroxypatite and unlabeled RNA are used to remove said tester / driver hybrid. 77. A method for removing non-specifically bound RNA by treating the non-specifically bound RNA / DNA hybrid with an enzyme capable of degrading single-stranded RNA. 78. The enzyme may be RNase I, RNase A, RNase
8. A method selected from the group consisting of IV, RNaseT1, RNaseT2, RNaseII and RNaseIII, or a mixture thereof.
7. The method according to 7. 79. The enzyme according to claim 78, wherein the enzyme is RNaseI.
The method described in. 80. The method according to any one of claims 77 to 79, wherein the RNA / DNA hybrid is a result of a normalization method. 81. The method according to any one of claims 77 to 79, wherein the RNA / DNA hybrid is a result of a subtraction method. 82. The RNA / DNA hybrid is the result of a method comprising an unordered normalization and subtraction step, or a method comprising a single normalization / subtraction step.
80. The method according to any one of 7 to 79. 83. A method for isolating a single-stranded cDNA, comprising:
A method comprising treating a hybrid comprising RNA nonspecifically bound to cDNA with an enzyme capable of degrading single-stranded RNA, removing the degraded single-stranded RNA, and recovering the cDNA. . 84. A normalizing and / or subtracting method comprising adding an enzyme capable of degrading a single-stranded RNA driver non-specifically bound to a cDNA tester, and removing the degraded single-stranded RNA driver. CD
How to make NA. 85. The DNA or cDNA of claim 77 to 84, wherein said DNA or cDNA is a long chain, full coding and / or full length cDNA.
The method according to any one of claims 1 to 4. 86. The method according to any one of claims 1 to 85, wherein the method is used to create one or more libraries. 87. A cDNA or a cDNA library obtainable by the method according to any one of claims 1 to 86. 88. The cDNA according to claim 87, which is single-stranded or double-stranded.