CN114350803A

CN114350803A - Pretreatment method and application of large-volume urine

Info

Publication number: CN114350803A
Application number: CN202210023701.1A
Authority: CN
Inventors: 王龙; 徐根明; 李超; 王永利; 姚鲲; 刘建业; 鞠巍; 汤维; 李仁君; 李永祥
Original assignee: Hunan Yearth Biotechnological Co ltd; Third Xiangya Hospital of Central South University
Current assignee: Hunan Yearth Biotechnological Co ltd; Third Xiangya Hospital of Central South University
Priority date: 2022-01-10
Filing date: 2022-01-10
Publication date: 2022-04-15
Anticipated expiration: 2042-01-10
Also published as: CN114350803B

Abstract

The invention discloses a pretreatment method and application of large-volume urine. The invention can carry out high-efficiency and low-cost DNA enrichment from a large amount of urine and effectively remove the inhibitors which influence the subsequent molecular biological reaction, such as heme, urea and the like in the hematuria, thereby directly detecting the enriched product and achieving the purpose of faster detection. The detection method and the detection kit thereof can accurately detect 5 copies of urothelial cancer related mutant DNA molecules from 100mL of urine.

Description

Pretreatment method and application of large-volume urine

Technical Field

The invention relates to a pretreatment method and application of large-volume urine. Belongs to the technical field of gene detection.

Background

Urothelial cancer is a multiple malignant tumor originating from the urothelium and is the most common urinary system tumor. Among them, urothelial cancer can be classified into non-muscle invasive urothelial cancer and muscle invasive urothelial cancer. And 10-15% of patients with muscle-layer invasive urothelial carcinoma have metastasis when the diagnosis is confirmed. The incidence rate of urothelial cancer in western countries, rank 4, is second only to prostate cancer, lung cancer, colorectal cancer. From the site of occurrence, renal pelvis cancer and ureteral cancer occurring in the upper urinary tract, and bladder cancer and urethral cancer of the lower urinary tract are included. The upper urinary tract epithelial cancer is less, only accounts for 5-10% of the urinary tract epithelial cancer clinically, and is different from bladder cancer in that about 60% of the upper urinary tract epithelial cancer is invasive tumor, and the prognosis is poor. Cystotomy or nephroureterectomy are the gold standard for the treatment of urothelial tumors, but for patients at high risk for tumors, local recurrence or distant metastasis after surgery is the major cause of no improvement in long-term survival. In 50% of patients with invasive bladder cancer, potential metastases are already present before surgery. In China, bladder cancer is one of ten common cancer types, is one of the important disease burdens in China due to easy recurrence, easy metastasis and limited treatment means, and seriously threatens the survival time and the life quality of patients. Urothelial Cancer (UC) is a common type of bladder cancer, accounting for over 90% of all bladder cancer cases.

Hematuria refers to that the number of red blood cells in centrifugal sediment urine is more than or equal to 3 per high power of visual field, or the red blood cell count in non-centrifugal urine exceeds 1 or 1 hour or the urine red blood cell count exceeds 10 ten thousand, or the urinary sediment count in 12 hours exceeds 50 ten thousand, which indicates that the red blood cells in urine are abnormally increased, and is a common urinary system symptom. The causes include urinary system inflammation, tuberculosis, calculus or tumor, trauma, medicine, etc., and the influence on the body is very different. In mild cases, the condition is that only under the lens, the condition is called as the hematuria under the lens; the appearance of the heavy person is a water sample of meat or contains blood clots, which is called naked eye hematuria. Typically 1mL of blood per liter of urine is visible to the naked eye, with the urine appearing red or as a meat wash sample. Because of the numerous causes of clinical hematuria, people often need to quickly know whether the hematuria is related to urothelial cancer, namely, to perform early screening and diagnosis on urothelial cancer of a hematuria patient. Meanwhile, as the recurrence rate of urothelial cancer is high, the recurrence monitoring of urothelial cancer patients is also needed clinically.

Urothelial cancer can cause hematuria, but not hematuria means urothelial cancer. The traditional diagnosis methods of urothelial cancer include carcinoembryonic antigen detection, cystoscopy and the like. The detection accuracy of carcinoembryonic antigen still needs to be improved, and cystoscopy often causes pain and psychological burden to patients. Therefore, noninvasive detection of urothelial cancer using urine is becoming a better approach.

The noninvasive test is a test performed using urine, peripheral blood, nails, hair, saliva, or the like as a sampling material for the test. Compared with invasive detection, the noninvasive detection can greatly reduce the psychological pressure on a detected person, and can also reduce or even avoid tissue or organ damage, infection and other conditions caused by sampling.

Noninvasive detection of urothelial cancer can be performed using the patient's urine. While urine of healthy people contains free DNA, urine of a patient with urothelial cancer contains normal free DNA, and cancer-specific DNA is released from a lesion into the urine. Noninvasive detection of urothelial cancer can be achieved by detecting these cancer-specific DNAs.

The TERT gene is a telomerase reverse transcriptase gene, which encodes a catalytic subunit of telomerase with reverse transcription activity. The gene plays an important role in maintaining telomere length and genome stability. Activating mutation of a core promoter region of the human TERT gene can lead to the enhancement of the combining capability of a transcription factor Ets/TCF, thereby leading to the 2-4 times increase of the transcription activity of the gene. The mutation of the core promoter region of the TERT gene is one of the most frequent mutations of the urothelial cancer tissue, and reaches more than 80 percent. And the core promoter region mutation of the TERT gene is found to be a mutation which is not related to the progression stage of urothelial cancer. This means that mutations in the core promoter region of the TERT gene are biomarkers that can be used as early screening for urothelial cancer.

For patients with early or very early urothelial cancer, the lesion releases very little, and possibly as few as a few copies of the DNA molecule that is cancer specific due to its microscopic lesion. Adults probably produce about 3L of urine every day, and the average urine volume per time is about 400-500 mL. This small amount of DNA is released into such a large amount of urine, which presents a considerable challenge to DNA detection techniques. At present, no scheme for efficiently extracting DNA with low cost from urine with super-large volume exists in the market. At present, a small part of urine, such as 2-3 mL, is taken for a commercial urine DNA detection method, and urine DNA extraction is firstly carried out, and then detection is carried out by a QPCR quantitative or sequencing method. The extraction of urine adds complexity to the experiment, is time consuming, and most importantly, because only a small portion of urine is taken for detection, it greatly reduces the detection sensitivity of early or very early urothelial cancer patients containing trace amounts of cancer-specific DNA.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a pretreatment method and application of large-volume urine.

In order to achieve the purpose, the invention adopts the following technical scheme:

a pretreatment method of large-volume urine comprises the following specific steps:

(1) firstly, carrying out protein digestion on urine by using protease K to obtain urine I;

(2) removing QPCR molecular biological reaction inhibitor components in the urine I by using crosslinked polyvinylpyrrolidone PVPP to obtain urine II;

(3) and then enriching free DNA in the urine II by using the polylysine coated silica particles to obtain a urine sample for QPCR detection.

Preferably, in step (1), the urine is fresh hematuria or hematuria which is rapidly frozen after collection.

Preferably, the specific method of step (1) is: firstly, centrifuging hematuria for 10 minutes by a refrigerated centrifuge of 800g, taking supernatant, then adding proteinase K into the supernatant, and digesting for 30 minutes at 55 ℃; wherein the volume ratio of hematuria to proteinase K is 1000: 1, the concentration of proteinase K is 20 mg/mL.

Preferably, the specific method of step (2) is: firstly, adding crosslinked polyvinylpyrrolidone PVPP into urine I, mixing the urine I and the PVPP evenly from the top of a vertical mixing instrument, centrifuging the urine I for 5 minutes by a refrigerated centrifuge at 1600g, and taking the supernatant to obtain urine II; wherein the dosage ratio of hematuria to PVPP is 100 mL: 35 mg.

Preferably, in step (3), the preparation method of the polylysine-coated silica particles is as follows: adding silica gel powder and powdery polylysine into Tris-HCl (Tris (hydroxymethyl) aminomethane hydrochloride) with the pH value of 7, vortexing for 30 minutes, centrifuging to obtain a precipitate, and cleaning to obtain the gel-silica gel-loaded porous carrier; wherein the ratio of silica gel powder, powdery polylysine and Tris-HCl is 250 mg: 100 mg: 10mL, Tris-HCl concentration 100 mM.

Preferably, the specific method of step (3) is: uniformly dispersing polylysine coated silicon dioxide particles in Tris-HCl to obtain a treatment solution, adding the treatment solution into urine II, vertically mixing the treatment solution and the urine II in an upside-down manner for 30 minutes, standing the mixture at room temperature, discarding the supernatant after complete precipitation, suspending the obtained precipitate by using sterile deionized water, standing the mixture until complete precipitation, discarding the supernatant, repeating the suspension step of the sterile deionized water, finally adding a sodium bicarbonate aqueous solution into the obtained precipitate, treating the precipitate at 80 ℃ for 30 minutes, and eluting the precipitate twice; wherein, the ratio of silica gel powder, Tris-HCl, urine II, sterile deionized water and sodium bicarbonate water solution is 13.33 mg: 40 μ L of: 100 μ L of: 1mL of: 30. mu.L of aqueous sodium bicarbonate solution at a concentration of 100 mM.

The pretreatment method of the large-volume urine is applied to preparation of a urine sample of a urinary epithelial cancer mutant gene QPCR detection kit.

The invention has the beneficial effects that:

the invention can carry out high-efficiency and low-cost DNA enrichment from a large amount of urine and effectively remove the inhibitors which influence the subsequent molecular biological reaction, such as heme, urea and the like in the hematuria, thereby directly detecting the enriched product and achieving the purpose of faster detection. The detection method and the detection kit thereof can accurately detect 5 copies of urothelial cancer related mutant DNA molecules from 100mL of urine.

Pretreating urine: the urine used in the invention can be fresh hematuria or quick frozen hematuria after collection. Since urine, particularly hematuria, contains various proteins and enzymes, it is necessary to digest proteins first to prevent excessive proteins from affecting the enrichment of DNA.

Removing an inhibitor: the hematuria often contains a large amount of immunoglobulin G, hemoglobin, lactoferrin, iron ions and the like, and can inhibit subsequent molecular biological reactions such as QPCR and the like. Meanwhile, a large amount of urea contained in urine is also an inhibitor of molecular biological reaction. In addition, some blood urine samples contain anticoagulants such as EDTA for sample stabilization during collection, which also seriously affect the molecular biological response. On the other hand, enrichment of free DNA from such large urine samples also results in a much larger amount of inhibitor than is present in conventional small urine samples. The inhibitory effect of these inhibitors, which severely affect the detection reaction, needs to be reduced or eliminated by various methods. At the same time, to maximize detection sensitivity, all enriched DNA can be used for detection, which requires less inhibitor content to affect detection. PVP (polyvinylpyrrolidone) is a water-soluble polymer. PVPP is a highly crosslinked PVP polymer. Which upon crosslinking will absorb water, causing the polymer to swell. As the degree of crosslinking increases, the water solubility thereof becomes poor. PVP is widely used in the wine industry to remove polyphenols and is also useful in the processing of biological samples to neutralize phenolics. The inventor finds that the inhibitor component in the large-volume urine can be adsorbed and removed with very good effect in the experimental process.

And (3) enriching free DNA: free DNA contained in urine carries negative charges due to the phosphate skeleton, and the medium with positive charges is used for adsorbing the free DNA, so that the aim of enriching from large-volume urine is fulfilled. Such as polylysine coated silica particles, magnetic particles coated with various charged groups, and the like. The silica particles are generally spherical silica with uniform particle size distribution prepared by taking tetraethoxysilane as a raw material. The silicon dioxide particles with Si-OH ends have hydrophilic surfaces, are chemically active and are stable for a long time in organic solvents and aqueous media. The hydroxyl on the surface of the silicon dioxide particles can enable various substances to be combined on the surface of the particles, improve the surface state of the particles and realize chemical modification of the particles. Different organic functional groups such as COOH, NH2, NHS, Epoxy, Ni-NTA, C18 and the like can be introduced to functionalize the surface of the functional group, and various biomolecules such as Streptavidin, Avidin and Protein A and the like can be covalently bonded to improve the biological targeting property of the functional group, so that the functional group is applied to the fields of biological analysis, biochemical detection and the like. Polylysine coated silica particles are preferred for use in the present invention.

QPCR detection: the hot spot mutation of the TP53 gene and the TERT gene was detected by fluorescence PCR. If the corresponding hotspot mutation has a fluorescent signal, the corresponding urothelial cancer mutant gene is indicated in the hematuria sample.

Drawings

FIG. 1 is a QPCR plot for samples A-S1;

FIG. 2 is a QPCR plot for samples A-S2;

FIG. 3 is a QPCR plot for samples A-S3;

FIG. 4 is a QPCR plot for samples B-S1;

FIG. 5 is a QPCR plot for samples B-S2;

FIG. 6 is a QPCR plot for samples B-S3;

FIG. 7 is a graph showing the detection of pectin by gel electrophoresis in example 2.

Detailed Description

The present invention will be further described with reference to the accompanying drawings and examples, which are provided for the purpose of illustration only and are not intended to limit the scope of the invention.

Example 1

Urine pretreatment, removal of inhibitors and free DNA enrichment

A hematuria sample of a patient with non-urothelial cancer was taken in two aliquots A and B, each 300 mL. Each was divided into three 100mL portions. Respectively numbered A-S1, A-S2, A-S3, B-S1, B-S2 and B-S3.

Artificially synthesizing a positive TERT to-be-detected sequence as follows:

TERT(-124/-146)：

GGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAAGGGGCTGGGCCGGGGACCCGGAAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCA, as shown in SEQ ID NO. 1;

QPCR primer and probe sequences were as follows:

TERT 124-F: GGAGAGGGCGGGGCCGCGGA, as shown in SEQ ID NO. 2;

TERT 124-R: GGGTCCCCGGCCCAGCCCCT, as shown in SEQ ID NO. 3;

TERT 124-P: FAM-AAGGAAGGGGAGGGGCTGG-BHQ1 as shown in SEQ ID NO. 4;

TERT 146-F: GGCTGGGCCGGGGACCCGGA, as shown in SEQ ID NO. 5;

TERT 146-R: TGGGGACCCGGGCACCCGTCCTG, as shown in SEQ ID NO. 6;

TERT 146-P: VIC-CGGAGGAGGCGGAGCTGGAA-BHQ1 shown as SEQ ID NO. 7;

internal reference gene primer and probe sequence:

AGAGGTTGTTATATTTAACAAAAGTGTTCA as shown in SEQ ID NO. 8;

TTATTAACTTTAGAAATATTATTTTACCTG, shown as SEQ ID NO. 9;

RP-P is HEX-CAGTTGGCTATTCAGTTGT-BHQ1, shown as SEQ ID NO. 10;

the artificially synthesized positive TERT sequence was spiked into a hematuria sample at a concentration of 50nM/100mL of urine as described above.

A. Pretreating urine:

each 100mL aliquot of hematuria was mixed well and divided equally into 250 mL BD tubes. Centrifuge 800g for 10 minutes, remove sediment and transfer supernatant to a new 50mL BD tube. mu.L (20mg/mL) of proteinase K was added and digested in a water bath at 55 ℃ for 30 minutes. Mix by inversion every 10 minutes.

B. Removing an inhibitor:

the sample after urine pretreatment was allowed to stand at room temperature. 35mg of PVPP (Ashland, # Polyplasdone XL, particle size 110- > 130um) was added and the mixture was mixed by inverting on a vertical mixer for 30 minutes. Centrifuge 1600g for 5 minutes. The supernatant was transferred to a new 50mL BD tube.

C. And (3) enriching free DNA:

preparing silica gel particles:

250mg of silica gel 60N (Kanto, #37565-79), 100mg of powdered polylysine (poly-Lys) (Biyunyan, # ST509) were added to 10mL of 100mM Tris-HCl (pH 7.0), and vortexed for 30 minutes. The particles were washed three times with 10mL 100mM Tris-HCl (pH 7.0). 100mM Tris-HCl (pH 7.0) was supplemented to a total volume of 750. mu.L. Storing at 4 ℃.

② enriching free DNA:

the silica gel particles were re-mixed and 40. mu.L was added to 100. mu.L of urine sample. The mixture is mixed for 30 minutes from top to bottom on a vertical mixer. Taking down the mixture and standing the mixture at room temperature, and removing supernatant after the silica gel particles are completely precipitated. The precipitated particles were suspended using 1mL sterile deionized water and transferred to a 1.5mL tube. Standing for complete precipitation, and then discarding the supernatant; suspending the precipitated particles by using 1mL of sterile deionized water, standing for complete precipitation, and then discarding the supernatant; 30 μ L of 100mM sodium bicarbonate (pH 11) was added and 80 ℃ for 30 min. Elution was performed twice.

Each sample was run according to the steps in Table 1 to illustrate the importance of each step of urine pretreatment, removal of inhibitors, and enrichment of free DNA in the present invention.

TABLE 1

QPCR detection

mu.L of each sample was subjected to QPCR reaction according to Table 2:

TABLE 2

Reagent	Amount of addition
		5×buffer A	4μL
2G Robust DNA polymerase	0.2μL
		DNA sample	5μL
dNTP(10mM each)	1μL
		Primer TERT124-F (100uM)	1μL
Primer TERT124-R (100uM)	1μL
		Probe TERT124-P (120uM)	1μL
Primer TERT146-F (100uM)	1μL
		Primer TERT146-R (100uM)	1μL
Probe TERT146-P (120uM)	1μL
		Internal reference gene RP-F (100uM)	1μL
Internal reference gene RP-R (100uM)	1μL
		Internal reference gene RP-P (120uM)	1μL
Deionized water	0.8μL
		Total volume	20μL

The reaction conditions are shown in Table 3:

TABLE 3

The experimental results are shown in figures 1-6, and the results show that the urine pretreatment and the removal of inhibitors are necessary steps in the invention, and both the steps can effectively enrich free DNA in hematuria and successfully perform downstream QPCR detection.

Example 2

For the purpose of cost reduction, mutation detection may be performed by a gel electrophoresis method without using a detection probe.

A blood urine sample of a patient with non-urothelial cancer is taken in three portions of A, B, C, each of which is 100 mL.

Artificially synthesizing single positive TERT (-124) and double positive TERT (-124/-146) to be detected sequences as follows: TERT (-124): GGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAAGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCA, as shown in SEQ ID NO. 11;

TERT(-124/-146)：

QPCR primer and probe sequences were as follows:

TERT 124-F: GGAGAGGGCGGGGCCGCGGA, as shown in SEQ ID NO. 2;

TERT 124-R: GGGTCCCCGGCCCAGCCCCT, as shown in SEQ ID NO. 3;

TERT 146-F: GGCTGGGCCGGGGACCCGGA, as shown in SEQ ID NO. 5;

TERT 146-R: TGGGGACCCGGGCACCCGTCCTG, as shown in SEQ ID NO. 6;

the A sample was not mixed with the artificially synthesized positive mutant TERT sequence fragment, and the B sample was mixed with the single positive TERT (-124) sequence fragment at a concentration of 50nM/100mL urine. C samples were mixed with double positive TERT (-124/-146) sequence fragments at a concentration of 50nM/100mL urine.

A. Pretreating urine:

each 100mL aliquot of hematuria was mixed well and divided equally into 2 tubes of 50 mLBD. Centrifuge 800g for 10 minutes, remove sediment, supernatant to new 50mLBD tube. mu.L (20mg/mL) of proteinase K was added and digested in a water bath at 55 ℃ for 30 minutes. Mix by inversion every 10 minutes.

B. Removing an inhibitor:

C. And (3) enriching free DNA:

preparing silica gel particles:

② enriching free DNA:

PCR amplification:

mu.L of each sample was subjected to PCR reaction according to Table 4:

TABLE 4

Reagent	Amount of addition
		5x buffer A	4μL
2G Robust DNA polymerase	0.2μL
		DNA sample	5μL
dNTP(10mM each)	1μL
		Primer TERT124-F (100uM)	1μL
Primer TERT124-R (100uM)	1μL
		Primer TERT146-F (100uM)	1μL
Primer TERT146-R (100uM)	1μL
		Deionized water	5.8μL
Total volume	20μL

The reaction conditions are shown in Table 5:

TABLE 5

The results of the experiment are shown in fig. 7, in which case the hematuria sample a did not incorporate the mutated TERT sequence fragment and therefore was not amplified. The hematuria sample B incorporates a single mutated TERT (-124) sequence fragment, which results in a 70bp amplification product. The incorporation of a double mutant TERT (-124/-146) sequence fragment into the hematuria sample C resulted in two amplification products: the TERT (-124) sequence fragment produces an amplification product of 70bp, the TERT (-146) sequence fragment produces an amplification product of 100bp, and the two amplification products are combined to generate a third composite amplification product (153 bp). The design of the composite amplified fragment can help to more accurately identify the specific mutation type of the sample.

Example 3

84 specimens of clinically confirmed urothelial cancer accompanied by hematuria were tested.

A. Pretreating urine:

B. Removing an inhibitor:

the sample after urine pretreatment was allowed to stand at room temperature. 35mg of PVPP (Ashland, # Polyplasdone XL, particle size 110- > 130um) was added and the mixture was mixed by inverting on a vertical mixer for 30 minutes. Centrifuge 1600g for 5 minutes. The supernatant was transferred to a new 50mLBD tube.

C. And (3) enriching free DNA:

preparing silica gel particles:

② enriching free DNA:

2.QPCR

See example 1 for primers, probes, reagents, and reaction conditions.

The results are shown in Table 6:

TABLE 6

In this example, the accuracy of detection of 84 cases of urothelial cancer by the present invention was about 77%.

Although the embodiments of the present invention have been described with reference to the accompanying drawings, the scope of the present invention is not limited thereto, and various modifications and variations which do not require inventive efforts and which are made by those skilled in the art are within the scope of the present invention.

Sequence listing

<110> Xiangya three hospitals of Zhongnan university

Same-year Biotech Ltd of Hunan Earth

<120> pretreatment method and application of large-volume urine

<130> 2022

<141> 2022-01-09

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 153

<212> DNA

<213> Artificial Sequence

<400> 1

ggagagggcg gggccgcgga aaggaagggg aggggctggg agggcccgga aggggctggg 60

ccggggaccc ggaaggggtc gggacggggc ggggtccgcg cggaggaggc ggagctggaa 120

ggtgaagggg caggacgggt gcccgggtcc cca 153

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

ggagagggcg gggccgcgga 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 3

gggtccccgg cccagcccct 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 4

aaggaagggg aggggctgg 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

ggctgggccg gggacccgga 20

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 6

tggggacccg ggcacccgtc ctg 23

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

cggaggaggc ggagctggaa 20

<210> 8

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 8

agaggttgtt atatttaaca aaagtgttca 30

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 9

ttattaactt tagaaatatt attttacctg 30

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 10

cagttggcta ttcagttgt 19

<210> 11

<211> 153

<212> DNA

<213> Artificial Sequence

<400> 11

ggagagggcg gggccgcgga aaggaagggg aggggctggg agggcccgga aggggctggg 60

ccggggaccc gggaggggtc gggacggggc ggggtccgcg cggaggaggc ggagctggaa 120

ggtgaagggg caggacgggt gcccgggtcc cca 153

Claims

1. A pretreatment method of large-volume urine is characterized by comprising the following specific steps:

2. The method for pre-treating large volume of urine according to claim, wherein in step (1), said urine is fresh blood or blood frozen immediately after collection.

3. The method for pre-treating large volume of urine as claimed in claim, wherein the specific method in step (1) is: firstly, centrifuging hematuria for 10 minutes by a refrigerated centrifuge of 800g, taking supernatant, then adding proteinase K into the supernatant, and digesting for 30 minutes at 55 ℃; wherein the volume ratio of hematuria to proteinase K is 1000: 1, the concentration of proteinase K is 20 mg/mL.

4. The method for pre-treating large volume of urine as claimed in claim, wherein the specific method in step (2) is: firstly, adding crosslinked polyvinylpyrrolidone PVPP into urine I, mixing the urine I and the PVPP evenly from the top of a vertical mixing instrument, centrifuging the urine I for 5 minutes by a refrigerated centrifuge at 1600g, and taking the supernatant to obtain urine II; wherein the dosage ratio of hematuria to PVPP is 100 mL: 35 mg.

5. The method for pre-treating large volume of urine according to claim, wherein in step (3), the polylysine-coated silica particles are prepared by the following steps: adding silica gel powder and powdery polylysine into Tris-HCl (Tris (hydroxymethyl) aminomethane hydrochloride) with the pH value of 7, vortexing for 30 minutes, centrifuging to obtain a precipitate, and cleaning to obtain the gel-silica gel-loaded porous carrier; wherein the ratio of silica gel powder, powdery polylysine and Tris-HCl is 250 mg: 100 mg: 10mL, Tris-HCl concentration 100 mM.

6. The method for pre-treating large volume of urine as claimed in claim, wherein the specific method in step (3) is: uniformly dispersing polylysine coated silicon dioxide particles in Tris-HCl to obtain a treatment solution, adding the treatment solution into urine II, vertically mixing the treatment solution and the urine II in an upside-down manner for 30 minutes, standing the mixture at room temperature, discarding the supernatant after complete precipitation, suspending the obtained precipitate by using sterile deionized water, standing the mixture until complete precipitation, discarding the supernatant, repeating the suspension step of the sterile deionized water, finally adding a sodium bicarbonate aqueous solution into the obtained precipitate, treating the precipitate at 80 ℃ for 30 minutes, and eluting the precipitate twice; wherein, the ratio of silica gel powder, Tris-HCl, urine II, sterile deionized water and sodium bicarbonate water solution is 13.33 mg: 40 μ L of: 100 μ L of: 1mL of: 30. mu.L of aqueous sodium bicarbonate solution at a concentration of 100 mM.

7. Use of the pretreatment method for large volume urine according to any one of claims 1 to 6 in preparation of urine samples of a urinary epithelial cancer mutation gene QPCR detection kit.