Background
Bladder cancer refers to the most common malignant tumor of urinary system which occurs on the mucous membrane of bladder, the average onset age is about 65 years old, about 90% of which is transitional cell carcinoma, the other 10% are mainly squamous carcinoma and adenocarcinoma, the incidence rate of bladder cancer in the national tumor registration area in 2012 is 6.61/10 ten thousand, and the 9 th position of the incidence rate of malignant tumor is listed. The obvious characteristics of poor prognosis and easy recurrence exist, and the 5-year survival rate of the early-discovered and early-treated bladder cancer patient is more than 90 percent, so the early diagnosis has important significance for the treatment of the disease. Cystoscopy is the most reliable method for diagnosing bladder cancer at present, and can find whether the bladder has tumor through cystoscopy, but the cystoscopy is invasive and expensive, has poor patient compliance, is easy to stimulate bladder wall tumor, can cause malignant swelling and metastasis of tumor, and is not suitable for large-scale screening; urine shedding cytology examination has high specificity for diagnosis of urothelial cancer, but has low sensitivity to graded bladder cancer, is prone to false negative results, and factors such as cellular atypical or degenerative changes, urinary system infection, calculus, bladder perfusion therapy, and large observation bias among different examiners also have an effect on urine cytology examination. Therefore, the application of the tumor marker method which is noninvasive, simple and convenient and has easily obtained specimens in the aspects of early diagnosis and postoperative detection of bladder cancer attracts more attention of researchers.
At present, bladder cancer related products on the market comprise a bladder cancer cell chromosome and gene abnormality detection kit (fluorescence in situ hybridization method) for detecting aneuploidy of chromosome 3, 7 and 17 and deletion of P16(9P21) in exfoliated cells, and related tumor marker products such as a bladder tumor related antigen BTA quantitative determination kit (microplate chemiluminescence method), a urinary nucleus matrix protein 22(NMP-22) detection kit (colloidal gold method) and the like. The FISH technology is more suitable for detecting the postoperative recurrence of the urothelial cancer, but for low-grade urothelial cancer, the lack of genetic abnormality related to the urothelial cancer can cause missed diagnosis and easily form false negative results. NMP-22 is a three-dimensional network structure protein involved in maintaining the function of the nucleus, can be released into urine through apoptosis, is considered to be closely related to urothelial tumor, and has been shown to be present in bladder cancer epithelial cells by tens of times higher than normal urothelial cells. The reports of the literature on the sensitivity and the specificity of the NMP-22 are different (47 to 90 percent), and great controversy exists. The bladder tumor associated antigen (BTA), also known as complement factor H associated protein, is produced by urothelial tumor cells and macrophages, is a compound released into the bladder during the growth process of bladder tumors, and when the urine BTA level is high, the occurrence of the urothelial tumors is prompted, so that the bladder tumor associated antigen (BTA) can be used for early detection and recurrence monitoring of the urothelial tumors. The guidelines for diagnostic and treatment of bladder cancer indicate: BTA is a tumor marker used for detecting bladder cancer earlier, and is detected by adopting a BTA Stat method and a BTA Trak method, wherein the BTA Stat is a rapid qualitative method, and the sensitivity and specificity are respectively 29-74% and 56-86% according to related literature reports; BTATrak is an enzyme-linked immunosorbent assay quantitative method, the sensitivity and specificity are 60% -83% and 60% -79% respectively, and the sensitivity is improved along with the grading and stage rise of tumors. The detection of NMP-22 and BTA is non-invasive, convenient and quick, but when hematuria, urinary tract infection, urinary calculus, prostatic hyperplasia and other urinary system diseases occur, particularly after bladder perfusion chemotherapy, the false positive rate of the detection of NMP-22 and BTA is higher, so that bladder cancer tumor markers with high specificity and sensitivity are still needed to be developed.
The exosome is a bilayer structure vesicle-like corpuscle actively secreted by cells, has the diameter of 30-150 nm and the density of 1.10-1.18 g/ml, can be released by cells of different types (including tumor cells) in an abscission way, and can be detected in most body fluids such as peripheral blood, urine, saliva, ascites, amniotic fluid, breast milk, cerebrospinal fluid, joint fluid, bronchoalveolar lavage fluid and the like. The exosome comprises protein, DNA, RNA and other components, can selectively wrap/release genetic information in cells of the exosome, and research results of exosome content in the fields of intercellular communication, tumor immunity, treatment and the like are reported in many documents, so that the exosome extracted from the cells has huge application potential in diagnosis and monitoring of diseases, tumors and the like. At present, domestic patents on exosomes mainly focus on exosome separation and detection, but few published reports of exosome extraction in urine applied to bladder cancer auxiliary diagnosis are provided, only Zhejiang university publishes an integrated detection method and a detection chip for urine exosome separation, enrichment and detection, cancer information in urine exosomes is detected to be used for noninvasive diagnosis and monitoring of bladder cancer, and the method establishes a chip ELISA rapid diagnosis method by using a specific marker of exosome transmembrane protein CD63, but does not screen bladder cancer specific tumor markers.
If tumor markers with high specificity and sensitivity can be searched and screened from the extracted urine sample exosomes and rapid detection is carried out by means of molecular means, the method has great significance for assisting early diagnosis and postoperative detection of bladder cancer.
Disclosure of Invention
In order to solve the above problems, the present invention provides a kit for non-invasively detecting the probability of having bladder cancer using urine exosomes, comprising primers and probes for genes of markers CK20, CA9, and UCA 1.
The forward primer of CK20 is SEQ.1: AAAAGGAGCATCAGGAGGAAGTC the flow of the air in the air conditioner,
the reverse primer of CK20 is SEQ.2: GCATCAACCTCCACATTGACA the flow of the air in the air conditioner,
the TaqMan probe of CK20 is SEQ.3:
ATGGCCTACACAAGCATCTGGGCAA,
the forward primer of CA9 is seq.4: CATCCTAGCCCTGGTTTTTGG the flow of the air in the air conditioner,
the reverse primer of CA9 is seq.5: CCTTCTGTGCTGCCTTCTCAT the flow of the air in the air conditioner,
the TaqMan probe of CA9 is SEQ.6: CTGTCACCAGCGTCGCGTTCCTT the flow of the air in the air conditioner,
the forward primer of UCA1 is seq.7: GCCCTCATTCCGTGAAGAGA the flow of the air in the air conditioner,
the reverse primer of UCA1 is seq.8: ATTTGAAATTGGTGAGATGTTCCTT the flow of the air in the air conditioner,
the TaqMan probe of UCA1 is seq.9: CCACCTGCGACCTCGGGTCCT are provided.
a. b, c and d represent the results of the fluorescent quantitation of each of CA9, CK20, IGF2 and UCA14 genes, respectively,
logit (p) -1.146 a-0.068 b +0.692 d-0.924, or,
Logit(P)=1.274*a-0.077*b+0.84*d-0.714,
the Logit (P) value is used to determine the probability of bladder cancer.
The term "probability of bladder cancer" means that the detected logit (p) value of the person is the probability of cancer.
Preferably, the kit also comprises primers and a needle sequence of endogenous control genes GAPDH and beta-actin.
The forward primer of GAPDH is seq.13: CACATGGCCTCCAAGGAGTAA the flow of the air in the air conditioner,
the reverse primer of GAPDH is seq.14: TGAGGGTCTCTCTCTTCCTCTTGT the flow of the air in the air conditioner,
the TaqMan probe for GAPDH is seq.15: CTGGACCACCAGCCCCAGCAAG the flow of the air in the air conditioner,
the forward primer of beta-actin is SEQ.16: TGCCGACAGGATGCAGAAG the flow of the air in the air conditioner,
the reverse primer of beta-actin is SEQ.17: CTCAGGAGGAGCAATGATCTTGA the flow of the air in the air conditioner,
the TaqMan probe of beta-actin is SEQ.18: ATCACTGCCCTGGCACCCAGCA are provided.
The invention can be used for non-invasive auxiliary diagnosis of bladder cancer by detecting the information of urine exosomes, and meanwhile, some tumor markers (such as CA9, CK20, UCA1 and the like) in urine exfoliative cells are good markers for diagnosing bladder cancer, and the non-invasive diagnosis of bladder cancer can be realized by detecting the expression quantity of the tumor markers in the urine exosomes.
Compared with the prior art, the invention has the following beneficial effects:
(1) the invention uses the urine exosome for diagnosing the bladder cancer, is a non-invasive diagnosis method, has convenient and repeatable material obtaining, is easy to accept and operate by patients, can be matched with cystoscopy although the cystoscopy cannot be completely replaced, reduces the cystoscopy frequency and reduces the pain and the risk of the patients.
(2) The research object of the invention is the exosome in urine, as the exosome secreted by the tumor cell has more secretion than the normal cell, the exosome can also play the role of a tumor marker, and the vesicle structure of the exosome is stable, the molecular stability of the carried tumor-specific related nucleic acid, protein and the like is superior to the complex environment and blood free state of the cell, the physiological and pathological function states of the secretory cell can be truly reflected, and the specificity is better.
(3) The invention simultaneously detects 4 tumor markers of CA9, CK20 and UCA1 in urine exosomes for the first time, improves the specificity to more than 95 percent by establishing a bladder cancer diagnosis model, achieves the sensitivity to more than 71 percent and has the positive prediction rate of more than 92 percent, and shows better diagnosis performance compared with clinical urine exfoliative cytology examination (the sensitivity is 13 to 75 percent and the specificity is 85 to 95 percent) and other bladder cancer immunodiagnosis products such as NMP22 (the sensitivity is 47 to 90 percent and the specificity is 55 to 98 percent).
(4) The invention is a powerful supplement to the existing bladder tumor diagnosis technology and has important significance for filling up the blank of molecular diagnosis products in vitro of bladder cancer in China.
Detailed Description
The non-invasive detection method based on urine exosome bladder cancer of the present invention is described in detail below with reference to the accompanying drawings and specific embodiments.
The inventors collected 176 urine samples of cystoscopic and pathological diagnosis confirmed bladder cancer patients, defined as a bladder cancer group, and 123 healthy volunteers, defined as a control group, at the tumor control center of university of zhongshan between 2017 and 2018, months 3. The sample providers in this study were all informed of the purpose of the study and signed informed consent.
The non-invasive detection method based on the urine exosome bladder cancer comprises the following specific detection steps:
1. urine sample processing
30ml of morning urine before bladder cancer patients and 30ml of morning urine after healthy control groups are collected, and 176 samples of the bladder cancer groups and 123 samples of the healthy control groups are obtained, wherein 170 samples of the patients and 111 samples of the healthy control groups respectively meet requirements. Urine samples 3000g centrifugal 15 minutes, get the supernatant for standby.
2. Exosome enrichment
Exosomes were extracted from urine supernatants using an exosome extraction kit (System Biosciences, exotquick-TC, cat. No. exotc50a-1) according to the supplier's instructions. The method comprises the following specific steps:
(1) and (3) taking 20ml of urine supernatant obtained after sample treatment, adding 4ml of exosome extraction reagent, fully and uniformly mixing, and standing at 4 ℃ for 16 hours.
(2) The mixed solution is 5000g and centrifuged for 30 minutes at 4 ℃; the supernatant was carefully removed completely and the precipitate was collected as exosomes.
3. Exosome RNA extraction
Exosome total RNA was extracted from exosome pellets using RNA extraction Kit (Qiagen, miRNeasy Micro Kit, cat No. 217084):
(1) adding the collected exosome precipitate into 700uL QIAzol lysine Reagent, fully blowing, uniformly mixing, and transferring the mixed solution into a new RNase-free 1.5mL centrifuge tube;
(2) standing at room temperature for 5min, and fully cracking;
(3) adding 140uL of chloroform into the mixed solution, and violently and uniformly mixing for 15 s;
(4) standing at room temperature for 2-3 min;
(5) centrifuging at 4 deg.C and 12000Xg for 15 min;
(6) carefully sucking the upper aqueous phase solution into a new 1.5mL centrifuge tube;
(7) adding 1.5 times of anhydrous ethanol, and mixing;
(8) transferring the mixed solution into adsorption column (RNeasy MinElute spin column), placing the adsorption column in a collection tube, centrifuging at 4 deg.C and 12000Xg for 15s, discarding the waste liquid, and placing the adsorption column back in the collection tube;
(9) adding 700uL Buffer RWT (checking whether absolute ethyl alcohol is added according to requirements before use) into an adsorption column, centrifuging at 4 ℃ and 12000Xg for 15s, discarding waste liquid, and putting the adsorption column back into a collecting pipe;
(10) adding 500uL Buffer RPE (whether absolute ethyl alcohol is added according to requirements or not before use) into an adsorption column, centrifuging at 4 ℃ and 12000Xg for 15s, discarding waste liquid, and putting the adsorption column back into a collecting pipe;
(11) adding 500uL 80% ethanol into the adsorption column, centrifuging at 4 deg.C and 12000Xg for 2min, and removing waste liquid;
(12) transferring the adsorption column into a new collection tube, and centrifuging at 12000Xg for 5min at 4 ℃;
(13) transferring the adsorption column to a new 1.5mL RNase-free centrifuge tube, adding 14uL RNase-free H2And O, centrifuging at 4 ℃ and 12000Xg for 1min, and obtaining the RNA solution in a 1.5mL centrifuge tube.
The concentration of the obtained RNA was determined using a spectrophotometer (NanoDrop). In view of the feasibility of the next quantitative PCR experiment, samples with RNA concentrations below 8ng/uL were excluded from the study, and samples of 168 bladder cancer patients and 100 healthy controls were obtained and subjected to the next study.
4. Design of primers and probes
According to the design principle of primers and probes, primers and probes are designed for 4 target genes CK20, CA9, UCA1, IGF2 and 2 endogenous control genes beta-actin and GAPDH, the specific gene information is shown in Table 1, and the sequences of the primers and the probes are shown in Table 2.
Table 1: list of 4 target genes and 2 endogenous controls analyzed in the present application
Table 2: primer and probe sequences for 4 target genes and 2 endogenous controls analyzed in the present application
5. Real-time quantitative PCR
Complementary DNA (cDNA) was obtained by RNA Reverse transcriptase (Invitrogen, TaqMan Reverse Transcription Reagents, cat # 4304134) using 100ng to 500ng of total RNA obtained from urine samples, depending on availability. The cDNAs of 4 target genes and 2 endogenous control genes were amplified by fluorescent quantitative PCR reaction using PCR Taq enzyme (Applied Biosystems, TaqMan Universal PCR MasterMix, cat # 4304437) using an Applied Biosystems ABI 7500 real-time fluorescent quantitative PCR instrument.
Table 3: fluorescent quantitative PCR reaction system
The fluorescent quantitative PCR conditions were as follows:
6. data analysis
Processing the quantitative PCR data by 7500Software v2.3 Software configured by an amplification instrument, establishing a threshold value and a base line of each gene, and obtaining a CT value of each sample reaction corresponding to the gene. Data were normalized to the geometric mean of 2 endogenous control genes (. beta. -actin and GAPDH). In order to ensure the reliability of the result data, the RNA quality of the sample with the CT value of the endogenous control gene being more than 30 is considered to be low, and the RNA quality is excluded from the analysis, so that effective data of 158 bladder cancer patient samples and 88 healthy control samples are obtained. The relative expression of the target gene in the sample was calculated using the 2- Δ Δ ct algorithm, and the final result was expressed as RQ.
Genes with CT values greater than 36 are considered to be poorly expressed, and their Δ CT is calculated as the minimum Δ CT of the gene. Carrying out statistical analysis on RQ values of all data by using SPSS software, carrying out t test to observe whether the expressions of the bladder cancer group and the control group have significant difference or not, and constructing a scatter diagram of corresponding genes; calculating the sensitivity and specificity of the genes by the ROC curve; logistic regression analysis was used to construct a bladder cancer diagnostic model based on 4 genes, combining ROC curve analysis and evaluating model sensitivity and specificity.
7. Results
When samples of 176 bladder cancer groups and 123 control groups were analyzed, the concentration of exosome RNA and the expression of endogenous control genes were significantly different between the two groups (as shown in fig. 1). Expression analysis of 4 genes including CA9, CK20, IGF2 and UCA1 shows that the expression of the 4 genes in two groups has significant difference (as shown in figure 2), and the AUC area of the 4 genes is between 0.7304 and 0.8076 (as shown in figure 3), wherein the specificity of CK20 reaches 97.73%, but the sensitivity is low, the sensitivity of CA9 is relatively high, the AUC area of IGF2 is maximum, and UCA1 is low in expression in bladder cancer, and the relation between the other three genes and the bladder cancer is opposite. In view of the different performance of each gene data, 4 genes were subjected to combined analysis by using logistic regression equation, 11 calculation models based on 2 (C1-C6) or 3 (C7-C10) or 4 (C11) gene combinations were established, each model had significant difference between the bladder cancer group and the control group (FIG. 4-5), and the results calculated by ROC on each model equation were analyzed to find that the AUC area was between 0.6988 and 0.9064, wherein the C11C8 combination had the highest diagnostic performance, the AUC area was 0.9064, the sensitivity was 71.52%, and the specificity was 95.45% (Table 4, FIG. 6), and the total coincidence rate was 81.7%. The probability of bladder cancer in the unknown sample can be predicted by the logistic regression equation logit (p) 1.146 a-0.068 b +0.692 d-0.924 derived from the C11 model.
Table 4: diagnostic performance of 4 genes and combinations thereof analyzed in the present application
SN: sensitivity; SP: specificity; PPV: positive prediction rate; NPV: negative prediction rate; cutoff: a cutoff value; a. b, c and d represent the fluorescence quantitative results of each of CA9, CK20, IGF2 and UCA14 genes respectively
While the preferred embodiments of the present invention have been illustrated and described in detail, it should be understood that modifications and variations can be made by persons skilled in the art in light of the above teachings without inventive faculty. Therefore, any technical solutions that can be obtained by a person skilled in the art through logical analysis, reasoning or limited experiments based on the prior art according to the present inventive concept should be within the scope of protection defined by the present claims.
Sequence listing
<110> Hengtai Biotechnology Ltd, Guangzhou
<120> a kit for non-invasively detecting probability of bladder cancer using urine exosomes
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aaaaggagca tcaggaggaa gtc 23
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gcatcaacct ccacattgac a 21
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atggcctaca caagcatctg ggcaa 25
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
catcctagcc ctggtttttg g 21
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ccttctgtgc tgccttctca t 21
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ctgtcaccag cgtcgcgttc ctt 23
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gccctcattc cgtgaagaga 20
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
atttgaaatt ggtgagatgt tcctt 25
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ccacctgcga cctcgggtcc t 21
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
agagagacac caatgggaat cc 22
<210> 11
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gcggtaagca gcaatgca 18
<210> 12
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cttctcacct tcttggcctt cgcctc 26
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
cacatggcct ccaaggagta a 21
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
tgagggtctc tctcttcctc ttgt 24
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
ctggaccacc agccccagca ag 22
<210> 16
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tgccgacagg atgcagaag 19
<210> 17
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ctcaggagga gcaatgatct tga 23
<210> 18
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
atcactgccc tggcacccag ca 22