CN114686607B - Application of corynebacteria as urine microorganism marker in preparation of related detection products for detecting bladder cancer - Google Patents

Abstract

The application provides application of corynebacteria serving as a urine microorganism marker in preparation of related detection products for detecting bladder cancer. The application discovers that the corynebacteria have strong correlation with the bladder cancer patients in healthy people and have higher prediction probability, so that the corynebacteria are used as a microbial marker in urine to prepare a detection product for detecting the bladder cancer, and the method has the advantages of low cost and no wound.

Description

Application of corynebacteria as urine microorganism marker in preparation of related detection products for detecting bladder cancer

Technical Field

The application relates to the field of bladder cancer diagnosis, in particular to application of corynebacteria serving as a urine microorganism marker in preparation of a related detection product for detecting bladder cancer.

Background

Bladder cancer is the fourth most common cancer in men (7% of male solid malignant tumors), and in recent 10 years, with increased levels of industrialization and aging population, the incidence of bladder cancer in Chinese people, both men and women, has a growing trend. The gold standard for bladder cancer monitoring is white light endoscopy, however, this method is invasive and expensive, can cause significant discomfort to the patient, and also results in expensive expense due to the need for repeated endoscopy during the monitoring process. These factors can lead to reduced compliance in patients with bladder cancer. In addition, bladder cancer can be screened through urine abscission cytology examination, but the abscission cytology examination has complicated materials, is difficult to obtain satisfactory specimens, and has few clinical applications.

Urine tumor markers are conceptually well suited for monitoring because urine is in direct contact with the tumor and the tumor releases metabolites into the urine. In low risk bladder cancer patients, the biomarker can help reduce the frequency of endoscopic detection. For high-risk patients, the biomarkers can more timely discover early recurrence and progression of tumors.

At present, the research on urine of bladder cancer is mainly focused on screening biomarkers such as abscission cells, urine supernatant cfDNA, microRNA, exosomes and the like, and the effect of urine flora on tumors of the urinary system is an emerging research field, urine and bladder are considered to be sterile in the past, but bacteria exist in the urine through 16S rDNA sequencing. Thus, if markers associated with diagnosis or monitoring of bladder cancer can be found from the microbial flora in the urine of bladder cancer, the diagnosis of bladder cancer and/or monitoring of the progress of recurrence can be driven to a maximum extent.

Disclosure of Invention

The application mainly aims to provide an application of corynebacteria as a urine microbial marker in preparing a related detection product for detecting bladder cancer, so as to provide a noninvasive low-cost detection product capable of diagnosing and monitoring bladder cancer.

In order to achieve the above object, according to a first aspect of the present application, there is provided the use of corynebacteria as a urine biomarker in the manufacture of a relevant test product for the detection of bladder cancer.

Further, the urine microorganism marker is a specific sequence of corynebacterium, preferably, the specific sequence is selected from any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5; preferably, the specific sequence is SEQ ID NO. 1.

Further, the detection product comprises a detection primer for detecting the specific sequence; preferably, the detection primer is selected from any one of the following primer pairs: (1) SEQ ID NO. 6 and SEQ ID NO. 7; (2) SEQ ID NO. 8 and SEQ ID NO. 9; (3) SEQ ID NO 10 and SEQ ID NO 11; (4) SEQ ID NO. 12 and SEQ ID NO. 7 and (5) SEQ ID NO. 13 and SEQ ID NO. 14; preferably, the detection primers are primer pairs SEQ ID NO. 12 and SEQ ID NO. 7.

Further, the detection includes one or more of diagnostic detection, progress monitoring, and prognostic detection; preferably, the detection is performed by fluorescence quantitative PCR.

Further, the relevant detection product is a reagent or a kit.

In order to achieve the above object, according to a second aspect of the present application, there is provided a kit for detecting bladder cancer, characterized in that the kit comprises a reagent for detecting corynebacteria in urine.

Further, the kit comprises a detection reagent for detecting a specific sequence of corynebacteria in urine; preferably, the specific sequence is selected from any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5; more preferably, the specific sequence is SEQ ID NO. 1; preferably, the detection reagent comprises a detection primer that detects a specific sequence; more preferably, the detection primer is selected from any one of the following primer pairs: (1) SEQ ID NO. 6 and SEQ ID NO. 7; (2) SEQ ID NO. 8 and SEQ ID NO. 9; (3) SEQ ID NO 10 and SEQ ID NO 11; (4) SEQ ID NO. 12 and SEQ ID NO. 7 and (5) SEQ ID NO. 13 and SEQ ID NO. 14; further preferably, the detection primers are primer pairs SEQ ID NO. 12 and SEQ ID NO. 7.

Further, the kit further comprises any one or more of the following: positive standard, PCR reaction related reagent, urine collector and DNA related reagent extracted from urine; preferably, the positive standard is a plasmid standard, more preferably the plasmid standard is a plasmid standard comprising the sequence shown in SEQ ID NO. 1, further preferably the plasmid standard is stored in dry powder form; preferably, the PCR reaction-related reagent is a fluorescent quantitative PCR reaction-related reagent; more preferably, the PCR reaction-related reagents include any one or more of the following: DNA polymerase, DNA polymerase buffer, dNTPs, fluorescent dye and optional deionized water; further preferably, the DNA polymerase, DNA polymerase buffer and dNTPs are present as a DNA polymerase premix, and the fluorescent dye is ROX Reference Dye; still more preferably, the DNA polymerase is selected from TAKARA SYBR Premix Ex Taq II.

According to the technical scheme, according to the research result, the strong correlation of the corynebacteria in healthy people and bladder cancer patients is found, and the prediction probability is higher, so that the corynebacteria are used as a microbial marker in urine to prepare a detection product for detecting bladder cancer, and the method has the advantages of low cost and no wound.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification, illustrate embodiments of the application and together with the description serve to explain the application. In the drawings:

fig. 1 shows that corynebacteria screened according to an embodiment of the present application have a significant difference between bladder cancer patients and healthy persons.

FIGS. 2A and 2B show, respectively, the sequence of a coryneform bacterium specific target gene according to an embodiment of the present application as SEQ ID NO:1. 4 and/or 5, a box plot (boxplot) and ROC curve of the detection results of 16 tumor patients and 16 healthy people are performed by using the optimal primer (the primer used is Cor-F4/Cor-R4).

FIGS. 3A and 3B show, respectively, the sequence of a coryneform bacterium specific target gene according to an embodiment of the present application as SEQ ID NO:1. 4 and/or 5, the primer pair is used for detecting the box-shaped graph and ROC curve of 16 tumor patients and 16 healthy people by the aid of the primer pair of Cor-F1/Cor-R1.

FIGS. 4A and 4B show, respectively, a coryneform bacterium having a target gene sequence of SEQ ID NO:1. 4 and/or 5, a box plot and ROC curve of the detection results of 16 tumor patients and 16 healthy people are obtained by using the primer pair Cor-F2/Cor-R2.

FIGS. 5A and 5B show box-shaped graphs and ROC curves of the detection results of 16 tumor patients and 16 healthy persons using the primer pair Cor-F5/Cor-R5 when the specific target gene sequences of coryneform bacteria are SEQ ID NO:2 and/or 3, respectively, in the examples according to the present application.

Detailed Description

It should be noted that, without conflict, the embodiments of the present application and features of the embodiments may be combined with each other. The present application will be described in detail with reference to examples.

According to the studies conducted at present, the basic knowledge of the relationship between the presence of microorganisms in urine and bladder cancer is that the abundance of microbial species varies between bladder cancer patients and healthy individuals, but different studies have different conclusions, so no theories of bladder cancer markers exist at present.

In order to improve the current situation and find potential bladder cancer markers from urine, the inventor of the present application conducted a study on bladder cancer urine flora, and conducted analysis and comparison on urine flora of 46 bladder cancer patients and 47 healthy individuals by using 16S rDNA amplicon sequencing, and analysis shows that:

(1) The flora diversity and the overall composition are significantly different between the two groups (while most of the presently disclosed articles consider that the urine flora diversity and the overall composition are not significantly different between the two groups, the inventor considers that the reason for the difference of the results is possibly related to the small sample size used by the articles through analysis);

(2) And bacteria with significant abundance differences between the two groups were identified. Among them, corynebacteria (Corynebacterium) have been found to have a strong correlation with bladder cancer.

Since the change of the microbial components in different stages of the research can be used as a new means for diagnosing and prognosis monitoring of cancers, the research further finds out markers for diagnosing and monitoring the occurrence and development of bladder cancers by measuring specific genes of corynebacteria in bladder cancers.

On this basis, quantitative PCR (qPCR) detection was performed on specific genes of corynebacteria in healthy control populations, the amounts of the genes were determined, and the probability of predicting bladder cancer by these genes was analyzed and verified. In view of the above research results, it is found that the detection of the corynebacteria specific genes can be used for developing a urine microorganism gene detection kit for bladder cancer patients, and provides a rapid and simple bladder cancer diagnosis product for a vast population.

Thus, in a typical embodiment of the application, there is provided the use of a urine microbial marker, which is a corynebacterium in urine, in the manufacture of a relevant test product for the detection of bladder cancer. According to the research result of the application, the strong correlation of corynebacteria in healthy people and bladder cancer patients is found, and the prediction probability is higher, so that the corynebacteria are used as a microbial marker in urine to prepare a detection product for detecting bladder cancer, and the method has the advantages of low cost and no wound.

The corynebacteria in urine is used as a microbial marker, can be used for developing various related detection products for detecting bladder cancer, and can be used for developing detection reagents, detection kits or detection chips and the like according to different requirements. Specific developments can be made around the specific molecules of the urine microbiota which the corynebacteria possess. Such as a specific gene sequence. In the present application, development is preferably performed around the gene sequence specific to the corynebacterium urine.

In a preferred embodiment, the urine biomarker is a specific sequence of corynebacterium. Specific sequences can be selected by sequence alignment, in particular by the sequence of 16S rDNA which is able to distinguish species classes. However, the sequence is not limited to 16S rDNA, and any sequence capable of specifically labeling Corynebacterium may be used for detection.

In the application, by sequencing the 16S rDNA of urine microorganisms of healthy people and bladder cancer patient people, the specific sequence (namely the sequence from SEQ ID NO:1 to SEQ ID NO: 5) of corynebacteria with relatively high sequence frequency is found in the sequencing result of bladder cancer samples. Thus, in a preferred embodiment of the application, the specific sequence is selected from any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5. These 5 sequences can be used as the detection targets for detecting bladder cancer or the basis for developing detection reagents. The frequency of detection of these 5 sequences in the analysis results (referred to herein as the number of specific sequences detected by 16s rDNA sequencing) is as follows: SEQ ID NO. 1 is 18,060; SEQ ID NO. 2 is 7,300; SEQ ID NO. 3 is 7,149; SEQ ID NO. 4 is 6,575; the method comprises the steps of carrying out a first treatment on the surface of the SEQ ID NO. 5 is 5,845. A more preferred specific sequence is SEQ ID NO. 1.

The detection frequency of the above 5 sequences is ranked as the first 5 among all the sequences of coryneform bacteria, and thus any one of these 5 sequences can specifically represent coryneform bacteria. According to the specific sequence selected in practical application, the corresponding detection primer can be designed for detection. Specifically, in designing a primer, the primer may be designed for a single one of the 5 sequences, or may be designed for two or more of the 5 sequences. In designing the primer, the primer is designed by referring to the principle and notice of the existing primer design. The sensitivity and the specificity of the detection of the specific primers can be confirmed by detecting and comparing the specific primers with the detection of the bladder cancer patient population and the healthy population.

In a preferred embodiment of the application, the detection product comprises a detection primer for detecting a specific sequence, in particular a detection primer for a specific sequence shown in SEQ ID NO. 1. Specific detection primers can be designed for the sequence in a variety of ways, such as, for example, detection primers including, but not limited to, any of the following primer pairs: (1) SEQ ID NO. 6 and SEQ ID NO. 7; (2) SEQ ID NO. 8 and SEQ ID NO. 9; (3) SEQ ID NO 10 and SEQ ID NO 11; (4) SEQ ID NO. 12 and SEQ ID NO. 7 and (5) SEQ ID NO. 13 and SEQ ID NO. 14. In the present application, the detection primer of the primer pair consisting of (4) SEQ ID NO. 12 and SEQ ID NO. 7 is preferable in terms of accuracy in prediction of bladder cancer.

In the above applications, the mentioned assays include one or more of diagnostic assays, progress monitoring and prognostic assays; preferably, the detection is performed by fluorescence quantitative PCR.

The screening of bladder cancer (or expansion to urinary system) by urine flora is limited to literature research, the number of reported articles is limited, and screening methods mentioned in the literature are all based on sequencing, the detection cost of the qPCR detection method (detection steps can be seen in the examples) used by the application is quite low, and 50 Yuan-people-coin per reaction. Moreover, the detection accuracy is relatively high. Taking the detection primer pair of the (1) as an example, the detection accuracy AUC is 0.898 (sensitivity and specificity are 87.5% and 81.2% respectively), which is obviously superior to the existing screening method (urine abscission cytology screening) in the clinic of bladder cancer.

In the above application, in addition to the development of the first-generation detection products by using corynebacteria and their specific sequences, new detection products can be further developed based on the first-generation detection products with reference to the first-generation detection products. I.e. preferably the above applications further comprise: screening or developing new detection products by taking the related detection products for detecting corynebacteria in urine as references.

Taking the specific sequence SEQ ID NO. 1 of corynebacterium as an example, the (4) pair detection primer pair is developed, and the detection result of the primer pair in the amplified urine sample to be detected can be used as a contrast to screen other potential markers capable of being used for detecting bladder cancer urine microorganisms.

As described above, the relevant detection products that can be developed using corynebacteria as a urine microorganism marker may be reagents, kits or chips.

In a second exemplary embodiment of the application, a kit or chip for detecting bladder cancer is provided, the kit or chip comprising reagents for detecting corynebacteria in urine.

In a preferred embodiment, the kit or chip comprises detection reagents for detecting a specific sequence of corynebacteria in urine; preferably, the specific sequence is selected from any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5. Most preferred is SEQ ID NO 1.

In another preferred embodiment, the detection reagent comprises a detection primer that detects a specific sequence, more preferably the detection primer is selected from any one of the following primer pairs: (1) SEQ ID NO. 6 and SEQ ID NO. 7; (2) SEQ ID NO. 8 and SEQ ID NO. 9; (3) SEQ ID NO 10 and SEQ ID NO 11; (4) SEQ ID NO. 12 and SEQ ID NO. 7 and (5) SEQ ID NO. 13 and SEQ ID NO. 14. Most preferably the (4) th pair.

To facilitate detection, in a preferred embodiment, the kit further comprises any one or more of the following: positive standard, PCR reaction related reagent, urine collector and DNA related reagent extracted from urine; preferably, the positive standard is a plasmid standard, more preferably the plasmid standard is a plasmid standard comprising the sequence shown in SEQ ID NO. 1, further preferably the plasmid standard is stored in dry powder form; preferably, the PCR reaction-related reagent is a fluorescent quantitative PCR reaction-related reagent; more preferably, the PCR reaction-related reagents include any one or more of the following: DNA polymerase, DNA polymerase buffer, dNTPs, fluorescent dye and optional deionized water; further preferably, the DNA polymerase, DNA polymerase buffer and dNTPs are present as a DNA polymerase premix, and the fluorescent dye is ROX Reference Dye; still more preferably, the DNA polymerase is selected from TAKARA SYBR Premix Ex Taq II.

The urine collector can be a collecting tube or a collecting cup, can be graduated or non-graduated, can be manual or automatic. The related reagent for DNA extraction in urine can adopt the existing DNA extraction kit or self-prepared DNA extraction solution.

The advantageous effects of the present application will be further described below in connection with specific examples.

Example 1 screening for urine microorganisms associated with bladder cancer

Sequencing analysis of 16S r DNA from urine flora of 46 bladder cancer patients and 47 healthy individuals showed that: the diversity and overall composition of the flora were significantly different between the two groups, and the genus of bacteria with significant abundance differences between the two groups was identified, wherein corynebacteria were strongly correlated with bladder cancer (see in particular fig. 1, wherein the ordinate represents the percentage of abundance of bacteria, P < 0.5 indicates significant differences between the two groups).

Based on the above correlation, 5 coryneform specific sequences having a relatively high detection frequency were selected (see Table 1 in detail), and the sequences of 16S r DNA of these 5 coryneform bacteria (SEQ ID NOS: 1 to 5) were selected as specific sequences for verification (see example 2).

Table 1: specific gene sequence for Corynebacterium screening

The detection frequencies of the 5 specific sequences are as follows: SEQ ID NO. 1 is 18,060; SEQ ID NO. 2 is 7,300; SEQ ID NO. 3 is 7,149; SEQ ID NO. 4 is 6,575; SEQ ID NO. 5 is 5,845.

Example 2 verification of the correlation of Corynebacterium specific sequences with bladder cancer

1. The verification method adopted by the embodiment is as follows: population expansion validation, pilot experiments used 23 bladder cancer patients and 24 healthy individuals to validate the screened specific sequences.

2. The preparation of raw materials comprises the following steps: designing and testing a primer; the order of the positive standard substance is as follows:

1) Primer design: primer design is carried out on specific sequences of specific flora obtained by screening by adopting oligo7 software, on the basis of meeting important principles as far as possible, the amplification products of upper and lower primers are required to be 70 bp-200 bp, 2-6 sets of primers are respectively designed for each gene, and the sequences of specific target genes SEQ ID NO. 1 and SEQ ID NO:4 and SEQ ID NO:5, the primer sequence SEQ ID NO:6-12; and aiming at a specific target gene sequence SEQ ID NO:2 and SEQ ID NO:3, the primer sequence SEQ ID NO:13 and SEQ ID NO:14.

2) Primer test: the primer test detects the band by common PCR amplification and agarose gel electrophoresis, and if the size of the target band is consistent with the expected size and the band is single, the primer specificity is good.

3) Order of positive standard: commercial companies synthesize the gene sequences of the specific bacteria provided by the application as positive standard substances; adding a certain amount of ultrapure water into the positive standard substance, quantifying by adopting Q-bit, and preserving at-20 ℃; when in use, the solution is further diluted to the concentration of the working solution in an equal gradient.

Table 2: 1 to SEQ ID NO:5, and a detection primer for a specific target gene sequence shown in the specification

qPCR experimental detection: and (4) carrying out reagent configuration and on-machine operation according to the existing flow. The method comprises the following specific steps:

qPCR was performed using urine DNA from 23 bladder cancer patients and urine DNA from 24 healthy individuals (reagent used: SYBR Premix Ex Taq (TM) II (Perfect Real Time) cat# DRR 081A).

The standard curve method is used in the example, the adopted standard substance is the sequence containing SEQ ID NO. 1, and the positive standard substance is the plasmid which clones the sequences on the vector, and is specifically synthesized by commercial company (Nanjing Jinsri company, standard vector pUC 57). Plasmid standard substances sent by commercial companies are dry powder, the dry powder is diluted after centrifugation, the concentration of the dry powder is measured and converted into corresponding copy numbers, then gradient dilution is carried out, and 6 gradients are diluted to be used as standard curves (the abscissa of the standard curves is the copy number, and the ordinate is the CT value).

The experimental specific operation steps are as follows:

1) Preparing a reaction solution: the primers, DNA templates, ROX Reference Dye and SYBR Premix Ex Taq II (brand: TAKARA; product number: RR 820A) were prepared as 10ul of reaction solution and added to a 96 well reaction plate as follows:

2) qPCR amplification: the 96-well plate was placed on a qPCR instrument (Applied Biosystems company) for amplification detection; the amplification procedure was: s1: pre-denaturation for 95-30 sec; s2: denaturation for 95-5 sec, annealing for 60-30 sec; s3: repeating S2 for 40 times; s4: maintained at 4 ℃.

3) Analysis data: using qPCR software (StepOne Software v 2.1) to derive a result, analyzing and mapping data according to quantitative results of qPCR by using R language, and drawing box plots (box plot) and ROC curves according to patients and healthy people;

specific results for each detection primer pair are shown in tables 3 to 6 below, and FIGS. 2A to 5B. Among them, table 3 and FIG. 2A and FIG. 2B show the results of detection of the Cor-F4/Cor-R4 primer pair. Table 4 and FIGS. 3A and 3B show the results of the detection of the Cor-F1/Cor-R1 primer pair. Table 5 and FIGS. 4A and 4B show the results of the detection of the Cor-F2/Cor-R2 primer pair. Table 6 and FIGS. 5A and 5B show the results of the detection of the Cor-F5/Cor-R5 primer pair. The PCR amplification of the primer pair Cor-F3/Cor-R3 was less specific and no specific data were presented here.

Table 3: when the primer used was Cor-F4/Cor-R4, qPCR detection results were obtained for 16 healthy persons and 16 patients.

Note that: in the table, "-" represents that the detection result is higher than the cut off value, and the judgment result is normal; and "+" represents that the detection result is lower than the cut off value, and the judgment result is that the patient has bladder cancer tumor.

Wherein, FIG. 2A is a box-shaped diagram showing the dispersion of two sets of data for a bladder cancer patient and a healthy person; the abscissa in the figure represents two populations of bladder cancer and healthy people, and the ordinate represents the degree of enrichment. 1) The lowest line of each bin represents the lower quartile; the middle line represents the median; the uppermost line represents the upper quartile; the larger the median difference between the two populations, the more widely the two populations are distinguished, and the higher the detection efficiency of the tumor marker. 2) Each point in the graph represents the QPCR detection result, and the corresponding value is further calculated.

FIG. 2B is a receiver operating characteristic curve (ROC curve) with specificity represented by the abscissa and sensitivity represented by the ordinate; the middle diagonal represents auc=0.5, and the AUC obtained in the graph is 0.898, which indicates that the tumor marker detection effect is better. The circled points in the figure are the points with the best sensitivity and specificity, the sensitivity and specificity are 87.5% and 81.2% respectively, the cut off value of the corresponding qPCR is 367.829 (the number (quality value) obtained by qPCR is smaller than or equal to the value, and the bladder cancer patient can be judged as normal when the number (quality value) obtained by qPCR is larger than the value, and the absolute value obtained by the standard curve is obtained.

Table 4: when the primer pair is Cor-F1/Cor-R1, qPCR detection results are carried out on 24 healthy people and 23 bladder cancer patients.

Note that: in the table, "-" represents that the detection result is higher than the cut off value, and the judgment result is normal; and "+" represents that the detection result is lower than the cut off value, and the judgment result is that the patient has bladder cancer tumor.

FIG. 3A shows a box plot of the primer pair Cor-F1/Cor-R1 for healthy persons and bladder cancer patients, where the median of the two groups is somewhat different than that of FIG. 2A.

Fig. 3B shows ROC curves with AUC 0.724 (the optimal points for sensitivity and specificity, 45.8% and 95.8%, respectively).

Table 5: qPCR detection results of 16 healthy people and 16 bladder cancer patients when the primer pair is Cor-F2/Cor-R2

Note that: in the table, "-" represents that the detection result is higher than the cut off value, and the judgment result is normal; and "+" represents that the detection result is lower than the cut off value, and the judgment result is that the patient has bladder cancer tumor.

FIG. 4A shows a box plot of the primer pair Cor-F2/Cor-R2 for healthy persons and bladder cancer patients, as can be seen from FIG. 4A, the median difference between the two groups is small. Fig. 4B shows the ROC curve with AUC of 0.520 (the optimal points for sensitivity and specificity, 43.8% and 81.2%, respectively).

Table 6: when the primer used was Cor-F5/Cor-R5, qPCR detection results were as follows for 16 normal persons and 16 bladder cancer patients:

note that: in the table, "-" represents that the detection result is higher than the cut off value, and the judgment result is normal; and "+" represents that the detection result is lower than the cut off value, and the judgment result is that the patient has bladder cancer tumor.

FIG. 5A shows a box plot of the detection of healthy and bladder cancer patients for the primer pair Cor-F5/Cor-R5. Fig. 5B shows the ROC curve with AUC of 0.612 (the optimal points for sensitivity and specificity, 40.3% and 82%, respectively).

4. Analysis and evaluation: these gene markers were calculated to predict the sensitivity and specificity of bladder cancer.

From the five primer pairs described above, SEQ ID NO:1 to SEQ ID NO:5, the sensitivity and the specificity of the qPCR amplification for predicting bladder cancer can be seen, and the 5 specific sequences can be used as specific gene sequences of corynebacteria for developing and utilizing detection products.

Further comparing the five pairs of designed primers shows that the detection specificity of the three pairs of primers to the healthy people and the bladder cancer patient group can reach more than 81 percent except that the Cor-F3/Cor-R3 has poor specificity due to qPCR amplification, so that the healthy people and the bladder cancer patient group can be distinguished to a certain extent, although the detection sensitivity has some difference. Wherein, the primer pair Cor-F4/Cor-R4 has the best detection effect and higher sensitivity and specificity.

As can be seen, in a preferred embodiment, the specific sequence of the corynebacteria shown in SEQ ID NO. 1 with the highest relative abundance is used as a microbial marker of bladder cancer in urine (any one, two or three of SEQ ID NO. 1, SEQ ID NO. 4 and SEQ ID NO. 5 can be used as microbial markers), and the AUC obtained by further calculating the number (quality value) of the detection of Cor-F4/Cor-R4 by qPCR by using the primer pair is 0.898 (the sensitivity and the specificity are 87.5% and 81.2%, respectively), so that the detection of corynebacteria in urine by using the specific sequence and the detection primer pair combination can be realized efficiently and noninvasively with low cost, and the detection effect is superior to that of the traditional abscission cell screening method.

From the above description, it can be seen that the above embodiments of the present application achieve the following technical effects: the bladder cancer is screened by using corynebacteria in urine microorganisms as markers and developing corresponding detection products such as corresponding detection primers, and the like, so that the method has the advantages of no wound, low cost, simple operation, high sensitivity and quick detection period.

The above description is only of the preferred embodiments of the present application and is not intended to limit the present application, but various modifications and variations can be made to the present application by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the protection scope of the present application.

Sequence listing

<110> Shenzhen Hua institute of great life science

<120> use of corynebacteria as urine microorganism markers in the preparation of related detection products for the detection of bladder cancer

<130> PN140274HDSM

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 320

<212> DNA

<213> corynebacteria (coreynebacterium)

<400> 1

tacgtagggt gcgagcgttg tccggaatta ctgggcgtaa agagctcgta ggtggtttgt 60

cgcgtcgtct gtgaaattcc ggggcttaac tccgggcgtg caggcgatac gggcataact 120

tgagtgctgt aggggagact ggaattcctg gtgtagcggt gaaatgcgca gatatcagga 180

ggaacaccga tggcgaaggc aggtctctgg gcagtaactg acgctgagga gcgaaagcat 240

gggtagcgaa caggattaga aaccccagta gtccaagtcg gaggccaagc gttagaagac 300

aaataaggca gtcaactcct 320

<210> 2

<211> 320

<212> DNA

<213> corynebacteria (coreynebacterium)

<400> 2

tacgtagggt gcgagcgttg tccggattta ctgggcgtaa agggctcgta ggtggtgtgt 60

tgcgtcgtct gtgtaatcca ggggcttaac ttttggttgg caggcgatac gggcattgct 120

tgagtgctgt aggggagact ggaattcctg gtgtagcggt gaaatgcgca gatatcagga 180

ggaacaccga tggcgaaggc aggtctctgg gcagttactg acgctgagga gcgagagcat 240

gggtagcgaa caggattaga taccccagta gtccaagtcg gaggcggtct taggaagaca 300

acatcatttt tcaactcctt 320

<210> 3

<211> 320

<212> DNA

<213> corynebacteria (coreynebacterium)

<400> 3

tacgtagggt gcgagcgttg tccggattta ctgggcgtaa agggctcgta ggtggtgtgt 60

tgcgtcgtct gtgtaatcca ggggcttaac ttttggttgg caggcgatac gggcattgct 120

tgagtgctgt aggggagact ggaattcctg gtgtagcggt gaaatgcgca gatatcagga 180

ggaacaccga tggcgaaggc aggtctctgg gcagttactg acgctgagga gcgagagcat 240

gggtagcgaa caggattaga aaccccagta gtccaagtcg gacagcggtc ttaggaagac 300

aatacaccag ttcaactcct 320

<210> 4

<211> 320

<212> DNA

<213> corynebacteria (coreynebacterium)

<400> 4

tacgtagggt gcgagcgttg tccggaatta ctgggcgtaa agagctcgta ggtggtttgt 60

cgcgtcgtct gtgaaattcc ggggcttaac tccgggcgtg caggcgatac gggcataact 120

tgagtgctgt aggggagact ggaattcctg gtgtagcggt gaaatgcgca gatatcagga 180

ggaacaccga tggcgaaggc aggtctctgg gcagttactg acgctgagga gcgaaagcat 240

gggtagcgaa caggattaga taccccagta gtccaagtcg gaggccaagc ttaggaagac 300

aagactcact gacaactcct 320

<210> 5

<211> 320

<212> DNA

<213> corynebacteria (coreynebacterium)

<400> 5

tacgtagggt gcgagcgttg tccggaatta ctgggcgtaa agggctcgta ggtggtttgt 60

cgcgtcgtct gtgaaattcc ggggcttaac tccgggcgtg caggcgatac gggcataact 120

tgagtactgt aggggtaact ggaattcctg gtgtagcggt gaaatgcgca gatatcagga 180

ggaacaccga tggcgaaggc aggttactgg gcagttactg acgctgagga gcgaaagcat 240

gggtagcgaa caggattaga aacccgagta gtccaagtcg gaccagcggt cttagggaga 300

caaggcatat tatcaactcc 320

<210> 6

<211> 24

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(24)

<223> Cor-F1

<400> 6

gcagatatca ggaggaacac cgat 24

<210> 7

<211> 24

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(24)

<223> Cor-R1/Cor-R4

<400> 7

taatcctgtt cgctacccat gctt 24

<210> 8

<211> 21

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(21)

<223> Cor-F2

<400> 8

cgcgtcgtct gtgaaattcc g 21

<210> 9

<211> 21

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(21)

<223> Cor-R2

<400> 9

cgcatttcac cgctacacca g 21

<210> 10

<211> 24

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(24)

<223> Cor-F3

<400> 10

atacgggcat aacttgagtg ctgt 24

<210> 11

<211> 22

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(22)

<223> Cor-R3

<400> 11

ttctaacgct tggcctccga ct 22

<210> 12

<211> 23

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(23)

<223> Cor-F4

<400> 12

atatcaggag gaacaccgat ggc 23

<210> 13

<211> 21

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(21)

<223> Cor-F5

<400> 13

ttgcgtcgtc tgtgtaatcc a 21

<210> 14

<211> 19

<212> DNA

<213> corynebacteria (coreynebacterium)

<220>

<221> misc_feature

<222> (1)..(19)

<223> Cor-R5

<400> 14

cgcatttcac cgctacacc 19

Claims (16)

1. A marker for detecting bladder cancer, wherein the marker is a urine microbial marker, the urine microbial marker is a specific sequence of corynebacteria, and the specific sequence is as follows: ATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCAGTAACTGACGCTGAGGAGCGAAAGCATGGGTAGCGAACAGGATTA.

2. Use of a detection reagent for a urine microbial marker, which is a specific sequence of corynebacteria, in the preparation of a related detection product for detecting bladder cancer, wherein the specific sequence is ATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCAGTAACTGACGCTGAGGAGCGAAAGCATGGGTAGCGAACAGGATTA.

3. The use according to claim 2, wherein the detection product comprises a detection primer for detecting the specific sequence, the detection primer being shown in SEQ ID NO. 12 and SEQ ID NO. 7.

4. The use according to claim 3, wherein the specific sequence is present within the target gene sequence shown in SEQ ID NO. 1.

5. The use of claim 2, wherein the detection comprises one or more of a diagnostic detection, a progression monitoring and a prognostic detection.

6. The use according to claim 2, wherein the detection is performed by means of fluorescent quantitative PCR.

7. The use according to any one of claims 2 to 6, wherein the relevant detection product is a kit.

8. A kit for detecting bladder cancer, comprising a detection primer for detecting a specific sequence of corynebacterium in urine, wherein the specific sequence is

ATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCAGTAACTGACGCTGAGGAGCGAAAGCATGGGTAGCGAACAGGATTA，

The detection primer is the following primer pair: SEQ ID NO. 12 and SEQ ID NO. 7.

9. The kit of claim 8, further comprising any one or more of the following: positive standard, PCR reaction related reagent, urine collector and related reagent for extracting DNA in urine.

10. The kit of claim 9, wherein the positive standard is a plasmid standard.

11. The kit according to claim 10, wherein the plasmid standard is a plasmid standard comprising the sequence shown in SEQ ID NO. 1.

12. The kit of claim 10, wherein the plasmid standard is stored as a dry powder.

13. The kit of claim 9, wherein the PCR reaction-related reagent is a fluorescent quantitative PCR reaction-related reagent.

14. The kit of claim 13, wherein,

the PCR reaction related reagent comprises any one or more of the following components: DNA polymerase, DNA polymerase buffer, dNTPs, fluorescent dye and optional deionized water.

15. The kit of claim 14, wherein,

the DNA polymerase, the DNA polymerase buffer solution and the dNTPs exist in the form of DNA polymerase premix, and the fluorescent dye is ROX Reference Dye.

16. The kit of claim 15, wherein,

the DNA polymerase is selected from SYBR Premix Ex Taq II of TAKARA.