CN110951871B

CN110951871B - PCA3 and PSA RNA detection kit and amplification system

Info

Publication number: CN110951871B
Application number: CN201911151087.1A
Authority: CN
Inventors: 张新; 胡守旺; 邓秀磊; 黄若磐
Original assignee: Reboo Guangzhou Biotechnology Co ltd
Current assignee: Reboo Guangzhou Biotechnology Co ltd
Priority date: 2019-11-21
Filing date: 2019-11-21
Publication date: 2024-01-05
Anticipated expiration: 2039-11-21
Also published as: CN110951871A

Abstract

The invention relates to a PCA3 and PSA gene detection kit and an amplification system, which comprise a primer and a fluorescent probe for the PCA3 and PSA genes, a Stoffel fragment and Tfl DNA polymerase, wherein the primer for the PCA3 genes is shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the fluorescent probe is shown as SEQ ID NO. 3; the primer for PSA gene is shown as SEQ ID NO.10 and SEQ ID NO.11, and the sequence of fluorescent probe is shown as SEQ ID NO. 12. The invention optimizes the real-time fluorescent quantitative RT-PCR detection and amplification system based on the existing kit. The primer and the probe with better detection effect are designed on the sequence on the exon 3 of the PCA3 gene selection, an optimized Tris-MOPS-sodium citrate buffer solution which is more suitable for RNA amplification is introduced into a reaction system, a Stoffel fragment or Tfl DNA polymerase is introduced, and the detection sensitivity and the specificity are improved, and meanwhile, more templates can be tolerated.

Description

PCA3 and PSA RNA detection kit and amplification system

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit and an amplification system for PCA3 and PSA (ribonucleic acid) in urine exosomes.

Background

Prostate Cancer (Prostate Cancer) is one of the most common male malignancies in developed Europe and America, and American Cancer society data in 2018 showed that: prostate cancer has a high incidence and is the first in the incidence of american male tumors and the second in mortality. In China, along with the continuous improvement of living standard and environmental change, the incidence rate of the prostate cancer is also increased year by year. About 60% of prostate cancer patients in China are early stage metastasis patients at the time of initial diagnosis, and the treatment effect and long-term survival of the prostate cancer patients in China are directly influenced. Since 2008, prostate cancer has become a malignant tumor with the highest incidence of urinary system, and the incidence of prostate cancer in China has larger urban and rural differences, especially in large cities. In 2009, the incidence rates of prostate cancer in Beijing, shanghai and Guangzhou reached 19.30/10 ten thousand, 32.23/10 ten thousand and 17.57/10 ten thousand respectively.

The early clinical diagnosis mode of the prostate cancer which is relatively accepted in the current academic circles is a three-step method: (1) suspicious cases were found by tumor marker examination such as blood Prostate Specific Antigen (PSA) and digital rectal examination. Due to the limited sensitivity and specificity of PSA, there are drawbacks of over-diagnosis of low risk prostate cancer and under-diagnosis of high grade prostate cancer. (2) Optionally, the positioning diagnosis of suspicious focus is completed by selecting imaging examination such as transrectal prostate ultrasound, multiparameter magnetic resonance scanning and the like. (3) Pathological diagnosis was obtained by TRUS-guided prostate system biopsy. As many as four out of five people with increased PSA after a needle biopsy are negative, even in true positives as many as half of the remaining life is unlikely to be problematic. Prostate puncture biopsy and treatment also present a risk: the biopsy has 0.6 to 4.1 percent of infection complications, and the estimated 20 to 70 percent of sexual function problems caused by radical prostate surgery and 5 to 50 percent of urination problems. The puncture biopsy has great physiological and psychological harm to patients, and currently, there is a foreign urine PCA3 molecular detection for determining whether repeated prostate puncture biopsy is needed. The long non-coding RNA prostate cancer antigen 3 (prostatecancer antigen, PCA 3) gene has been approved by the United states FDA as a marker for diagnosis of prostate cancer.

The new marker PCA3 of the prostate cancer is highly expressed in the prostate cancer and can reflect the progress of the prostate cancer. PCA3 is located on chromosome 9 and contains 4 exons, a non-coding mRNA, which produces at least four different transcripts by selective cleavage and polyadenylation. RT-PCR analysis showed that PCA3 was expressed only in prostate tissue and not in other tissues. PCA3 is overexpressed in 95% of all prostate cancers detected, can be harmlessly assayed from prostate cancerous cells, and is nearly 100% accurate. In addition, no PCA3 transcript has been detected in the extra-prostatic tissue (benign and malignant), proving that PCA3 is currently known to be the most specific PCa marker for prostate cancer. PCA3 is not affected by age, prostate volume, or other prostatosis. Northern blot analysis of 47 cases of PCA3 highly expressed in 50 cases of patients, whereas not expressed or lowly expressed in benign prostatic lesions. Comparing telomerase RNA to PCA3RNA as a marker for prostate cancer, PCA3 indicates better effect. PCA3 has been reported to be optimal for prostate cancer detection by using PCA3 exon 4 as a marker that is optimal for prostate cancer specificity so far, and contains 4 exons and three introns.

Exosomes (exosomes) are vesicles secreted by living cells from late endosomes (also called multivesicles), between 30-100nm in diameter, and 1.13-1.21g/ml in density. Exosomes derived from different tissue cells can exert different biological functions due to the different proteins carried. It has been found that exosomes contain the proteins rRNA, lncRNA and microRNA associated with the cell source and that exosomes are capable of transporting functional nucleic acid molecules between cells through biological barriers, thereby exerting various biological functions. Recent studies have shown that exosomes are the most important extracellular organelles of the tumor microenvironment, play a role in the development, progression and metastasis of tumors, and have clear clinical implications in tumor diagnosis.

Urine RNA exists in a form which is mainly divided into free RNA, protein-encapsulated protected RNA and RNA in vesicles. RNase is extremely abundant, free RNA is rapidly degraded, and the other two forms of RNA can be isolated and detected. Vesicles are largely divided into two classes, 500-1000nm microvesicles (mciroveside, the primary function being degradation) and 30-100nm exosomes (exosomes, the primary function being cellular communication), according to diameter.

PCA3RNA is specifically highly expressed in human prostate cancer cells and metastatic necrotic foci, and is not expressed or is under-expressed in normal prostate, benign prostatic hyperplasia cells. PSA is mainly synthesized by prostate cells, is not expressed or is underexpressed in other tissue cells, and PSA RNA represents the amount of prostate specific cells in the sample. The PCA3RNA expression quantity and the PSA RNA expression quantity in the urine exosomes are analyzed, effective cut-off values are counted, the probability of prostate puncture of a patient can be effectively judged, and the pain of the patient is relieved. The real-time fluorescence quantitative RT-PCR kit of PCA3 gene and PSA gene RNA originally developed by the applicant has good sensitivity, high specificity and repeated stability, but in practical application, the sensitivity is found to be unstable, which is possibly related to the fact that protein in urine is majority and the amount of target nucleic acid in exosomes is unstable, the applicant improves the detection method, introduces Stofel fragments or Tfl DNA polymerase, and introduces optimized Tris-MOPS-sodium citrate buffer more suitable for RNA amplification. Subsequent sample detection shows that the specificity is unstable while the sensitivity is increased. In view of the above, attempts have been made to improve the position and sequence of the primer and probe of the PCA3 gene based on the original detection method, and further develop a detection kit for the PCA3 gene and the PSA gene with good sensitivity and specificity.

Disclosure of Invention

The invention aims at providing a real-time fluorescent quantitative RT-PCR detection kit for PCA3 and PSA RNA in urine exosomes.

The technical scheme for achieving the purpose is as follows.

A PCA3 and PSA gene detection kit comprises primers and probes for PCA3 and PSA genes, stoffel fragments and Tfl DNA polymerase, wherein the primers for the PCA3 genes are shown as SEQ ID NO.1 and SEQ ID NO.2, and the probes are shown as SEQ ID NO. 3; the primers for the PSA gene are shown as SEQ ID NO.10 and SEQ ID NO.11, and the probes are shown as SEQ ID NO. 12.

In some embodiments, the kit further comprises a primer and a probe for the genome of the reference ACTB, wherein the primer for the reference ACTB gene is shown as SEQ ID NO.7 and SEQ ID NO.8, and the probe is shown as SEQ ID NO. 9.

In some of these embodiments, MMLV DNA polymerase is also included.

In some of these embodiments, the Tfl DNA polymerase and MMLV DNA polymerase and Stoffel fragment are used in an amount of 2±0.1U: 200+ -5U: 5 + -0.2U.

In some of these embodiments, tris-MOPS-sodium citrate buffer is also included.

In some of these embodiments, the primers and probes in the PCA3 and PSA gene detection kit of claim 1, and the Stofel fragment and Tfl DNA polymerase, MMLV DNA polymerase, and dNTP reagents are added to a conventional amplification buffer.

In some of these embodiments, the amount of Tfl DNA polymerase and MMLV DNA polymerase and Stoffel fragment in the amplification system is 2±0.1U: 200+ -5U: 5 + -0.2U.

In some embodiments, tris-MOPS-sodium citrate buffer is also included, wherein sodium citrate is at a concentration of 3+ -0.1 mM, tris solution is at a concentration of 66+ -0.5 mM, and MOPS solution is at a concentration of 18+ -0.5 mM.

In some embodiments, each of the primers is stored at a concentration of 20. Mu.M in an amount of 0.1. Mu.L.

In some embodiments, each probe is stored at a concentration of 100. Mu.M in an amount of 0.1. Mu.L.

The beneficial effects of the invention are as follows:

according to the detection method and the detection kit, the double polymerase of Stoffel fragments and Tfl DNA polymerase except MMLV DNA polymerase is introduced, and the specific primer probe group suitable for double polymerase amplification is designed and used for amplifying PCA3 and PSA RNA in urine exosomes respectively, so that other transcripts can not be amplified, and the specificity is high. The inventors have unexpectedly found that the PCA3 primer and probe set of the present invention is designed on exon 3 with higher sensitivity and specificity than exon 4. The amplification detection sensitivity on the exon 3 can reach 93%, the specificity can reach 85%, and the sensitivity on the exon 4 is 88%, and the specificity can reach 80%.

Meanwhile, the detection method also introduces an optimized Tris-MOPS-sodium citrate buffer solution which is more suitable for RNA amplification by the designed primer, so that the sensitivity and the specificity of detection are greatly improved.

Drawings

FIG. 1 is a schematic representation of the results of the precision experiments for PCA3 in example 3.

FIG. 2 is a schematic representation of the results of the experiments in example 3 with respect to PSA precision.

Fig. 3 is a schematic representation of the results of the sensitivity experiment for PCA3 in example 3.

Fig. 4 is a schematic diagram of the results of the experiment for PSA sensitivity in example 3.

Fig. 5 is a ROC curve of PCA3 score for sample detection in example 4.

Detailed Description

The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. The various chemicals commonly used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

In one aspect, the invention relates to a real-time fluorescent quantitative RT-PCR detection kit for PCA3 and PSA RNA, wherein the kit is introduced with a double polymerase amplification method of Stofel fragments and Tfl DNA polymerase except MMLV DNA polymerase. Wherein the Stoffel fragment is Taq DNA polymerase with the 5'-3' exonuclease activity domain removed, and the correction activity of a small amount of 3'-5' exonuclease is recovered while the 5'-3' exonuclease activity is removed, so that the defect of insufficient specificity of Tfl DNA polymerase is overcome. Whereas Tfl DNA polymerase provides 5'-3' exonuclease activity that cleaves the taqman probe. The detection specificity is improved, and more templates can be tolerated. On the other hand, the Stoffel fragments and Tfl DNA polymerase have strong inhibitor resistance, so that more templates can be added into the fluorescent RT-PCR kit constructed according to the invention, thereby being capable of improving sensitivity. Meanwhile, a primer and a probe for the PCA3 and PSA genes are designed, the primer for the PCA3 gene is shown as SEQ ID NO.1 and SEQ ID NO.2, and the probe is shown as SEQ ID NO. 3; the primers for the PSA gene are shown as SEQ ID NO.10 and SEQ ID NO.11, and the probes are shown as SEQ ID NO. 12. Thus, a high-sensitivity and high-specificity detection amplification system is formed.

The detection introduces the optimized Tris-MOPS-sodium citrate buffer solution which is more suitable for RNA amplification, so that the sensitivity and the specificity of the detection are greatly improved.

In the detection of PCA3 and PSA genes, a qualitative method can be performed, PCA3 score=1000/2 ^{(PCA3 Ct} ^{value-PSA Ct value} The expression quantity of PCA3RNA can be accurately quantified. PCA3 score is positively correlated with the likelihood of prostate cancer. A PCA3 score < 35 is less likely to be positive for prostate puncture, and if a PCA3 score > 35 is more likely to be positive for prostate puncture. Therefore, by noninvasively detecting PCA3 through urine, unnecessary prostate puncture of partial patients can be reduced, and pain of the patients can be relieved.

The effectiveness of extraction, purification and PCR amplification of exosome RNA is indicated by adding an internal reference gene ACTB into each reaction system. The RNA of a gene is detected through two different fluorescent channels, and the single-tube double quantification avoids the operation error when the single tube is used for single quantification.

The real-time fluorescence quantitative RT-PCR detection method and the kit for the PCA3 and the PSA RNA in the urine exosomes can realize rapid detection of target RNA in the urine exosomes, and are extremely convenient to apply.

The invention optimizes the real-time fluorescent quantitative RT-PCR detection and amplification system based on the existing kit. The primer and the probe with better detection effect are designed on the sequence on the exon 3 of the PCA3 gene selection, meanwhile, the optimized Tris-MOPS-sodium citrate buffer solution which is more suitable for RNA amplification is introduced into the reaction solution, the Stofel fragment or Tfl DNA polymerase is introduced, the detection specificity is improved, and more templates can be tolerated. The detection sensitivity of the optimized amplification system can reach 93 percent, and the specificity can reach 85 percent.

The present invention is further illustrated below in conjunction with specific examples, but is not intended to limit the scope of the present invention.

Example 1: PCA3 and PSA gene detection kit

Design of specific primers and probes:

(1) Primer groups and probes for detecting PCA3RNA designed for the RNA sequence on the PCA3 genome exon 3 have the following sequences:

forward primer Y21:5'-TTCCCCACAAGAATTTCAACGA-3' SEQ ID NO:1;

reverse primer Y22:5'-TCATCTAAAGCAATATAGCCCAT-3' SEQ ID NO:2;

fluorescent probe Y27:5'FAM-ACTAACCTGAATGCCTAGACCC-BHQ1-3' SEQ ID NO:3;

for the RNA sequence on exon 4 of the PCA3 genome, a primer set and a probe for detecting PCA3RNA are designed, and the sequences are as follows:

forward primer Y21-1:5'-GGAAGCACAGAGATCCCTGCGA-3' SEQ ID NO:4;

reverse primer Y22-1:5'-TAAAGCACAGGGCGAGGCTCAT-3' SEQ ID NO:5;

fluorescent probe Y27-1:5'FAM-ACT AGAAATGCCCGGCCGCCATC-BHQ1-3' SEQ ID NO:6;

(2) For the RNA sequence of the internal reference ACTB genome, a primer group and a probe for detecting the internal reference gene are designed, and the sequences are as follows:

forward primer Y25:5'-CAAATGCTTCTAGGCGGAC-3' SEQ ID NO:7;

reverse primer Y26:5'-AAACAAATAAAGCCATGCCAA-3' SEQ ID NO:8;

fluorescent probe Y28:5'JOE-ATGACTTAGTTGCGTTACACCCTT-BHQ1-3' SEQ ID NO:9;

(2) For PSA genomic RNA sequences, primer sets and probes for detecting PSA RNA were designed, the sequences of which are as follows:

forward primer Y23:5'-CTCAGGCCAGGTGATGACTCC-3' SEQ ID NO:10;

reverse primer Y24:5'-CATGACCTTCACAGCATCCGT-3' SEQ ID NO:11;

fluorescent probe Y29:5'FAM-CCTCATGCTGCTCCGCCTGTCAGA-BHQ1-3' SEQ ID NO:12.

Specimen collection and pretreatment:

the detection method and the kit are suitable for specimen types including urine samples, and the samples are collected from three courts in Guangzhou city.

Urine was collected after regular prostate massage. The urine collecting pipe is used for collecting not less than 10mL of urine according to the proposal of the manufacturer, and the urine sample can be immediately used for detection or stored at the temperature of 2-8 ℃ for not more than 24 hours; the food is not preserved at-20deg.C; the sample can be stored for six months at a temperature lower than-70deg.C, and repeated freezing and thawing is avoided.

And (3) placing the urine tube into a centrifugal machine for centrifugation, wherein the rotating speed is 1350+/-150 rcf, centrifuging for 10 minutes, taking the urine tube out of the centrifugal machine, transferring the supernatant urine into a 15mL centrifuge tube made of polypropylene material by using a new disposable pipette, and marking a sample number.

Extraction of urine exosomes and RNA:

nucleic acid extraction or purification kit using Guangzhou Ruibaobio-technology Co-Ltd, containing exosome separation reagent (Yue ear mechanical preparation 20181281)

Preparation of a cationic quality control product:

and synthesizing the amplified target fragment into a plasmid serving as a negative and positive quality control product.

ACTB gene fragment:

5’-CAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAACTTGCGCAGAAAACAAGATGAGA-3’(SEQ ID NO.13)

PCA3 gene exon 3 fragment:

5’-CTTCCCCACAAGAATTTCAACGACTCTCAAGTCTTTTCTTCCATCCCCACCACTAACCTGAATGCCTAGACCCTTATTTTTATTAATTTCCAATAGATGCTGCCT-3(SEQ ID NO.14)

PCA3 gene exon 4 fragment:

5’-GGAAGCACAGAGATCCCTGCGAGGACTAGAAATGCCCGGCCGCCATCTTGGGTCATCGATGAGCCTCGCCCTGTGCTTTA-3(SEQ ID NO.15)

PSA gene RNA fragment:

5’-CTCAGGCCAGGTGATGACTCCAGCCACGACCTCATGCTGCTCCGCCTGTCAGAGCCTGCC--3(SEQIDNO.16)

example 2:

fluorescent quantitative PCR amplification:

each test reaction system was formulated as follows, 50 μl system: 2.5. Mu.L of the enzyme mixture (set up experimental group and control group) and 17.5. Mu.L of PCR Mix (set up experimental group and control group) were subjected to instantaneous centrifugation, and 30. Mu.L of RNA to be detected was then added; positive and negative controls were also set up according to the above system, and 30 μl of positive or negative quality control was added for amplification.

The PCA3 PCR (experimental group) Mix was:

solution (Solution)	Working
		1M Tris-SO ₄ (pH9@25℃)	66mM
1M MOPS(pH7@25℃)	18mM
		Sodium citrate	3mM
2M(NH4) ₂ SO4	20mM
		1M MgSO4	7mM
Brij-35	0.10％
		30mg/mL acetylated BSA (3%)	0.1mg/mL
Y21(20μM)	0.1μl
		Y22(20μM)	0.1μl
Y27(100μM)	0.1μl
		Y25(100μM)	0.1μl
Y26(100μM)	0.1μl
		Y28(100μM)	0.1μl
dNTP(10mM)	1μl

The PSA PCR (experimental group) Mix is:

the enzyme mixture also comprises an experimental group and a control group

The PCA3 PCR (control group) Mix was:

the PSA PCR (control) Mix was:

Solution	Working
		1M Tris-Cl(pH9@25℃)	66mM
2M(NH4) ₂ SO4	20mM
		1M MgSO4	7mM
Brij-35	0.10％
		30mg/mL acetylated BSA (3%)	0.1mg/mL
Y23(20μM)	0.1μl
		Y24(20μM)	0.1μl
Y29(100μM)	0.1μl
		Y25(100μM)	0.1μl
Y26(100μM)	0.1μl
		Y28(100μM)	0.1μl
dNTP(10mM)	1μl

Each reaction tube was placed in a reaction tank of a quantitative PCR instrument (ABI 7500), the name and the type of fluorescent group of each detection were set (PCA 3 and PSA reporter group were set as FAM, internal reference group was JOE, and quencher group was none), and the circulation conditions were set:

result analysis and determination:

1. and (3) setting result analysis conditions: automatically storing the result after the reaction is finished, automatically analyzing the result by using instrument matched software, adjusting the Start value and End value of Baseline according to the analyzed image to be Threshold value (the user can adjust the Start value to be 2-8 and the End value to be 10-20 according to the actual situation,fluorescence Threshold (Threshold) setting principle is that a Threshold line just exceeds the highest point of a negative quality control amplification curve (irregular noise line), ct value is displayed as undet, analysis results are automatically obtained by clicking Analysis, result values are arranged and analyzed, and PCA3 score = 1000/2 is calculated ^(PCA3 ^{Ct value-PSA Ct value} PCA3 score was determined.

2. Quality control

A PCR reaction was verified to be effective if both negative and positive quality controls met the criteria set forth in the following table, and the patient sample was measured along with both negative and positive quality controls in the same PCR reaction. If either or both of the negative or positive quality control samples are not effective, the results of the patient samples cannot be analyzed, and the test is repeated for all patient samples.

Quality control product for verifying validity of PCR reaction

3. And (3) result judgment: on the premise that the numerical values of the negative quality control product and the positive quality control product are normal, the sample result is judged as follows:

if the Ct value of the internal standard channel of the sample to be detected is more than 38 or the Ct value of the PSA channel is more than 34, the sample is extracted again or the sample is extracted again and then is detected.

In the case where both PCR reaction solutions were effective and PSA was positive, ct values of PCA3 and PSA were substituted into the following formula to calculate

PCA3 score. PCA3 score = 1000/2 (PCA 3 Ct value-PSA Ct value)

4. Interpretation of results:

PCA3 scoring	Interpretation of	Result prompt
			＜35	Negative of	Less likelihood of positive prostate puncture
≥35	Positive and negative	The probability of positive prostate puncture is high

Test results:

10 urine specimens collected are extracted, and the pathological diagnosis is 2 healthy human samples and 8 prostate cancer samples. The extraction and quantification were performed as described above. Internal standard JOE channel Ct values>34, PSA FAM channel Ct values<38, the numerical results are valid. Ct values of prostate cancer patient samples>30, ct values of healthy human samples are all<30. The sample detection result meets the experimental requirements. Wherein the amplification effect of the primer probe set at the 3 position of the exon is better than that at the 4 position of the exon, which is selected by the PCA3 reaction system: the average difference is 1.5 Ct values, i.e., the amplification efficiency on exon 3 of the PCA3 gene is 2-4 times higher than on exon 4. PCR mix in which PSA reaction solution was compared with conventional Tris-HCl as buffer pair, optimized Tris-SO was used ₄ Buffer solution composed of MOPS and sodium citrate, and has higher sensitivity: the Ct phase difference after optimization is about 1, namely the amplification efficiency is increased by 1-2 times.

/>

Example 2: gene fragments were selected as positive references and diluted as shown in the following table.

The test groups and results are as follows:

/>

as can be seen from the above table analysis, when the sample size was 5. Mu.L, normal amplification was possible using Taq DNA polymerase and mmlv DNA polymerase (group 5);

when the sample size was increased to 30. Mu.L, amplification was not possible using Taq DNA polymerase and MMLV DNA polymerase alone (groups 2 and 4), whereas normal amplification was possible using Stoffel fragment, tfl DNA polymerase and MMLV DNA polymerase (groups 1 and 3); the kit is introduced with a double-polymerase amplification method of Stoffel fragments and Tfl DNA polymerase except MMLV DNA polymerase, so that a sample taking RNA as a template can be amplified more effectively.

Therefore, the primer probe on the exon 3 is matched with an optimized enzyme system and reaction liquid, and is more suitable for RNA amplification with different concentrations.

Example 3:

the synthesized RNA fragment mixture was diluted to a certain ratio according to the following table and used as a sample to be tested, and the sensitivity and precision of the PCA3 reaction solution and the PSA reaction solution were searched.

Detection results of precision reference:

detection results of precision reference: the precision reference prepared above is used for carrying out PCR reaction with the PCA3 reaction liquid and the PSA reaction liquid respectively, and the two tubes of the reaction liquid are respectively repeated for 10 holes, so that as shown in the figures 1 and 2, the Ct value of a detection channel (FAM) of the PCA3 reaction liquid is in the range of 31.10-31.46, the coefficient of variation (CV value) is 0.38 percent and within 5 percent, the repeatability is good, the Ct value of the detection channel (FAM) of the PSA reaction liquid is in the range of 31.12-31.63, the coefficient of variation (CV value) is 0.54 percent and within 5 percent, and the repeatability is good.

Detection results of sensitivity reference:

/>

results of sensitivity: the sensitivity reference is used for respectively carrying out PCR reaction with the PCA3 reaction liquid and the PSA reaction liquid, 20 holes are repeated, the result is shown in the figures 3 and 4, the Ct value of a detection channel (FAM) of the PCA3 reaction liquid is in the range of 33.60-35.39, the Ct value of a reference channel (JOE) is in the range of 27.79-28.63, the Ct value of the detection channel (FAM) of the PSA reaction liquid is in the range of 33.11-34.25, and the Ct value of the reference channel (JOE) is in the range of 28.12-28.71. The variation coefficients (CV values) of the FAM channel and the JOE channel of the reaction solution are within 5%, and the amplification repeatability is good.

Example 4: determination of PCA3 score positive judgment and sensitivity specificity comparison on exons 3 and 4

The ROC curve is a curve obtained by dividing a diagnosis experiment result into a plurality of critical points, taking sensitivity corresponding to each critical point as an ordinate and 1-specificity as an abscissa, and drawing the curve, wherein the optimal threshold value of detection is determined by selecting a point which is as close to the upper left of the curve as possible and combining with professional actual conditions, so that the ROC curve is an effective tool for comprehensively and accurately evaluating the diagnosis experiment.

In this embodiment, 200 clinical samples are detected in total, wherein 100 cases of positive samples and 100 cases of negative samples of prostate cancer are detected, FAM channel Ct values of PCA3 and PSA corresponding to 200 cases of clinical samples are substituted into a formula, PCA3 scores are calculated, possible PCA3 score tangential points are used as thresholds to calculate sensitivity and specificity, sensitivity is used as ordinate, 1-specificity is used as abscissa, a ROC curve is obtained by drawing, and a positive judgment value of PCA3 scores is found out through the ROC curve.

PCA3 score = 1000/2 ^{(PCA 3 Ct value-PSA Ct value)} The expression quantity of PCA3RNA can be accurately quantified. PCA3 score is positively correlated with the likelihood of prostate cancer.

Amplification results corresponding to exon 3: a PCA3 score < 35 is less likely to be positive for prostate puncture, and if a PCA3 score > 35 is more likely to be positive for prostate puncture.

Sensitivity and specificity of amplified sample PCA3 scoring at exon 3 for different thresholds

/>

Referring to the above table and FIG. 5, the amplification result on exon 3 should be based on ROC principle, the point closest to the upper left corner should be taken as the critical point, the PCA3 score of the corresponding point of the ROC curve is 35, the detection sensitivity is 93%, the specificity is 85% and the about dengue index is the maximum when the PCA3 score is 35.

Sensitivity and specificity of amplified sample PCA3 scoring at exon 4 for different thresholds

/>

As a result of amplification on exon 4, the point closest to the upper left corner should be taken as the critical point according to the ROC principle, the PCA3 score at the point corresponding to this ROC curve is 40, and when the PCA3 score is 40, the detection sensitivity is 88%, the specificity is 80%, and the about dengue index is the maximum.

Therefore, the primer/probe on the selected exon 3 of the kit is matched with the corresponding enzyme system and reaction liquid, so that the kit has better amplification efficiency, and the interpretation requirements are as follows: and judging that the PCA3 score is less than 35 and is negative, and judging that the PCA3 score is more than or equal to 35 and is positive. The amplification sensitivity was 93% and the specificity was 85%.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Sequence listing

<110> Guangzhou Rebauo biotechnology Co., ltd

<120> PCA3 and PSA RNA detection kit and amplification System in urine exosomes

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ttccccacaa gaatttcaac ga 22

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tcatctaaag caatatagcc cat 23

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

actaacctga atgcctagac cc 22

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ggaagcacag agatccctgc ga 22

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

taaagcacag ggcgaggctc at 22

<210> 6

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

actagaaatg cccggccgcc atc 23

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

caaatgcttc taggcggac 19

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

aaacaaataa agccatgcca a 21

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

atgacttagt tgcgttacac cctt 24

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ctcaggccag gtgatgactc c 21

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

catgaccttc acagcatccg t 21

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

cctcatgctg ctccgcctgt caga 24

<210> 13

<211> 83

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

caaatgcttc taggcggact atgacttagt tgcgttacac cctttcttga caaaacctaa 60

cttgcgcaga aaacaagatg aga 83

<210> 14

<211> 105

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

cttccccaca agaatttcaa cgactctcaa gtcttttctt ccatccccac cactaacctg 60

aatgcctaga cccttatttt tattaatttc caatagatgc tgcct 105

<210> 15

<211> 80

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

ggaagcacag agatccctgc gaggactaga aatgcccggc cgccatcttg ggtcatcgat 60

gagcctcgcc ctgtgcttta 80

<210> 16

<211> 60

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

ctcaggccag gtgatgactc cagccacgac ctcatgctgc tccgcctgtc agagcctgcc 60

Claims

1. The PCA3 and PSA gene detection kit is characterized by comprising a primer and a fluorescent probe for PCA3 and PSA genes, stofel fragments, tfl DNA polymerase and MMLV DNA polymerase, wherein the sequence of the primer for the PCA3 genes is shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the fluorescent probe is shown as SEQ ID NO. 3; the sequences of the primers for the PSA gene are shown as SEQ ID NO.10 and SEQ ID NO.11, and the sequences of the fluorescent probes are shown as SEQ ID NO. 12;

the kit also comprises Tris-MOPS-sodium citrate buffer solution;

the amounts of Tfl DNA polymerase and MMLV DNA polymerase and Stoffel fragment were 2±0.1U: 200+ -5U: 5 + -0.2U.

2. The PCA3 and PSA gene detection kit according to claim 1, further comprising a primer and a fluorescent probe for reference gene ACTB, wherein the sequence of the primer for reference gene ACTB is shown as SEQ ID NO.7 and SEQ ID NO.8, and the sequence of the fluorescent probe is shown as SEQ ID NO. 9.

3. The PCA3 and PSA gene detection kit according to claim 1, wherein the amount of Tfl DNA polymerase and MMLV DNA polymerase and Stoffel fragment is 2U:200U:5U.

4. The PCA3 and PSA gene detection kit of claim 1, wherein the Tris-MOPS-sodium citrate buffer has a sodium citrate concentration of 3±0.1mM, tris solution has a concentration of 66±0.5mM, and MOPS solution has a concentration of 18±0.5mM.

5. The PCA3 and PSA gene detection kit according to any of the claims 1-4, wherein the storage concentration of each primer is 20 μm and the amount is 0.1 μl.

6. The PCA3 and PSA gene detection kit according to claim 5, wherein the storage concentration of each probe is 100 μΜ and the dosage is 0.1 μΜ.