CN109457033B

CN109457033B - Marker for colon cancer screening

Info

Publication number: CN109457033B
Application number: CN201811641665.5A
Authority: CN
Inventors: 姜书梅; 司峻岭; 王仁本
Original assignee: Shandong Institute of Cancer Prevention and Treatment
Current assignee: Shandong Institute of Cancer Prevention and Treatment
Priority date: 2018-12-29
Filing date: 2018-12-29
Publication date: 2020-03-10
Anticipated expiration: 2038-12-29
Also published as: CN109457033A

Abstract

The invention discloses a marker for colon cancer screening, and belongs to the field of molecular diagnosis. The invention develops new molecular markers hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569 for colon cancer screening and diagnosis, the diagnostic value of single circRNA of the markers is high, and ROC curve analysis shows that the markers can better distinguish colon cancer patients and have good sensitivity and specificity; the expression profile of the molecular marker formed by combining 3 circRNAs has higher diagnostic efficiency in the aspect of diagnosing colon cancer than that of a single circRNA molecule, and is expected to become an important index applied to clinical diagnosis and evaluation of colon cancer.

Description

Marker for colon cancer screening

Technical Field

The invention belongs to the technical field of biomedicine and molecular biology, particularly relates to the field of clinical screening of colon cancer, and more particularly relates to a newly discovered marker for screening of colon cancer and a molecular kit for screening of colon cancer.

Background

It should be noted that this section is only a reference and background of the invention design section and does not necessarily constitute a disclosure of prior art relative to the present invention.

The colon cancer is one of main malignant tumors of a digestive system, and in recent years, with the improvement of living standard of people in China, the change of dietary structure and the aggravation of aging of population, the incidence of the colon cancer in China tends to rise year by year, thus seriously threatening the health of people. Although the etiology of colon cancer is not completely understood, some factors such as environment, dietary structure, living habits (drinking and smoking) and the like may induce colon cancer, and familial polyps, ulcerative colitis, familial tumor genetic history and the like are also high-risk factors for colon cancer.

The survival and prognosis of colon cancer patients depend on the detection time of tumors, the early stage of colon cancer has no specific symptoms, and the patients have low consciousness due to physical examination and timely diagnosis, so that part of colon cancer is discovered to be in the later stage, great difficulty is brought to treatment, and the prognosis is relatively poor. Data statistics show that over 57% of patients have metastasized cancer cells when diagnosed, while 5-year survival rates for early stage colon cancer patients can reach 90%, but 5-year overall survival rates for late stage and metastatic patients are only 15%. In order to improve the survival rate of colon cancer patients, research is clinically carried out to establish a diagnosis method and a diagnosis standard of early colon cancer, and currently, colon cancer diagnosis mainly depends on enteroscopy, imaging, stool occult blood and other examinations, but corresponding convenience, sensitivity and specificity are still lacked.

With the rapid development of molecular biology technology and the continuous and deep research of colorectal cancer mechanism, more and more related biomarkers are continuously discovered and reported. From the research progress of non-coding RNA, some miRNA, lncRNA and circRNA have application prospects as disease biomarkers. Circular RNA (circular rRNA) is a single-stranded non-coding RNA which is widely present in organisms, is originally found in RNA viruses of 70 years in the 20 th century, and is different from the traditional linear RNA, circular RNA molecules are in a closed circular structure, are not influenced by RNA exonuclease, are more stable in expression and are not easy to degrade; functionally, the circRNA molecules are rich in microRNA binding sites and play a role of miRNA sponge in cells, so that the inhibition effect of miRNA on target genes of the circRNA molecules is relieved, and the expression level of the target genes is increased; circRNA plays an important regulatory role in disease through the interaction with disease-associated mirnas.

Various circrnas have also been found to be associated with colon cancer. Weng W et al analyzed the effect of cirS-7 expression on prognosis in two independent groups of colorectal cancer patients, and found that high cirS-7 expression was associated with overall low survival; dou Y et al studied the relationship between KRAS mutations and colon cancer cells and found that circRTN4 is expressed at a high level in exosomes of colon cancer cell DLD-1 and is down-regulated in cells; in addition, circ-ITCH, hsa _ circ _0014717, circHIPK3, circCCDC66, hsa _ circ _0001649, circ-KLDHC10, hsa _ circ _0000567, hsa _ circ _000984, circRNA0003906, has _ circ _0020397, circCCDC66, hsa _ circ _0000069, hsa _ circ _001569, hsa _ circ _001988, circ-BANP, hsa _ circRNA _103809, hsa _ circRNA _104700, hsa _ circ _0126897, etc. have also been found to be involved in the development of colon cancer, in invasive metastasis processes, as a prognostic marker or in affecting chemoradiotherapy of colon cancer, etc. However, for screening and detecting colon cancer, new effective markers need to be further explored, and the specificity and accuracy of the markers need to be explored.

Disclosure of Invention

Based on the above, the invention obtains the circRNA marker for colon cancer screening through research, and develops related products for colon cancer screening based on the circRNA marker.

Specifically, the invention discloses the following technical scheme:

firstly, the invention discloses application of one or a combination of several of hsa _ circ _0036847, hsa _ circ _0064628 and hsa _ circ _0086569 as a marker in preparing a product for colon cancer screening.

Secondly, the present invention discloses a product for colon cancer screening, which can screen colon cancer by detecting the expression level of hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569 in colon tissue of a patient, and the detection result shows that the expression of hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569 is significantly up-regulated compared with normal tissue.

Further, the invention discloses a fluorescent quantitative PCR primer set of the circRNA marker for colon cancer screening, wherein the primer set is used for amplifying hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569 respectively.

In addition, the invention also discloses a colon cancer screening method, which judges the risk of suffering colon cancer by the relative expression of hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _ 0086569.

Furthermore, the invention also provides the application of one or more of hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569 in preparing a medicine for prognosis or treatment of colon cancer.

Based on the technical scheme of the invention, the invention at least obtains the following technical effects:

(1) the invention develops a new molecular marker hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569 for colon cancer screening and diagnosis, and provides a new reference for colon cancer screening;

(2) in the markers hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569, the diagnostic value of single circRNA is high, ROC curve analysis shows that the markers can well distinguish and screen colon cancer patients, the areas under the curves of the markers, hsa _ circ _0036847, hsa _ circ _0064628 and hsa _ circ _0086569 are 0.906, 0.853 and 0.961 respectively, and the markers have good sensitivity and specificity; furthermore, the expression profile of the molecular marker formed by combining 3 circRNAs has higher diagnosis efficiency in the aspect of colon cancer diagnosis than that of a single circRNA molecule, and is expected to become an important index applied to clinical diagnosis and evaluation of colon cancer.

Drawings

FIG. 1 is a functional annotation of hsa _ circ _0036847 in the parental gene

FIG. 2 is a functional annotation of hsa _ circ _0064628 in the parental gene

FIG. 3 is a functional annotation of hsa _ circ _0086569 in the parental gene

FIG. 4 is a graph showing the statistics of the relative expression amounts of hsa _ circ _0036847 in normal tissues and colon cancer tissues

FIG. 5 is a graph showing the statistics of the relative expression amounts of hsa _ circ _0064628 in normal tissues and colon cancer tissues

FIG. 6 is a graph showing the statistics of the relative expression amounts of hsa _ circ _0086569 in normal tissues and colon cancer tissues

FIG. 7 is a ROC curve for hsa _ circ _0036847 for diagnostics

FIG. 8 is a ROC curve for hsa _ circ _0064628 for diagnostics

FIG. 9 is a ROC curve for hsa _ circ _0086569 for diagnostics

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments according to the present disclosure. Furthermore, it will be further understood that the terms "comprises" and/or "comprising," when used in this specification, specify the presence of stated features, steps, operations, and/or combinations thereof.

In one or some exemplary embodiments disclosed herein, the application of one or more combinations of hsa _ circ _0036847, hsa _ circ _0064628 and hsa _ circ _0086569 as a marker in the preparation of a product for colon cancer screening is disclosed.

The sequence of hsa _ circ _0036847 is shown as SEQ ID NO:1 (spaliced SEQ), the position in the genome is chr15:91083270-91157720, and the functional annotation in the parent gene is shown in FIG. 1;

the sequence of hsa _ circ _0064628 is shown as SEQ ID NO. 2, the position in the genome is chr3:28373179-28382113, and the functional annotation of the hsa _ circ _0064628 in the parent gene is shown in FIG. 2;

the sequence of hsa _ circ _0086569 is shown in SEQ ID NO 3, the position in the genome is chr9: 20923658-.

In particular embodiments, the product for colon cancer screening comprises a reagent or drug that detects the expression level of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 in colon tissue of a patient.

In some typical embodiments, the product for colon cancer screening comprises: products for diagnosis of colon cancer were tested for expression levels of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 by real-time quantitative PCR, in situ hybridization, gene chip, or gene sequencing.

In one or more exemplary embodiments disclosed herein, a product for colon cancer screening is disclosed, which is capable of screening colon cancer by detecting the expression level of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 in colon tissue of a patient, the detection result showing that hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 expression is significantly up-regulated compared to normal tissue.

In colon cancer patients, with colon polyps, the incidence of colon cancer is typically 5 times that of patients without colon polyps, and in particular embodiments of the invention, the colon tissue of the patient may be selected from colon polyps or other tissues (e.g., colon epithelial cells, etc.).

In a specific embodiment of the invention, a fluorescent quantitative PCR primer set for a circRNA marker for colon cancer screening is disclosed for amplifying hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569, respectively.

In a specific embodiment, the primer set sequences used for amplification of hsa _ circ _0036847 include SEQ ID NO 4 and SEQ ID NO 5; the primer set sequences for amplification of hsa _ circ _0064628 include SEQ ID NO 6 and SEQ ID NO 7; the primer set sequences for amplification of hsa _ circ _0086569 included SEQ ID NO 8 and SEQ ID NO 9.

In a specific embodiment of the invention, a kit of the circRNA marker for colon cancer screening is disclosed, which comprises the fluorescent quantitative PCR primer set.

In specific embodiments, a primer set for amplifying an internal reference gene can be specifically included, for example, the internal reference gene can be GAPDH; the primer set sequences for amplifying GAPDH include SEQ ID NO 10 and SEQ ID NO 11.

In one or more exemplary embodiments disclosed herein, a method for screening colon cancer is disclosed, wherein the relative expression level of hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569 is used to determine the risk of colon cancer.

In one embodiment of the invention, colon cancer is screened by detecting the expression level of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 in colon tissue of a patient, wherein the detection result shows that hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 expression is significantly up-regulated compared to normal tissue, indicating the presence of colon cancer.

In one or more exemplary embodiments disclosed herein, the difference in the relative expression level of the circRNA in colon cancer tissue is also related to prognosis or treatment of colon cancer patients, and thus the invention also discloses the use of one or more combinations of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 in the preparation of a product for prognosis or treatment of colon cancer.

In some exemplary embodiments, the colon cancer prognosis or treatment product comprises: products with expression levels of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 were detected by real-time quantitative PCR, in situ hybridization, gene chip, or gene sequencing.

In order to clearly show the technical solutions disclosed in the present invention, the following detailed description of the embodiments and technical contents will be provided in conjunction with specific examples.

Examples

According to the invention, based on the early stage of a subject group, through colon cancer screening, RNA-seq deep sequencing research between a few cases of colon cancer patient tissues and paracarcinoma tissues (normal tissues) is selected, and a plurality of groups of novel circular RNA molecules with high expression and good difference are screened out for screening, verification and analysis. The invention selects hsa _ circ _0036847, hsa _ circ _0064628 and hsa _ circ _0086569, and the research on the expression condition between the tissues of a colon cancer patient and normal tissues is combined with statistical analysis and verification to be used for screening the colon cancer.

Study subject and sample

60 colon cancer patients collected in Shandong tumor hospitals from 2017 to 2018 in 5 are selected, wherein 36 male patients and 24 female patients are confirmed to be diagnosed through pathological examination, and the judgment of histopathological types refers to WHO pathological staging; colon cancer tissue and tissue samples adjacent to the cancer are obtained and stored by appropriate methods (to avoid RNA degradation).

RNA extraction

Taking cancer tissues/tissues beside cancer, grinding by adopting a liquid nitrogen method, transferring into a centrifugal tube of 1.5ml, using 750 ul of TRIzol LS Reagent and 20 ul of glacial acetic acid, and manually and violently shaking the tube body until the tube body is mixed evenly.

After homogenization the sample is incubated for 5 minutes at 15 to 30 ℃.

0.2ml of chloroform was added to 750. mu.l of the sample homogenized with TRIzol LS Reagent.

After shaking the tube vigorously by hand for 15 seconds, incubation was carried out for 2-3 minutes at 15 to 30 ℃.

Centrifugation was carried out at 12000 Xg for 15 minutes at 4 ℃. After centrifugation, the mixed liquid was separated into a lower red phenol chloroform phase, an intermediate layer and an upper colorless aqueous phase. The RNA was partitioned in the aqueous phase in its entirety.

The aqueous phase was transferred to a fresh centrifuge tube. 0.5ml of isopropanol (1ml of TRIZOL reagent) was added, and the aqueous phase was mixed with isopropanol to precipitate RNA therein.

After mixing, incubation was carried out at 15 to 30 ℃ for 10 minutes, and centrifugation was carried out at 12000 Xg at 4 ℃ for 10 minutes.

The supernatant was removed and at least 1ml of 75% ethanol was added to each 1ml sample of TRIZOL reagent homogenate to wash the RNA pellet. After shaking, the cells were centrifuged at 7500 Xg for 5 minutes at 4 ℃.

The ethanol solution was removed and the RNA pellet was air dried for 5-10 minutes. The A260/280 ratio of the partially lysed RNA sample will be less than 1.6. When RNA was dissolved, RNase-free water was added and the mixture was repeatedly blown with a gun several times, followed by incubation at 55 to 60 ℃ for 10 minutes.

The RNA solution obtained was stored at-70 ℃.

cDNA Synthesis

The PCR tube was equipped with: RNA 1-2. mu.g, 0.5. mu.g/. mu. l N6 (random primer) 1. mu.l, dNTPs Mix (10mM) 1. mu.l, plus RNase-free H₂O to a total volume of 13.7 μ l; the mixture was incubated at 70 ℃ for 5 minutes and then placed in a quick ice bath for 2 minutes.

Preparing a reverse transcription system, sequentially adding 4 mu l of RT reaction liquid 5 XFirst-Strand Buffer, 1 mu l of 0.1M DTT, 0.3 mu l of RNase Ihibitor and 1 mu l of SuperScript III RT into a centrifuge tube, carrying out reverse transcription, carrying out reaction at 42 ℃ for 1h and 70 ℃ for 20min, and storing cDNA in an ice bath or placing at-20 ℃.

Real-time fluorescent quantitative PCR

Realtime PCR reaction system. The system configuration is shown in Table 1, and the primer sets used are shown in Table 2.

TABLE 1 Realtime PCR reaction System

TABLE 2 real-time fluorescent quantitative PCR primers

The PCR plate was placed on a Realtime PCR instrument for PCR reaction. All the indexes were carried out according to the following procedures: at 95 ℃ for 10 min; 40 PCR cycles (95 ℃, 10 sec; 60 ℃, 30 sec). In order to establish a melting curve of a PCR product, after the amplification reaction is finished, the temperature is 95 ℃ for 10 seconds; 30 seconds at 60 ℃; the procedure was carried out at 95 ℃ for 15 seconds; GAPDH was used as an internal control. Use 2^-△△CtAnd (4) calculating.

Statistics and results analysis

Statistical analysis was performed using SPSS 17.0 and GraphPad Prism 5(San Diego, Calif.). The Student t-test was used to analyze the differences between the two groups. One-way anova was used between circRNA and clinical and pathological factors. Receiver operating characteristic curve (ROC) analysis was used to determine the diagnostic value of circ RNA using pathologically-reported surgically excised colon cancer tissues as gold standards. P <0.05 was considered statistically significant.

TABLE 3 analysis of the relationship between three circRNA and colon cancer patient clinical case parameters

According to statistical analysis, the expression levels of hsa _ circ _0036847 and hsa _ circ _0086569 were correlated with cancer tissue differentiation, and 3 circRNA expression was independent of sex, age, tumor size, lymphatic metastasis status, and TNM stage (no difference between groups).

Real-time quantitative PCR data showed that the expression of 3 circRNAs (hsa _ circ _0036847, hsa _ circ _0064628, hsa _ circ _0086569) was significantly up-regulated in colon cancer tissues compared to normal tissues in samples collected by the present invention, see FIG. 4-FIG. 6(P < 0.05).

The diagnostic performance of differentially expressed circRNA was tested by ROC curve analysis and calculation of the area under the receiver operating characteristic curve (AUC). The AUCs for hsa _ circ _0036847, hsa _ circ _0064628, and hsa _ circ _0086569 were 0.906, 0.853, and 0.961, respectively, and 95% CI was 0.853-0.971, 0.677-0.912, and 0.901-0.988, respectively (FIGS. 7-9). The results show that 3 circRNAs can be used as the marker for colon cancer diagnosis.

The expression profile AUC of the molecular marker formed by combining 3 circRNAs is 0.975, the diagnosis efficiency of the molecular marker for colon cancer is higher, and in addition, the molecular marker can be combined with colon radiography which is commonly used in clinic to further improve the early screening and prevention efficiency of colon cancer.

The above embodiments are preferred embodiments of the present disclosure, but the embodiments of the present disclosure are not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present disclosure should be regarded as equivalent replacements within the scope of the present disclosure.

SEQUENCE LISTING

<110> Shandong province tumor prevention and treatment research institute (Shandong province tumor hospital)

<120> marker for colon cancer screening

<130>

<160>11

<170>PatentIn version 3.5

<210>1

<211>481

<212>DNA

<213>hsa_circ_0036847

<400>1

gttcaatttc agaagcttca gcaactgcgc cttacacagt accatggagg atccttacca 60

aatgtgagcc agctgcggag cagtgcgtca gagtttcagc cgtcatttca ccaagctgat 120

aatgttcggg gaacccgcca tcacgggctg gtggagaggc catccaggaa ccgcttccac 180

cccctccacc gaaggtctgg ggacaagcca gggcgacaat ttgatggtag tgcttttgga 240

gccaattatt cctcacagcc tctggatgag agttggccaa ggcagcagcc tccttggaaa 300

gacgaaaagc atcctgggtt caggctgaca tctgcactta acaggaccaa ttctgattct 360

gctcttcaca cgagtgctct gagtaccaag ccccaggacc cctatggagg agggggccag 420

tcggcctggc ctgccccata catgggtttc tgtgatggtg agaataatgg acatggggaa 480

g 481

<210>2

<211>918

<212>DNA

<213>hsa_circ_0064628

<400>2

ttgtcatgga tgcactggta gaagatgata tctgtattct gaatcatgaa aaagcccata 60

agagagatac agtgactcca gtttcaatat attcaggaga tgaatctgtt gcttcccatt 120

ttgctcttgt cactgcatat gaagacatca aaaaacgact taaggattca gagaaagaga 180

actctttgtt aaagaagaga ataagatttt tggaagaaaa gctaatagct cgatttgaag 240

aagaaacaag ttccgtggga cgagaacaag taaataaggc ctatcatgca tatcgagagg 300

tttgcattga tagagataat ttgaagagca aactggacaa aatgaataaa gacaactctg 360

aatctttgaa agtattgaat gagcagctac aatctaaaga agtagaactc ctccagctga 420

ggacagaggt ggaaactcag caggtgatga ggaatttaaa tccaccttca tcaaactggg 480

aggtggaaaa gttgagctgt gacctgaaga tccatggttt ggaacaagag ctggaactga 540

tgaggaaaga atgtagcgat ctcaaaatag aactacagaa agccaaacaa acggatccat 600

atcaggaaga caatctgaag agcagagatc tccaaaaact aagcatttca agacagagta 660

tctgtagcac agcctggagt gcagtggcgc aatcatggga tagcatgaat tttgaggact 720

gttccctctt cgcataagaa tagaagtagc catcagagtt catatacttt ttcaaccctt 780

tttcctcaaa tacgtatcat ttttacttaa gtaacttcaa ttctgtgttt taagctatct 840

aataattgtt gtttctacta tgttaagata gcctctctac attgttaccc tccatccaat 900

aaaaaatact gatctgac 918

<210>3

<211>226

<212>DNA

<213>hsa_circ_0086569

<400>3

ggagagtccggtagtgaaag gcaatgcgct gttagctcta agcagccttg ctgtcgtcgt 60

atctagacat gaagccagcc tctcctcaga ctctgacggg ctcctggagg ttcaacctaa 120

tttcctttca atgaaagagt gggtttccat ggtacttgat acactcttgg tcattgtgga 180

tagccattac caacccagag ggcaacttct ctcctggttt tattat 226

<210>4

<211>20

<212>DNA

<213> primer

<400>4

agacgaaaag catcctgggt 20

<210>5

<211>21

<212>DNA

<213> primer

<400>5

tctgaaattg aaccttcccc a 21

<210>6

<211>23

<212>DNA

<213> primer

<400>6

tctacattgt taccctccat cca 23

<210>7

<211>21

<212>DNA

<213> primer

<400>7

gcagtgacaa gagcaaaatg g 21

<210>8

<211>21

<212>DNA

<213> primer

<400>8

ggatagccat taccaaccca g 21

<210>9

<211>18

<212>DNA

<213> primer

<400>9

ggagcccgtc agagtctg 18

<210>10

<211>20

<212>DNA

<213> primer

<400>10

ctcacagttg ccatgtagac 20

<210>11

<211>18

<212>DNA

<213> primer

<400>11

gctcaattta tagaaacc 18

Claims

Use of one or a combination of several of hsa _ circ _0036847, hsa _ circ _0064628 and hsa _ circ _0086569 as a marker in the preparation of a product for colon cancer screening;

the product for colon cancer screening comprises a reagent or drug that detects the expression level of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 in colon tissue of a patient;

a product for colon cancer screening, which is capable of screening for colon cancer by detecting the expression level of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 in colon tissue of a patient, the detection result showing that hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569 expression is significantly up-regulated compared to normal tissue;

the patient's colon tissue is selected from colonic polyps.
2. The use according to claim 1, wherein the product for colon cancer screening is a fluorescent quantitative PCR primer set for circRNA markers for colon cancer screening for amplification of hsa _ circ _0036847, hsa _ circ _0064628, or hsa _ circ _0086569, respectively;

the primer set sequences for amplification of hsa _ circ _0036847 are SEQ ID NO 4 and SEQ ID NO 5; the primer set sequences for amplification of hsa _ circ _0064628 are SEQ ID NO 6 and SEQ ID NO 7; the primer set sequences for amplification of hsa _ circ _0086569 are SEQ ID NO 8 and SEQ ID NO 9.
3. The use according to claim 1, wherein the product for colon cancer screening is a kit of circRNA markers for colon cancer screening comprising a fluorescent quantitative PCR primer set for amplifying hsa _ circ _0036847, hsa _ circ _0064628 or hsa _ circ _0086569, respectively, and a primer set for amplifying an internal reference gene;

the primer set sequences for amplification of hsa _ circ _0036847 are SEQ ID NO 4 and SEQ ID NO 5; the primer set sequences for amplification of hsa _ circ _0064628 are SEQ ID NO 6 and SEQ ID NO 7; the primer set sequences for amplification of hsa _ circ _0086569 are SEQ ID NO 8 and SEQ ID NO 9;

the reference gene is GAPDH, and the primer sequences for amplifying the GAPDH are SEQ ID NO. 10 and SEQ ID NO. 11.