CN114317594B - Application of arabidopsis seed regulatory gene RPP1A - Google Patents
Application of arabidopsis seed regulatory gene RPP1A Download PDFInfo
- Publication number
- CN114317594B CN114317594B CN202210027119.2A CN202210027119A CN114317594B CN 114317594 B CN114317594 B CN 114317594B CN 202210027119 A CN202210027119 A CN 202210027119A CN 114317594 B CN114317594 B CN 114317594B
- Authority
- CN
- China
- Prior art keywords
- rpp1a
- gene
- arabidopsis
- artificial sequence
- rpp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
The application of an Arabidopsis seed regulation gene RPP1A, in particular to the application of the Arabidopsis seed regulation gene RPP1A in controlling seed size and hundred grain weight. The ribosomal gene provided by the invention has homologous genes in all plants, and the genes are relatively conserved in evolution in different plant sources, so that the amino acid similarity is higher;RPP1Anot only has the function of regulating and controlling the size of seeds in arabidopsis thaliana, but also can be applied to the cultivation of new varieties of grain crops such as rice, wheat, corn and the like and economic crops such as rape, soybean and the like; the invention provides valuable gene resources for crop high-yield breeding.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to application of an arabidopsis seed regulation gene RPP1A in controlling seed size and hundred-grain weight.
Background
Seed size is an important agronomic trait, a key component in determining crop yield (Zhang, y.et al., plant Cell,2015, 27:620-632). In angiosperms, the seed starts from double fertilization to develop a mature seed comprising the embryo, endosperm and seed coat, which coordinate growth and regulation, thus determining the final size of the seed. Seed size is closely related to seed weight. In recent years, although there is a certain progress in molecular mechanisms for regulating seed size, signaling pathways for controlling seed size are known to be mainly: the IKU (HAIKU) pathway, ubiquitin-proteasome pathway, G (Guanosine triphosphate) protein signal pathway, mitogen-activated protein kinase (mitogen-activated protein kinase, MAPK) signal pathway, plant hormone and transcription regulator, but the regulation network of seed size is not perfect, and further new genes for regulating seed size are required to be further mined to perfect the regulation mechanism and regulation network of seed size, so that important theoretical basis is provided for crop high-yield breeding.
Ribosomes are molecular machines of protein synthesis within living cells. Cytoplasmic ribosomes in eukaryotic cells consist of a 60S large subunit and a 40S small subunit, containing about 80 ribosomal proteins and 4 ribosomal rRNAs (Barakey et al, plant Physiology,2001, 127 (2): 398-415). Plant ribosomal proteins are encoded by multiple copies of genes, often one ribosomal protein is encoded by 2 or more genes of the same family. There were certain differences in the expression levels of homologous genes of the same family of Arabidopsis ribosomes in different growth and development phases, different tissues and different stress responses (Savda et al, plant Science,2014, 223:134-145; wang et al, BMC Genomics,2013, 14, 783). This suggests that ribosomal proteins are not only involved in protein synthesis, but also play a regulatory role in various biological processes such as plant growth and development, stress response, etc. The Arabidopsis RPP1A protein belongs to the ribosomal phosphoprotein P1 family, which includes three homologous genes of RPP1A, RPP B and RPP 1C. The P1 protein has various biological functions in the aspects of protein synthesis, transcription control, DNA repair and the like, but the functions of the RPP1A protein in the aspect of seed size regulation have not been reported.
Disclosure of Invention
The technical problems to be solved are as follows: aiming at the blank of the prior art, the invention provides an application of an arabidopsis ribosomal protein RPP 1A. The RPP1A mutant seed adopting the technology of the invention is enlarged, the hundred-grain weight is increased, and the application prospect is good.
The technical scheme is as follows: the application of the RPP1A gene with the nucleotide sequence shown as SEQ.ID.NO.1 as an inhibition target in improving seed size and hundred grain weight.
The application of the RPP1A protein with the amino acid sequence shown as SEQ ID NO.2 as an inhibition target in improving seed size and hundred grain weight.
The inhibition method is to knock out or silence the RPP1A gene in plants.
Specifically, an agent which down regulates the transcription of the RPP1A gene, the expression of the protein or the activity of the protein is transferred into a plant.
Such plants include, but are not limited to, dicotyledonous plants and monocotyledonous plants.
The beneficial effects are that: the invention discovers the biological function of the RPP1A gene in the aspect of regulating and controlling the seed size and hundred-grain weight for the first time, the seed size and hundred-grain weight of the gene have negative regulation and control effects, the RPP1A gene is used for supplementing RPP a mutant to obtain a transgenic plant, the phenotype of the transgenic plant has no obvious difference with that of wild type arabidopsis thaliana, and the gene is proved to participate in regulating and controlling the seed size; the ribosomal gene provided by the invention has homologous genes in all plants, and the genes are relatively conserved in evolution in different plant sources, so that the amino acid similarity is higher; the RPP1A not only has the function of regulating the seed size in the arabidopsis thaliana, but also can be applied to the cultivation of new varieties of grain crops such as rice, wheat, corn and the like and economic crops such as rape, soybean and the like; the invention provides valuable gene resources for crop high-yield breeding.
Drawings
FIG. 1 is a schematic diagram of the structure of the Arabidopsis RPP1A gene and the T-DNA insertion positions of the RPP a-1 and RPP a-2 mutants.
FIG. 2 shows the three-primer PCR identification results (A and B) and semi-quantitative RT-PCR analysis (C) of the T-DNA insertion homozygous mutants RPP a-1 and RPP a-2 of the RPP1A gene.
FIG. 3 is a semi-quantitative RT-PCR analysis of transgenic plants (comp 6#, comp13#, comp16# and comp 17#) after the complementation of the Arabidopsis RPP a-2 mutant and RPP1A gene.
FIG. 4 is a photograph of seed phenotype of Arabidopsis wild type (Col-0) and rpp1a-1 and rpp a-2 mutants and transgenic plants after gene complementation (comp 6# and comp17 #), scale 1mm.
FIG. 5 is a seed size analysis, length and width (A), surface area (B) and hundred grain weight (C) of Arabidopsis wild type (Col-0) and rpp a-2 mutants and transgenic plants after gene complementation (comp 6# and comp17 #). The different letters represent significant differences (p value < 0.05) between the different strains using one-way ANOVE analysis.
Detailed Description
Example 1: identification of T-DNA insertion homozygous mutant of Arabidopsis RPP1A gene
1. Plant material
Seeds of the 2T-DNA insertion mutants RPP a-1, RPP a-2 of Arabidopsis RPP1A were purchased from Arabidopsis Biological Resource Center (ABRC) and stored under the accession numbers SAIL_210_H01 and SALK_206736C, respectively. As shown in FIG. 1, the T-DNA insertion site of the rpp1a-1 mutant was located in the promoter region, while the T-DNA insertion site of the rpp a-2 mutant was located in the protein coding region, and in the second exon region of the gene, wild-type Arabidopsis Col-0 was from the present laboratory.
2. Cultivation of plant material
Col-0, rpp1a-1, rpp a-2 were sterilized with 75% alcohol for 3min,0.5% sodium hypochlorite for 10min, rinsed 5 times with sterile water, vernalized at 4℃for 2d, sown on 1/2MS medium, cultured in an illumination box (16 h illumination/8 h darkness, 22 ℃) for 10d, and then transplanted into the soil.
3. Identification of T-DNA insertion homozygous mutant of Arabidopsis RPP1A gene
The DNA of the leaves of the Col-0, rpp a-1 and rpp a-2 seedlings is extracted by adopting a CTAB method, and the extracted DNA is used as a template to carry out mutant identification by adopting a three-primer method.
The identifying primers of rpp a-1 (SAIL_210H 01) are:
LP:TGATTATATACCGTGCGGGAC；
RP:AACGGTTCCAAAACCCTACTG；
LB1:GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC；
the identifying primers of rpp a-2 (SALK_ 206736C) are:
LP:ATGTTATGAAGACGCTGCTGG；
RP:ATTTCATCATCGTCTGGGTTG；
LBb1.3:ATTTTGCCGATTTCGGAAC；
PCR reaction system
PCR amplification conditions: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 56℃for 30s, extension at 72℃for 90s,35 cycles; extending at 72℃for 7min.
The PCR products were detected by 1% agarose gel electrophoresis. The results are shown in fig. 2 (a and B): in mutants RPP a-1, rppa-2, the RPP1A gene was not amplified, indicating that the RPP a-1 and RPP a-2 mutants were homozygous mutants.
Example 2: semi-quantitative RT-PCR analysis of RPP1A Gene T-DNA insertion mutants
To analyze whether the RPP1A gene was silenced in the T-DNA insertion mutant, we performed a semi-quantitative RT-PCR analysis as follows:
extracting total RNA of wild arabidopsis Col-0, rpp1a-1 and rpp a-2 plant leaves by adopting a Trizol method, reversely transcribing the total RNA into cDNA, and respectively carrying out PCR amplification by using specific primers by taking the diluted cDNA as a template, wherein the primers of internal reference are arabidopsis Actin.
The amplification primers are as follows:
qPCR-RPP1AF:GGGGTACCATTTGATCCGTTTATACTTGTTATTG；
qPCR-RPP1AR:CAAAGAAGAAAGACAAGTGACTGCGT；
ActinF:GTTGGGATGAACCAGAAGGA；
ActinR:CTTACAATTTCCCGCTCTGC；
PCR reaction system
PCR amplification conditions: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 55℃for 30s, elongation at 72℃for 30s,34 cycles; extending at 72℃for 7min.
The PCR products were detected by 1% agarose gel electrophoresis. The results are shown in FIG. 2 (C), and the results indicate that rpp a-2 is a loss-of-function mutant and rpp a-1 is a reduced-function mutant.
Example 3: acquisition of transgenic plants complementary to RPP1A
Cloning of the RPP1A Gene
The Col-0 genome DNA extracted by adopting a CTAB method is subjected to PCR amplification by taking the DNA as a template and adopting primers RPP1AF and RPP1AR containing enzyme cutting sites, wherein the amplification primers are as follows:
RPP1AF:CCGGAATTCGTGTAATGTGTTTAATTACTTTTGGT；
RPP1AR:CGCGGATCCTGGTAGAAAATAAACAAAATCAATTC；
PCR reaction system
The PCR reaction procedure was: pre-denaturation at 94℃for 3min; denaturation at 98℃for 10s, annealing at 56℃for 15s, elongation at 72℃for 20s,35 cycles; extending at 72℃for 5min.
The PCR amplified product is detected by 1% agarose gel electrophoresis, a target fragment is recovered and connected to a carrier, competent cells of escherichia coli are transformed, and monoclonal is selected for sequencing.
2. Construction of recombinant plasmids
The plasmids of the bacterial solutions which were sequenced successfully were extracted, and the plasmids with the target fragment and the plasmids with the pCAM1301 vector were digested with EcoRI and BamHI at 37℃for 30min.
Enzyme digestion reaction system
Separating the enzyme-cut product by 1% agarose gel electrophoresis, recovering the target fragment, connecting by using T4 ligase, reacting for 3 hours at 22 ℃, converting escherichia coli competence, selecting a monoclonal for PCR detection, extracting plasmids, and carrying out double enzyme-cut identification.
Obtaining of RPP 1A-complemented transgenic plants
Transforming agrobacterium competent cells with the constructed pCAM1301-RPP1A expression vector, transforming Arabidopsis T-DNA into mutants RPP a-2 by an inflorescence infection method, sowing mature Arabidopsis seeds on a hygromycin resistance plate, and screening to obtain positive plants. Further screening to obtain T3 generation homozygous transgenic plants.
Verification of the expression level of the RPP1A Gene in the transgenic plants with the RPP1A anaplerotic Gene
Total RNA from the T3 generation homozygous plants is extracted, reverse transcription is carried out, and the expression quantity of the RPP1A gene is detected.
Extracting total RNA of wild arabidopsis Col-0, rpp a-2 plants and anaplerotic strain (comp 6#, comp13# and comp 17#) seedlings by adopting a Trizol method, reversely transcribing the total RNA into cDNA, and respectively carrying out PCR (polymerase chain reaction) amplification by using specific primers by taking diluted cDNA as a template, wherein the primers of internal references are arabidopsis Tubulin.
The amplification primers are as follows:
qPCR-RPP1AF:CCTGCTGCTGAGGAGAAGA；
qPCR-RPP1AR:CGCGGATCCTGGTAGAAAATAAACAAAATCAATTC；
TubulinF:GTGCTGAAGGTGGAGACGAT；
TubulinR:AACACGAAGACCGAACGAAT；
PCR reaction system
PCR amplification conditions: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 30s,30 cycles; extending at 72℃for 7min.
The PCR products were detected by 1% agarose gel electrophoresis. As a result, as shown in FIG. 3, the complementation transgenic lines comp6#, comp13#, and comp17# were all able to complement or partially complement the expression level of the RPP1A gene, and the lines (comp6# and comp17#) whose expression levels were identical to those of the wild type were selected for the next experiment.
Example 4: mature seed size and hundred grain weight analysis of rpp a mutant and post-complementation transgenic plants
The seeds of arabidopsis were ripened and dried and then photographed by a stereo microscope to determine the seed size, including the length, width and surface area of the seeds. Seed hundred grains were measured on a ten-thousandth balance (at least 90 seeds averaged). Values are expressed as mean ± standard deviation.
As shown in FIG. 4, the seeds of the rpp1a-1 and rpp a-2 mutants were significantly larger than those of the Arabidopsis wild type (Col-0), while the seed sizes of the anaplerotic lines were consistent with the wild type. Mature seed sizes, including seed length, width, surface area and hundred grain weight, of the Col-0, rpp1a-1 and rpp a-2 mutants, and the anaplerotic lines were measured. As shown in fig. 5, the RPP a-1 and RPP a-2 mutant seeds were significantly increased in length and width and surface area compared to the wild type, and the hundred grain weight was also significantly increased, and the anaplerotic line was able to anaplerotic the wild type seed size and thousand grain weight, indicating that RPP1A was involved in regulating the arabidopsis seed size.
The foregoing is illustrative of the present invention and is not limited to the embodiments and, therefore, it is intended that all such modifications and examples be included within the scope of the present invention without departing from the spirit and scope of the invention.
Sequence listing
<110> Nanjing soil institute of China academy of sciences
<120> application of Arabidopsis seed regulatory gene RPP1A
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 587
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atttgatccg tttatacttg ttattggcat ttcatcatcg tctgggataa aaaaatgtcg 60
acagttggag agcttgcttg cagctacgct gttatgatcc tcgaggacga gggtatcgct 120
atcacggctg acaaaatcgc gaccttggtg aaagctgctg gtgttagtat tgagtcatac 180
tggccaatgc tattcgccaa gatggctgag aaacgtaacg tgactgatct catcatgaac 240
gttggtgctg gtggtggagg tggtgctccg gttgcagctg ctgctccagc tgctggcggt 300
ggtgcggcag ctgctcctgc tgctgaggag aagaagaagg atgagccagc agaagagagt 360
gacggagatt tgggtttcgg tttgtttgac taaacgcagt cacttgtctt tcttctttgt 420
agttggatat tggagactat attttgtcgt atgagttatt attacttgtt tgatctggct 480
aaaggactat tagttggttt atgatgcgta tgttgtataa ctcaagtttc ctagcaaacc 540
aatcggctcg ggcttttgtt agaattgatt ttgtttattt tctacca 587
<210> 2
<211> 112
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Ser Thr Val Gly Glu Leu Ala Cys Ser Tyr Ala Val Met Ile Leu
1 5 10 15
Glu Asp Glu Gly Ile Ala Ile Thr Ala Asp Lys Ile Ala Thr Leu Val
20 25 30
Lys Ala Ala Gly Val Ser Ile Glu Ser Tyr Trp Pro Met Leu Phe Ala
35 40 45
Lys Met Ala Glu Lys Arg Asn Val Thr Asp Leu Ile Met Asn Val Gly
50 55 60
Ala Gly Gly Gly Gly Gly Ala Pro Val Ala Ala Ala Ala Pro Ala Ala
65 70 75 80
Gly Gly Gly Ala Ala Ala Ala Pro Ala Ala Glu Glu Lys Lys Lys Asp
85 90 95
Glu Pro Ala Glu Glu Ser Asp Gly Asp Leu Gly Phe Gly Leu Phe Asp
100 105 110
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tgattatata ccgtgcggga c 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
aacggttcca aaaccctact g 21
<210> 5
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gccttttcag aaatggataa atagccttgc ttcc 34
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
atgttatgaa gacgctgctg g 21
<210> 7
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atttcatcat cgtctgggtt g 21
<210> 8
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
attttgccga tttcggaac 19
<210> 9
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
ggggtaccat ttgatccgtt tatacttgtt attg 34
<210> 10
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
caaagaagaa agacaagtga ctgcgt 26
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
ccggaattcg tgtaatgtgt ttaattactt ttggt 35
<210> 14
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
cgcggatcct ggtagaaaat aaacaaaatc aattc 35
<210> 15
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
cctgctgctg aggagaaga 19
<210> 16
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
cgcggatcct ggtagaaaat aaacaaaatc aattc 35
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
Claims (4)
1. The application of the RPP1A gene with the nucleotide sequence shown as SEQ ID NO.1 as an inhibition target in improving the seed size and hundred-grain weight of a plant, wherein the plant is Arabidopsis thaliana.
2. The application of the RPP1A protein with the amino acid sequence shown as SEQ ID NO.2 as an inhibition target in improving the seed size and hundred-grain weight of plants, wherein the plants are arabidopsis thaliana.
3. The use according to claim 1, wherein the RPP1A gene is knocked out or silenced in a plant.
4. The use according to claim 2, wherein the agent that down-regulates the transcription of the RPP1A gene, protein expression or protein activity is transferred into a plant.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2021110073564 | 2021-08-30 | ||
| CN202111007356 | 2021-08-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114317594A CN114317594A (en) | 2022-04-12 |
| CN114317594B true CN114317594B (en) | 2023-06-06 |
Family
ID=81026400
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210027119.2A Active CN114317594B (en) | 2021-08-30 | 2022-01-11 | Application of arabidopsis seed regulatory gene RPP1A |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114317594B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101484465A (en) * | 2006-03-31 | 2009-07-15 | 先锋高级育种国际公司 | Maize genes for controlling plant growth and organ size and their use in improving crop plants |
| WO2011023537A1 (en) * | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| CN102724865A (en) * | 2009-08-25 | 2012-10-10 | 目标栽培公司 | Modified transgene encoding a growth and/or development related protein in plants |
| WO2013012889A2 (en) * | 2011-07-19 | 2013-01-24 | Grassroots Biotechnology, Inc. | Regulatory polynucleotides and uses thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10087458B2 (en) * | 2014-09-25 | 2018-10-02 | Noble Research Institute, Llc | Manipulating BS1 for plant seed yield |
-
2022
- 2022-01-11 CN CN202210027119.2A patent/CN114317594B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101484465A (en) * | 2006-03-31 | 2009-07-15 | 先锋高级育种国际公司 | Maize genes for controlling plant growth and organ size and their use in improving crop plants |
| CN102724865A (en) * | 2009-08-25 | 2012-10-10 | 目标栽培公司 | Modified transgene encoding a growth and/or development related protein in plants |
| WO2011023537A1 (en) * | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| WO2013012889A2 (en) * | 2011-07-19 | 2013-01-24 | Grassroots Biotechnology, Inc. | Regulatory polynucleotides and uses thereof |
Non-Patent Citations (5)
| Title |
|---|
| A proteomic analysis of Arabidopsis ribosomal phosphoprotein P1A mutant;Bingjuan Li et al.;《J Proteomics . 》;第262卷;第1-13页 * |
| L. Michael Weaver et al..The Arabidopsis thaliana TIR-NB-LRR R-protein, RPP1A * |
| protein localization and constitutive activation of defence by truncated alleles in tobacco and Arabidopsis.《The Plant Journal》.2006,第47卷第829-840页. * |
| 种子大小发育的基因调控研究进展;朱伟等;《中国油料作物学报》;第34卷(第4期);第443-448页 * |
| 调控植物种子发育的转录因子研究进展;吴玉等;《生物技术通报》;第35卷(第11期);第150-159 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114317594A (en) | 2022-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xue et al. | Overexpression of TaNAC69 leads to enhanced transcript levels of stress up-regulated genes and dehydration tolerance in bread wheat | |
| WO2013060136A1 (en) | Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel | |
| WO2009073069A2 (en) | Genes and uses for plant enhancement | |
| US20120210458A9 (en) | Isolated Novel Nucleic Acid and Protein Molecules from Corn and Methods of Using Thereof | |
| WO2010075143A1 (en) | Genes and uses for plant enhancement | |
| WO2005024017A1 (en) | Nucleic acid molecules associated with oil in plants | |
| Peng et al. | Genome-wide comparative analysis of flowering-related genes in Arabidopsis, wheat, and barley | |
| CN101379080B (en) | Nucleic acids and methods for producing seeds having a all-diploid of the maternal genome in the embryo | |
| CN104450640A (en) | Transgenic Plant With Increased Stress Tolerance And Yield | |
| CN101679999A (en) | Transgenic plants with increased stress tolerance and yield | |
| EP3169785B1 (en) | Methods of increasing crop yield under abiotic stress | |
| CN108642065A (en) | A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application | |
| Sui et al. | A new GA-insensitive semidwarf mutant of rice (Oryza sativa L.) with a missense mutation in the SDG gene | |
| US20120117685A1 (en) | Isolated Novel Nucleic Acid and Protein Molecules from Soybeans and Methods of Using Thos Molecules | |
| CN103172715A (en) | Plant epidermal hair controlling gene and application thereof | |
| CN110511941B (en) | Method for increasing plant biomass and thus increasing yield by overexpressing abscisic acid receptors | |
| CN114317594B (en) | Application of arabidopsis seed regulatory gene RPP1A | |
| CN112899302B (en) | Application of rape alpha-6 tubulin gene in improving rape yield | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN103788189A (en) | Rice ageing control gene OsCDC48E and coded protein thereof | |
| CN109112137B (en) | Gene SNG1 for controlling size and weight of rice grains and application thereof | |
| CN111153980A (en) | Plant grain type related protein OsSDSG and coding gene and application thereof | |
| CN113817755B (en) | Rice long-grain gene LOG1 and application thereof | |
| CN110079547B (en) | Application of eIF4G protein in regulation and control of ABA tolerance of plants | |
| CN114231557B (en) | Rice seed dormancy regulatory gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |