CN114317594A - Application of arabidopsis seed regulatory gene RPP1A - Google Patents
Application of arabidopsis seed regulatory gene RPP1A Download PDFInfo
- Publication number
- CN114317594A CN114317594A CN202210027119.2A CN202210027119A CN114317594A CN 114317594 A CN114317594 A CN 114317594A CN 202210027119 A CN202210027119 A CN 202210027119A CN 114317594 A CN114317594 A CN 114317594A
- Authority
- CN
- China
- Prior art keywords
- rpp1a
- gene
- artificial sequence
- arabidopsis
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
An application of an arabidopsis seed regulatory gene RPP1A, in particular to an application of an arabidopsis seed regulatory gene RPP1A in controlling the size and the weight of seeds. The ribosome gene provided by the invention has homologous genes in all plants, and the genes in different plant sources are relatively conserved in evolution, and the amino acid similarity is higher;RPP1Athe arabidopsis thaliana seed size regulating and controlling agent not only has the function of regulating and controlling the size of seeds, but also can be applied to breeding new varieties of grain crops such as rice, wheat and corn and economic crops such as rape and soybean; the invention provides valuable gene resources for high-yield breeding of crops.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an application of an arabidopsis seed regulatory gene RPP1A in controlling seed size and hundred grain weight.
Background
Seed size is an important agronomic trait and is a key component in determining crop yield (Zhang, Y.et al, Plant Cell, 2015, 27: 620-632). In angiosperms, seeds develop from double fertilization into a mature seed, which includes three parts, namely embryo, endosperm and seed coat, which are coordinated in growth and regulation to determine the final size of the seed. Seed size is closely related to seed grain weight. In recent years, although some progress has been made in molecular mechanisms for controlling seed size, signal pathways for controlling seed size are known mainly as follows: an IKU (HAIKU) channel, an ubiquitin-proteasome channel, a G (guanosine triphosphate) protein signal channel, a mitogen-activated protein kinase (MAPK) signal channel, phytohormones and transcription regulators, but the seed size regulation network is still imperfect, and a new gene for regulating and controlling the seed size needs to be further excavated to complete the seed size regulation mechanism and regulation network, so that an important theoretical basis is provided for high-yield breeding of crops.
Ribosomes are the molecular machinery of protein synthesis within living cells. Cytoplasmic ribosomes in eukaryotic cells are composed of a 60S large subunit and a 40S small subunit, and contain about 80 ribosomal proteins and 4 ribosomal rRNAs (Baraket et al, Plant Physiology, 2001, 127 (2): 398-415). Plant ribosomal proteins are encoded by multiple copies of a gene, often one ribosomal protein is encoded by 2 or more genes of the same family. There is a certain difference in the expression level of homologous genes of the same family in Arabidopsis ribosome during different growth and development stages, different tissues and different stress responses (Savda et al, Plant Science 2014, 223: 134-. This indicates that the ribosomal protein not only participates in protein synthesis, but also plays a role in regulation and control in various biological processes such as plant growth and development, stress response and the like. The arabidopsis RPP1A protein belongs to the ribosomal phosphoprotein P1 family, which includes three homologous genes, RPP1A, RPP1B and RPP 1C. The P1 protein has various biological functions in the aspects of protein synthesis, transcription control, DNA repair and the like, but the function of the RPP1A protein in the aspect of seed size regulation is not reported.
Disclosure of Invention
The technical problem to be solved is as follows: the invention provides an application of Arabidopsis thaliana ribosomal protein RPP1A aiming at the blank of the prior art. The RPP1A mutant seed adopting the technology of the invention is enlarged, the hundred grain weight is increased, and the application prospect is good.
The technical scheme is as follows: application of RPP1A gene with nucleotide sequence shown in SEQ ID No.1 as inhibition target in increasing seed size and hundred grain weight.
The application of RPP1A protein with an amino acid sequence shown as SEQ ID NO.2 as an inhibition target in increasing seed size and hundred grain weight.
The inhibition method is to knock out or silence RPP1A gene in plants.
The specific scheme is that the agent for down regulating RPP1A gene transcription, protein expression or protein activity is transferred into plant.
Such plants include, but are not limited to, dicots and monocots.
Has the advantages that: the invention discovers the biological function of the RPP1A gene in the aspect of regulating the seed size and the hundred grain weight for the first time, the seed size and the hundred grain weight of the gene have negative regulation effect, the RPP1A gene complementation RPP1a mutant is used for obtaining a transgenic plant, the phenotype of the transgenic plant has no obvious difference with that of the wild arabidopsis thaliana, and the gene is indicated to participate in the regulation of the seed size; the ribosome gene provided by the invention has homologous genes in all plants, and the genes in different plant sources are relatively conserved in evolution, and the amino acid similarity is higher; RPP1A not only has the function of regulating and controlling the size of seeds in Arabidopsis, but also can be applied to the cultivation of new varieties of grain crops such as rice, wheat and corn and economic crops such as rape and soybean; the invention provides valuable gene resources for high-yield breeding of crops.
Drawings
FIG. 1 is a schematic diagram of the structure of Arabidopsis RPP1A gene and the T-DNA insertion positions of RPP1a-1 and RPP1a-2 mutants.
FIG. 2 shows the results of PCR identification (A and B) and semi-quantitative RT-PCR analysis (C) of T-DNA insertion homozygous mutant RPP1a-1 and RPP1a-2 of RPP1A gene.
FIG. 3 shows the semi-quantitative RT-PCR analysis of transgenic plants (comp6#, comp13#, comp16# and comp17#) after the Arabidopsis RPP1a-2 mutant and RPP1A gene are complemented.
FIG. 4 is a photograph of seed phenotypes of Arabidopsis thaliana wild type (Col-0) and rpp1a-1 and rpp1a-2 mutants and transgenic plants (comp6# and comp17#) after gene complementation, at a scale bar of 1 mm.
FIG. 5 is a seed size analysis, length and width (A), surface area (B) and grain weight (C) of Arabidopsis thaliana wild type (Col-0) and rpp1a-2 mutant and transgenic plants (comp6# and comp17#) after gene complementation. Different letters represent significant differences between different strains analyzed using one-way ANOVE (p value < 0.05).
Detailed Description
Example 1: identification of T-DNA insertion homozygous mutant of Arabidopsis RPP1A gene
1. Plant material
Seeds of 2T-DNA insertion mutants RPP1a-1, RPP1a-2 of Arabidopsis RPP1A were purchased from Arabidopsis center of Bioresources (ABRC) and stored under the accession numbers SAIL-210 _ H01 and SALK-206736C, respectively. As shown in FIG. 1, the T-DNA insertion site of the rpp1a-1 mutant is located in the promoter region, while the T-DNA insertion site of the rpp1a-2 mutant is located in the protein coding region, and in the second exon region of the gene, the wild-type Arabidopsis thaliana Col-0 is from the laboratory.
2. Cultivation of plant material
Sterilizing Col-0, rpp1a-1 and rpp1a-2 with 75% alcohol for 3min, sterilizing with 0.5% sodium hypochlorite for 10min, rinsing with sterile water for 5 times, vernalizing at 4 deg.C for 2d, sowing on 1/2MS culture medium, culturing in light box (16h light/8 h dark, 22 deg.C) for 10d, and transplanting into soil.
3. Identification of T-DNA insertion homozygous mutant of Arabidopsis RPP1A gene
DNA of Col-0, rpp1a-1 and rpp1a-2 seedling leaves is extracted by a CTAB method, and mutant identification is carried out by using the extracted DNA as a template and adopting a three-primer method.
rpp1a-1(SAIL _210H01) the identifying primers were:
LP:TGATTATATACCGTGCGGGAC；
RP:AACGGTTCCAAAACCCTACTG；
LB1:GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC；
rpp1a-2(SALK _206736C) the identifying primers were:
LP:ATGTTATGAAGACGCTGCTGG；
RP:ATTTCATCATCGTCTGGGTTG；
LBb1.3:ATTTTGCCGATTTCGGAAC；
PCR reaction system
PCR amplification conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 90s, and 35 cycles; extension at 72 ℃ for 7 min.
The PCR product was detected by electrophoresis on a 1% agarose gel. The results are shown in FIG. 2(A and B): in mutants RPP1a-1, rppa-2, the RPP1A gene was not amplified, indicating that the RPP1a-1 and RPP1a-2 mutants are homozygous mutants.
Example 2: semi-quantitative RT-PCR analysis of RPP1A gene T-DNA insertion mutant
To analyze whether the RPP1A gene was silenced in T-DNA insertion mutants, we performed a semi-quantitative RT-PCR analysis as follows:
extracting total RNA of leaves of wild arabidopsis thaliana Col-0, rpp1a-1 and rpp1a-2 plants by a Trizol method, carrying out reverse transcription to obtain cDNA, respectively carrying out PCR amplification by using specific primers by using the diluted cDNA as a template, wherein the primer of the internal reference is arabidopsis thaliana Actin.
The amplification primers are as follows:
qPCR-RPP1AF:GGGGTACCATTTGATCCGTTTATACTTGTTATTG；
qPCR-RPP1AR:CAAAGAAGAAAGACAAGTGACTGCGT；
ActinF:GTTGGGATGAACCAGAAGGA；
ActinR:CTTACAATTTCCCGCTCTGC；
PCR reaction system
PCR amplification conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s, for 34 cycles; extension at 72 ℃ for 7 min.
The PCR product was detected by electrophoresis on a 1% agarose gel. The results are shown in FIG. 2(C), and indicate that rpp1a-2 is a loss-of-function mutant, and rpp1a-1 is a reduced function mutant.
Example 3: acquisition of RPP 1A-complemented transgenic plants
Cloning of the RPP1A Gene
Adopting Col-0 genome DNA extracted by a CTAB method, taking the DNA as a template, adopting primers RPP1AF and RPP1AR containing enzyme cutting sites to carry out PCR amplification, wherein the amplification primers are as follows:
RPP1AF:CCGGAATTCGTGTAATGTGTTTAATTACTTTTGGT；
RPP1AR:CGCGGATCCTGGTAGAAAATAAACAAAATCAATTC；
PCR reaction system
The PCR reaction program is: pre-denaturation at 94 ℃ for 3 min; denaturation at 98 ℃ for 10s, annealing at 56 ℃ for 15s, extension at 72 ℃ for 20s, and 35 cycles; extension at 72 ℃ for 5 min.
Detecting the PCR amplification product by 1% agarose gel electrophoresis, recovering a target fragment, connecting the target fragment to a vector, transforming escherichia coli competent cells, and selecting a monoclonal for sequencing.
2. Construction of recombinant plasmid
And extracting a plasmid of a bacterial liquid with successful sequencing, cutting the plasmid with the target fragment and the plasmid of the pCAM1301 vector by using EcoRI and BamHI double enzymes, and performing 37 ℃ for 30 min.
Reaction system for enzyme digestion
Separating the enzyme digestion product by using 1% agarose gel electrophoresis, recovering a target fragment, connecting by using T4 ligase, reacting for 3h at 22 ℃, transforming the competence of escherichia coli, selecting a single clone for PCR detection, extracting plasmids, and performing double enzyme digestion identification.
Obtaining of RPP1A complementation transgenic plant
Transforming agrobacterium-infected cells by the constructed pCAM1301-RPP1A expression vector, transforming arabidopsis T-DNA by an inflorescence infection method, inserting the arabidopsis T-DNA into a mutant RPP1a-2, sowing mature arabidopsis seeds on a hygromycin resistance plate for screening, and screening positive plants. And further screening to obtain T3 generation homozygous transgenic plants.
3, verifying RPP1A gene expression quantity of RPP1A anaplerotic transgenic plant
Extracting total RNA from T3 homozygous plant, reverse transcribing, and detecting the RPP1A gene expression.
Extracting total RNA of wild arabidopsis thaliana Col-0 and rpp1a-2 plants and anaplerotic strain seedlings (comp6#, comp13#, and comp17#) by a Trizol method, performing reverse transcription to obtain cDNA, respectively performing PCR amplification by using the diluted cDNA as a template and a specific primer, wherein the primer of an internal reference is arabidopsis thaliana Tubulin.
The amplification primers are as follows:
qPCR-RPP1AF:CCTGCTGCTGAGGAGAAGA；
qPCR-RPP1AR:CGCGGATCCTGGTAGAAAATAAACAAAATCAATTC；
TubulinF:GTGCTGAAGGTGGAGACGAT；
TubulinR:AACACGAAGACCGAACGAAT；
PCR reaction system
PCR amplification conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; extension at 72 ℃ for 7 min.
The PCR product was detected by electrophoresis on a 1% agarose gel. As shown in FIG. 3, the results show that the transgenic strains comp6#, comp13# and comp17# can be used for complementing or partially complementing the expression level of the RPP1A gene, and strains (comp6# and comp17#) with the expression level consistent with that of the wild type are selected for the next experiment.
Example 4: rpp1a mutant and complemented transgenic plants for mature seed size and hundred grain weight analysis
After the seeds of arabidopsis thaliana are matured and dried, the sizes of the seeds, including the length, width and surface area of the seeds, are determined by taking a picture with a stereo microscope. The seed weight per million was measured on a scale (average of at least 90 seeds). Values are expressed as mean ± standard deviation.
As shown in FIG. 4, the seeds of the rpp1a-1 and rpp1a-2 mutants were significantly larger than those of the Arabidopsis wild type (Col-0), while the seed size of the anaplerotic line was consistent with that of the wild type. The seed sizes, including seed length, width, surface area and hundred grain weight, of the Col-0, rpp1a-1 and rpp1a-2 mutants, the anaplerotic line matured were measured. As shown in FIG. 5, compared with the wild type, the seed length and width and the surface area of RPP1a-1 and RPP1a-2 mutant seeds are remarkably increased, the hundred grain weight is also remarkably increased, and the anaplerosis line can compensate the seed size and thousand grain weight of the wild type, which indicates that RPP1A participates in regulating the seed size of Arabidopsis.
The invention and its embodiments have been described in an illustrative manner, and the description is not intended to be limiting, so that those skilled in the art will be able to devise similar arrangements and embodiments without departing from the spirit and scope of the invention.
Sequence listing
<110> Nanjing soil institute of Chinese academy of sciences
<120> application of arabidopsis seed regulatory gene RPP1A
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 587
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atttgatccg tttatacttg ttattggcat ttcatcatcg tctgggataa aaaaatgtcg 60
acagttggag agcttgcttg cagctacgct gttatgatcc tcgaggacga gggtatcgct 120
atcacggctg acaaaatcgc gaccttggtg aaagctgctg gtgttagtat tgagtcatac 180
tggccaatgc tattcgccaa gatggctgag aaacgtaacg tgactgatct catcatgaac 240
gttggtgctg gtggtggagg tggtgctccg gttgcagctg ctgctccagc tgctggcggt 300
ggtgcggcag ctgctcctgc tgctgaggag aagaagaagg atgagccagc agaagagagt 360
gacggagatt tgggtttcgg tttgtttgac taaacgcagt cacttgtctt tcttctttgt 420
agttggatat tggagactat attttgtcgt atgagttatt attacttgtt tgatctggct 480
aaaggactat tagttggttt atgatgcgta tgttgtataa ctcaagtttc ctagcaaacc 540
aatcggctcg ggcttttgtt agaattgatt ttgtttattt tctacca 587
<210> 2
<211> 112
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Ser Thr Val Gly Glu Leu Ala Cys Ser Tyr Ala Val Met Ile Leu
1 5 10 15
Glu Asp Glu Gly Ile Ala Ile Thr Ala Asp Lys Ile Ala Thr Leu Val
20 25 30
Lys Ala Ala Gly Val Ser Ile Glu Ser Tyr Trp Pro Met Leu Phe Ala
35 40 45
Lys Met Ala Glu Lys Arg Asn Val Thr Asp Leu Ile Met Asn Val Gly
50 55 60
Ala Gly Gly Gly Gly Gly Ala Pro Val Ala Ala Ala Ala Pro Ala Ala
65 70 75 80
Gly Gly Gly Ala Ala Ala Ala Pro Ala Ala Glu Glu Lys Lys Lys Asp
85 90 95
Glu Pro Ala Glu Glu Ser Asp Gly Asp Leu Gly Phe Gly Leu Phe Asp
100 105 110
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgattatata ccgtgcggga c 21
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aacggttcca aaaccctact g 21
<210> 5
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gccttttcag aaatggataa atagccttgc ttcc 34
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atgttatgaa gacgctgctg g 21
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
atttcatcat cgtctgggtt g 21
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
attttgccga tttcggaac 19
<210> 9
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ggggtaccat ttgatccgtt tatacttgtt attg 34
<210> 10
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
caaagaagaa agacaagtga ctgcgt 26
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ccggaattcg tgtaatgtgt ttaattactt ttggt 35
<210> 14
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
cgcggatcct ggtagaaaat aaacaaaatc aattc 35
<210> 15
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cctgctgctg aggagaaga 19
<210> 16
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cgcggatcct ggtagaaaat aaacaaaatc aattc 35
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
Claims (5)
1. The application of the RPP1A gene with the nucleotide sequence shown in SEQ ID NO.1 as an inhibition target in increasing the seed size and the hundred grain weight.
2. The application of RPP1A protein with an amino acid sequence shown as SEQ ID NO.2 as an inhibition target in increasing seed size and hundred grain weight.
3. Use according to claim 1, wherein the RPP1A gene is knocked out or silenced in a plant.
4. Use according to claim 2, wherein an agent which down-regulates the transcription of the RPP1A gene, the expression of a protein or the activity of a protein is transferred into a plant.
5. The use according to claim 1 or 2, wherein said plant includes but is not limited to dicotyledonous and monocotyledonous plants.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2021110073564 | 2021-08-30 | ||
| CN202111007356 | 2021-08-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114317594A true CN114317594A (en) | 2022-04-12 |
| CN114317594B CN114317594B (en) | 2023-06-06 |
Family
ID=81026400
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210027119.2A Active CN114317594B (en) | 2021-08-30 | 2022-01-11 | Application of arabidopsis seed regulatory gene RPP1A |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114317594B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101484465A (en) * | 2006-03-31 | 2009-07-15 | 先锋高级育种国际公司 | Maize genes for controlling plant growth and organ size and their use in improving crop plants |
| WO2011023537A1 (en) * | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| CN102724865A (en) * | 2009-08-25 | 2012-10-10 | 目标栽培公司 | Modified transgene encoding a growth and/or development related protein in plants |
| WO2013012889A2 (en) * | 2011-07-19 | 2013-01-24 | Grassroots Biotechnology, Inc. | Regulatory polynucleotides and uses thereof |
| US20160201076A1 (en) * | 2014-09-25 | 2016-07-14 | The Samuel Roberts Noble Foundation, Inc. | Manipulating bs1 for plant seed yield |
-
2022
- 2022-01-11 CN CN202210027119.2A patent/CN114317594B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101484465A (en) * | 2006-03-31 | 2009-07-15 | 先锋高级育种国际公司 | Maize genes for controlling plant growth and organ size and their use in improving crop plants |
| CN102724865A (en) * | 2009-08-25 | 2012-10-10 | 目标栽培公司 | Modified transgene encoding a growth and/or development related protein in plants |
| WO2011023537A1 (en) * | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| WO2013012889A2 (en) * | 2011-07-19 | 2013-01-24 | Grassroots Biotechnology, Inc. | Regulatory polynucleotides and uses thereof |
| US20160201076A1 (en) * | 2014-09-25 | 2016-07-14 | The Samuel Roberts Noble Foundation, Inc. | Manipulating bs1 for plant seed yield |
Non-Patent Citations (4)
| Title |
|---|
| BINGJUAN LI ET AL.: "A proteomic analysis of Arabidopsis ribosomal phosphoprotein P1A mutant", 《J PROTEOMICS . 》 * |
| L. MICHAEL WEAVER ET AL.: "The Arabidopsis thaliana TIR-NB-LRR R-protein, RPP1A; protein localization and constitutive activation of defence by truncated alleles in tobacco and Arabidopsis", 《THE PLANT JOURNAL》 * |
| 吴玉等: "调控植物种子发育的转录因子研究进展", 《生物技术通报》 * |
| 朱伟等: "种子大小发育的基因调控研究进展", 《中国油料作物学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114317594B (en) | 2023-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10301642B2 (en) | Genes and uses for plant enhancement | |
| US20220251593A1 (en) | Genes and uses for plant enhancement | |
| US9115368B2 (en) | Genes and uses for plant improvement | |
| WO2010039750A2 (en) | Transgenic plants with enhanced agronomic traits | |
| CA2840646A1 (en) | Methods and compositions for selective regulation of protein expression | |
| WO2013060136A1 (en) | Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel | |
| CN105087634A (en) | Plants having enhanced yield-related traits and a method for making the same | |
| CN101379080B (en) | Nucleic acids and methods for producing seeds having a all-diploid of the maternal genome in the embryo | |
| CN109369789B (en) | ZmDRR206 protein and application of coding gene thereof in regulation and control of plant disease resistance and growth development | |
| CN104450640A (en) | Transgenic Plant With Increased Stress Tolerance And Yield | |
| CN103613649A (en) | Paddy rice leaf color control gene OscpSRP54 and protein encoded by same | |
| US20120317676A1 (en) | Method of producing plants having enhanced transpiration efficiency and plants produced therefrom | |
| US20140090101A1 (en) | Transgenic plants with enhanced agronomic traits | |
| CN103172715A (en) | Plant epidermal hair controlling gene and application thereof | |
| CN110511941B (en) | Method for increasing plant biomass and thus increasing yield by overexpressing abscisic acid receptors | |
| CN112899302B (en) | Application of rape alpha-6 tubulin gene in improving rape yield | |
| CN114317594B (en) | Application of arabidopsis seed regulatory gene RPP1A | |
| CN113136398B (en) | GsHA24 protein and application of related biological material thereof in regulation and control of stress tolerance of plants | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN110698551B (en) | Application of soybean auxin response gene or protein thereof | |
| CN103788189A (en) | Rice ageing control gene OsCDC48E and coded protein thereof | |
| CN103232536B (en) | Application of SOAR1 protein and coding gene thereof to regulation and control on tolerance of plants to abscisic acid (ABA) | |
| CN110079547B (en) | Application of eIF4G protein in regulation and control of ABA tolerance of plants | |
| CN110117610B (en) | Method for improving drought tolerance of plant by down-regulating eIF4G gene and eISFiso 4G1 gene | |
| CN109988232B (en) | Application of eISHO 4G1 protein in regulation and control of ABA tolerance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |