CN110511941B

CN110511941B - Method for increasing plant biomass and thus increasing yield by overexpressing abscisic acid receptors

Info

Publication number: CN110511941B
Application number: CN201910821609.8A
Authority: CN
Inventors: 吕建; 陈希; 滕文涛; 刘志强; 尚永申
Original assignee: Syngenta Crop Protection AG Switzerland; Syngenta Biotechnology China Co Ltd
Current assignee: Syngenta Crop Protection AG Switzerland; Syngenta Biotechnology China Co Ltd
Priority date: 2019-09-02
Filing date: 2019-09-02
Publication date: 2020-09-08
Anticipated expiration: 2039-09-02
Also published as: CN110511941A

Abstract

The present application relates to the field of transgenics and gene editing, in particular to transgenics and gene editing in plants, such as crops. The present invention provides a method for increasing plant biomass and thus increasing yield by overexpressing an abscisic acid receptor. The invention increases biomass in plants, such as crops, particularly corn.

Description

Method for increasing plant biomass and thus increasing yield by overexpressing abscisic acid receptors

Technical Field

Background

Increasing crop yield is a necessary condition to ensure sustainable development in human society. It is expected that the world population will increase to 98 billion by 2050; this requires a 56% increase in agriculture over the calories provided in 2010. Based on the existing agricultural yield increase rate, the human needs to increase 15 hundred million acres of agricultural land to meet the needs of 2050 years. The agricultural land is influenced by factors such as climate, ecology, economic mode and the like, and the existing agricultural land area is not easy to guarantee. Therefore, further improvement of crop yield is the most effective method.

The first green revolution solves the problem of over-high/lodging of plants caused by applying chemical fertilizers; by utilizing the dwarf gene, the lodging resistance of the crops is greatly improved, and the yield of the crops in unit area is further improved. By applying chemical fertilizers and dwarfing/semi-dwarfing crops, the yield of wheat, rice, barley and sorghum is greatly improved; but this effect is not apparent on maize. Yield improvement in maize depends largely on the use of heterosis; by optimizing the hybridization combinations, an annual yield increase of 1% can be provided.

With the development of biotechnology, some genes that can improve yield were discovered and utilized. When the rice contains homozygous Osdep1 gene, the yield of the single plant is improved by 40% compared with the control [1 ]. OsGW5 can regulate grain width to improve grain weight and yield [2 ]. DELLA mutants, which can lead to plant dwarfing, are widely used to increase the Harvest Index (Harvest Index) in the Green leather hit [3 ]. Silencing ZmNAC7 can increase maize biomass, thus increasing maize yield [4 ]. According to a classical yield model, the yield is equal to source multiplied by harvest index, and the yield can be greatly improved by increasing the source; the source is often referred to as aerial biomass. As an example, the rice pyl1/4/6 mutant increased aerial biomass and thus increased yield [5 ].

Abscisic acid is a plant growth regulating hormone, is generated and enriched at roots under drought conditions, enters leaves through a conduit to regulate water potential or antioxidant capacity. In addition, studies have shown that abscisic acid can also be produced in leaves. Abscisic acid generally activates abscisic acid-dependent signaling pathways by binding to its receptor and altering the interaction of the receptor with protein phosphatases, thereby modulating the phosphorylation state of downstream phosphokinases. The abscisic acid receptor PYR/PYL/RCAR is a type of abscisic acid-binding protein, either in monomeric form or in dimeric form. In arabidopsis, there are 15 abscisic acid receptors; in wheat, there are 9 abscisic acid receptors.

Abscisic acid can regulate the corresponding balance of growth and stress; exogenous application of abscisic acid can increase the biomass of duckweed [6 ]. Tri-mutation Pyl1/4/6 in rice can increase yield, but makes the mutant more susceptible to drought stress [5 ]. This drought sensitivity is not a problem on rice because rice has water throughout the growing season; however, drought is common in crops such as wheat, corn, and soybean.

Disclosure of Invention

In general, the invention verifies that some corn abscisic acid receptors can increase crop biomass by an overexpression method, thereby improving crop yield; and can improve crop biomass without affecting water utilization efficiency.

In particular, the present invention relates to a method for increasing the biomass and thus the yield of a plant, comprising overexpressing in said plant a polynucleotide sequence encoding an abscisic acid receptor. In a preferred embodiment, the abscisic acid receptor is the abscisic acid receptor of the plant itself or of another species. In a preferred embodiment, one or more abscisic acid receptors are overexpressed. In a preferred embodiment, the amino acid sequence of the abscisic acid receptor is selected from the group consisting of SEQ ID NOs 2 and 4. In a preferred embodiment, the polynucleotide sequence encoding an abscisic acid receptor is selected from the group consisting of SEQ ID NOs 1 and 3. In a preferred embodiment, the overexpression is driven by a plant ubiquitin promoter or a plant actin promoter. In a further preferred embodiment, the plant ubiquitin promoter is the maize ubiquitin promoter prZmUbi1, the sequence of which is shown in SEQ ID NO. 5. In a further preferred embodiment, the plant actin promoter is the rice actin promoter, prAct1, the sequence of which is shown in SEQ ID No. 6. In a preferred embodiment, the overexpression is driven by a plant-inducible promoter or a plant organ-specific promoter. In a further preferred embodiment, the plant-inducible promoter is the Arabidopsis thaliana drought-inducible promoter prAtRD29A shown in SEQ ID NO 28 or other drought-inducible promoters. In a further preferred embodiment, said plant organ-specific promoter is the green organ-specific promoter prOsPSI33kd shown in SEQ ID NO:27, the stomata-specific promoter prAt1G22690 shown in SEQ ID NO:29 or a similar promoter. In a preferred embodiment, the overexpression is achieved by modulating DNA methylation or histone modification or variable cleavage. In a preferred embodiment, said overexpression is achieved by means of gene editing. In a preferred embodiment, the plant is selected from the group consisting of: maize, wheat, rice, sorghum, arabidopsis, soybean, tomato, sunflower, spinach and oilseed rape. In a preferred embodiment, the method increases the vigor of the crop at the seedling stage. In a preferred embodiment, the method increases silage corn biomass.

Drawings

FIG. 1 shows a map of ZmPYL-C binary vector.

FIG. 2 shows a map of ZmPYL-H binary vector.

Sequence Listing information

SEQ ID NO:1 is cZmPYL-C (coding box sequence).

SEQ ID NO:2 is cZmPYL-C (protein sequence).

SEQ ID NO:3 is cZmPYL-H (coding box sequence).

SEQ ID NO:4 is cZmPYL-H (protein sequence).

SEQ ID NO:5 is prZmUbi1 (maize ubiquitin promoter).

SEQ ID NO 6 is prAct1 (rice actin promoter).

SEQ ID NO. 7 is tUbi1 (maize ubiquitin terminator).

SEQ ID NO. 8 shows prHvLPT2 (barley aleurone layer-specific lipocalin promoter).

SEQ ID NO 9 is cRED (red fluorescent protein gene).

SEQ ID NO:10 is tPI-15 (tomato proteinase inhibitor II terminator).

SEQ ID NO:11 is cPAT (soybean codon-optimized phosphinothricin acetyltransferase gene).

SEQ ID NO:12 is t35S (cauliflower mosaic virus 35S terminator).

SEQ ID NO:13 is cPMI (mannose-6-phosphate isomerase gene).

SEQ ID NO:14 is tNOS (Agrobacterium nopaline synthase gene terminator).

SEQ ID NO 15 is ZmADH1 forward primer.

SEQ ID NO 16 is ZmADH1 reverse primer.

SEQ ID NO 17 is the ZmADH1 probe.

18 is PMI forward primer.

19 is PMI reverse primer.

20 is a PMI probe.

SEQ ID NO 21 is the Red forward primer.

SEQ ID NO. 22 is the Red reverse primer.

SEQ ID NO. 23 is the Red probe.

SEQ ID NO. 24 is the ZmEF forward primer.

SEQ ID NO. 25 is a ZmEF reverse primer.

SEQ ID NO 26 is the ZmEF probe.

SEQ ID NO:27 is prOsPSI33kd (33 kd gene promoter of rice photosynthesis center I).

SEQ ID NO. 28 is prAtRD29A (Arabidopsis drought-corresponding gene 29A promoter).

SEQ ID NO:29 is prAt1G22690 (Arabidopsis gibberellin-regulated gene promoter).

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1 overexpression of abscisic acid receptors from maize in maize

1.1. Binary vector construction

The coding frame sequences of the individual receptors (Table 1) were selected, designed with BsmBI cleavage sites at both ends, and synthesized in Kinry (GenScript). BsmBI was digested and ligated into BamHI/SpeI fragmented intermediate vectors. The spectinomycin positive clone (Spec +) was verified by PvuI/NotI cleavage. The correct clones were further verified by sequencing for junction error. The maize ubiquitin promoter (SEQ ID NO:5) was used for the expression of abscisic acid receptors. See fig. 1-2.

TABLE 1 maize abscisic acid receptor

Abscisic acid Acceptor numbering	Gene	Transcript
			ZmPYL-C	GRMZM2G169695	GRMZM2G169695_T01
ZmPYL-H	GRMZM2G048733	GRMZM2G048733_T01

1.2. Agrobacterium transformation of maize

The maize transformation variety in the experiment was JHAX. The agrobacterium transformation method is adopted, and the concrete operation is shown in reference [7 ]. The vector contains an expression cassette of a mannose-6-phosphate isomerase gene (PMI, SEQ ID NO:13) as a screening marker in plants; PMI positive plants were selected for copy number analysis (using primers and probes shown in SEQ ID NO: 18-20).

Identification of transgenic copy number in T0 generation

10 mg of leaves were collected from each PMI-positive shoot, and genomic DNA was extracted by the modified Tris-SDS method [8 ]. TaqMan primers and probes for the internal reference gene and the target gene were designed using PrimerExpress 3.0 software of Applied biosystems, USA, and synthesized by Invitrogen, and the sequence information is shown in tables 2 and 3.

TABLE 2 primer and Probe sequences (copy number) for real-time fluorescent quantitative PCR of reference genes

TABLE 3 primer and probe sequences (copy number) for real-time fluorescent quantitative PCR of genes of interest

T0 plants with 1 copy transgene were transplanted into the greenhouse (table 4).

TABLE 4 transgene copy number analysis

T2 generation seed breeding

T0 with 1 copy transgene was selfed in the greenhouse to produce T1 generation seeds. Transgenic copy number (same as 1.3) was checked by Taqman, and T1 generation plants with 1 copy transgene were retained. When the T1 transgenic plant blooms, manually emasculation is carried out; feeding the ears with wild-type JHAX pollen produced T2 seeds (table 4). Transgenic positive plants and non-transgenic plants were isolated from T2 seeds, and T2 generation plants were used for phenotypic analysis.

Example 2 overexpression of ZmPYL-C increased maize shoot stage biomass without affecting susceptibility to drought.

20 transgenic and non-transgenic T2 seeds were picked out by RED fluorescent labeling (RED, gene sequence shown in SEQ ID NO: 9) of the aleurone layer of the seeds. A9 cm × 9cm square pot was prepared and filled with culture soil of similar weight. T2 seeds were sown directly in the middle of the square pot at1 cm depth. Watering and fertilizing are carried out normally until the period of V3 is reached. The aerial parts were harvested, dried to constant weight, biomass was measured and statistically analyzed using T-test.

Overexpression of ZmPYL-C significantly increased the biomass accumulation during the seedling stage (Table 5).

TABLE 5 comparison of overexpression of ZmPYL-C with control Biomass

Water Use Efficiency (Water Use Efficiency) is the amount of Water required to accumulate dry matter per weight; the less water is needed, which reflects the improvement of drought-resistant ability of the plant. The stronger the drought avoidance ability is at the early stage of drought and/or under mild drought, the better the plants can cope with drought stress.

50 seeds of transgenic and non-transgenic T2 generations were each picked by RED fluorescence labeling (RED) of the aleurone layer of the seeds. A9 cm × 9cm square pot was prepared and filled with culture soil of similar weight. T2 seeds were sown directly in the middle of the square pot at1 cm depth. Watering and fertilizing are carried out normally until the period of V3 is reached. Selecting 30 transgenic plants and 30 non-transgenic plants with similar sizes; after being placed in full water for 2 hours, the cover is sealed by a plastic cover, and then the water is controlled to be dry. The remaining shoots, aerial parts harvested, and initial fresh (initial FW) and initial dry (initial DW) weights were weighed. Before drought treatment, weighing the total weight of pots and plants; after controlling water for 7 days, weighing the total weight of the pots and the plants; the difference between the two is the cumulative water usage. At the same time, the aerial parts of the plants were harvested and the final fresh weight (final FW) and the final dry weight (final DW) were weighed. The total water usage is cumulative water usage- (final fresh weight-initial fresh weight), and the water usage efficiency is total water usage/(final dry weight-initial dry weight). Statistical analysis was performed using T-test.

Based on significance analysis (P value less than 0.05), overexpression of ZmPYL-C did not affect water use efficiency (table 6), i.e., did not increase or decrease drought resistance. In conclusion, the biomass at the seedling stage can be improved by over-expressing ZmPYL-C, so that the yield is further improved; meanwhile, the sensitivity to drought is not influenced.

TABLE 6 comparison of Water use efficiency of overexpression of ZmPYL-C with control

Example 3 overexpression of ZmPYL-H increased maize shoot stage biomass without affecting drought sensitivity.

By the same validation method, over-expression of ZmPYL-H can significantly increase seedling stage biomass (Table 7) without affecting drought sensitivity (Table 8).

TABLE 7 comparison of overexpression of ZmPYL-H with control Biomass

TABLE 8 comparison of Water use efficiency of overexpression of ZmPYL-H with control

And (4) conclusion:

the plant biomass can be improved by over-expressing the abscisic acid receptor, so that the yield is improved; meanwhile, the sensitivity to drought is not influenced. Over-expression of a single abscisic acid receptor, or multiple receptors, can significantly increase biomass and thus yield.

Reference to the literature

[1]Huang X,Qian Q,Liu Z,Sun H,He S,Luo D,Xia G,Chu C,Li J,FuX.Natural variation at the DEP1 locus enhances grain yield in rice.NatGenet.2009Apr；41(4):494-7.

[2]Liu J,Chen J,Zheng X,Wu F,Lin Q,Heng Y,Tian P,Cheng Z,Yu X,Zhou K,Zhang X,Guo X,Wang J,Wang H,Wan J.GW5 acts in the brassinosteroid signalingpathway to regulate grain width and weight in rice.Nat Plants.2017Apr 10；3:17043.

[3]Serrano-Mislata A,Bencivenga S,Bush M,Schiessl K,Boden S,SablowskiR.DELLA genes restrict inflorescence meristem function independently of plantheight.Nat Plants.2017Sep；3(9):749-754.

[4]Zhang J,Fengler KA,Van Hemert JL,Gupta R,Mongar N,Sun J,Allen WB,Wang Y,Weers B,Mo H,Lafitte R,Hou Z,Bryant A,Ibraheem F,Arp J,Swaminathan K,Moose SP,Li B,Shen B.Identification and characterization of a novel stay-green QTL that increases yield in maize.Plant Biotechnol J.2019Apr 29.doi:10.1111/pbi.13139.

[5]Miao C,Xiao L,Hua K,Zou C,Zhao Y,Bressan RA,Zhu JK.Mutations in asubfamily of abscisic acid receptor genes promote rice growth andproductivity.Proc Natl Acad Sci U S A.2018Jun 5；115(23):6058-6063.

[6]Liu Y,Chen X,Wang X,Fang Y,Huang M,Guo L,Zhang Y,Zhao H.Improvingbiomass and starch accumulation of bioenergy crop duckweed(Landoltiapunctata)by abscisic acid application.Sci Rep.2018Jun 22；8(1):9544.

[7]Ishida Y,Hiei Y,Komari T.Agrobacterium-mediated transformation ofmaize.Nat Protoc.2007；2(7):1614-21.

[8]Li H,Li J,Cong XH,Duan YB,Li L,Wei PC,Lu XZ,Yang JB.Improvement ofAgrobacterium-mediated transformation in Hi-II maize(Zea mays)using standardbinary vectors.Plant Cell Rep.2008Feb；27(2):297-305.

Sequence listing

<110> Xianzhengda crops Protection shares company (Syngenta Crop Protection AG)

Syngenta Biotechnology China Co., Ltd. (Syngenta Biotechnology China Co., Ltd.)

<120> method for increasing plant biomass and thus increasing yield by overexpressing abscisic acid receptor

<130>81879-CN-REG-ORG-NAT-1

<141>2019-09-02

<160>29

<170>PatentIn version 3.5

<210>1

<211>702

<212>DNA

<213> Artificial sequence

<220>

<223> cZmPYL-C (coding frame sequence)

<400>1

atgagagaga gaaacagctc gatcgatcaa gaacaccaac gaggctctag ctccagatcg 60

acaatgccgt tcgcagcctc aaggacgtca cagcagcagc acagccgtgt ggccaccaac 120

gggagggccg tggcggtgtg cgcgggtcac gcgggcgtgc ccgacgaggt ggcgcggcac 180

cacgagcacg ctgtggcagc ggggcaatgc tgcgccgcca tggtgcagtc catcgcagcg 240

ccggtggacg cggtgtggtc gctggtgcgt cgcttcgacc agccgcagcg gtacaagcgc 300

ttcatcagga gctgccacct cgtggacggc gacggcgccg aggtggggtc cgtgcgggag 360

ctcctgctcg tgtccgggct gcccgccgag agcagccgcg agcggcttga gatccgggac 420

gacgagcggc gggtgatcag cttccgggtc ctgggcggcg accaccgcct ggccaactac 480

cgctccgtga ccaccgtgca cgaggcggcg ccgtcgcagg acgggcgccc gctcaccatg 540

gtcgtcgagt cctacgtggt ggacgtgccg ccggggaaca ccgtcgagga gacgcgcatc 600

ttcgtggaca ccatcgttcg gtgcaacctc cagtccctcg agggcacggt catcaggcag 660

ctggagatcg cggcaatgcc gcacgacgac aaccagaact ga 702

<210>2

<211>233

<212>PRT

<213> Artificial sequence

<220>

<223> cZmPYL-C (protein sequence)

<400>2

Met Arg Glu Arg Asn Ser Ser Ile Asp Gln Glu His Gln Arg Gly Ser

1 5 10 15

Ser Ser Arg Ser Thr Met Pro Phe Ala Ala Ser Arg Thr Ser Gln Gln

20 25 30

Gln His Ser Arg Val Ala Thr Asn Gly Arg Ala Val Ala Val Cys Ala

35 40 45

Gly His Ala Gly Val Pro Asp Glu Val Ala Arg His His Glu His Ala

50 55 60

Val Ala Ala Gly Gln Cys Cys Ala Ala Met Val Gln Ser Ile Ala Ala

65 70 75 80

Pro Val Asp Ala Val Trp Ser Leu Val Arg Arg Phe Asp Gln Pro Gln

85 90 95

Arg Tyr Lys Arg Phe Ile Arg Ser Cys His Leu Val Asp Gly Asp Gly

100 105 110

Ala Glu Val Gly Ser Val Arg Glu Leu Leu Leu Val Ser Gly Leu Pro

115 120 125

Ala Glu Ser Ser Arg Glu Arg Leu Glu Ile Arg Asp Asp Glu Arg Arg

130 135 140

Val Ile Ser Phe Arg Val Leu Gly Gly Asp His Arg Leu Ala Asn Tyr

145 150 155 160

Arg Ser Val Thr Thr Val His Glu Ala Ala Pro Ser Gln Asp Gly Arg

165 170 175

Pro Leu Thr Met Val Val Glu Ser Tyr Val Val Asp Val Pro Pro Gly

180 185 190

Asn Thr Val Glu Glu Thr Arg Ile Phe Val Asp Thr Ile Val Arg Cys

195 200 205

Asn Leu Gln Ser Leu Glu Gly Thr Val Ile Arg Gln Leu Glu Ile Ala

210 215 220

Ala Met Pro His Asp Asp Asn Gln Asn

225 230

<210>3

<211>576

<212>DNA

<213> Artificial sequence

<220>

<223> cZmPYL-H (coding frame sequence)

<400>3

atggtggtgg agatggacgg aggcgtggga gtagcagcag caggaggagg aggagcgcag 60

acgccggcgc cgccgccgcc gcggcggtgg cgcttggcgg acgagcggtg cgacctgcgc 120

gccatggaga cggactacgt gcggcggttc caccggcacg agccccgcga ccaccagtgc 180

tcctccgccg tcgccaagca catcaaggcg cctgtccacc ttgtctggtc cctggtgagg 240

cggttcgacc agccacagct cttcaagccc ttcgtgagcc ggtgtgagat gaaggggaac 300

atcgagatcg gtagcgtcag ggaggtcaac gtcaagtccg ggctgccggc cacaagaagc 360

acggagaggc tcgagctgtt agacgacgac gagcgcattc tcagcgtcag gttcgttgga 420

ggcgatcaca ggctgcaggt atgctctgtt cttcatctat ctatattctg tgctgcccat 480

gcgagatatt ttgcccacca cctcaaatgc gtcctggagt tcctctgcca gatgcatctt 540

gatgtgctgc cctgcgacga tgccatcctc gagtga 576

<210>4

<211>191

<212>PRT

<213> Artificial sequence

<220>

<223> cZmPYL-H (protein sequence)

<400>4

Met Val Val Glu Met Asp Gly Gly Val Gly Val Ala Ala Ala Gly Gly

1 5 10 15

Gly Gly Ala Gln Thr Pro Ala Pro Pro Pro Pro Arg Arg Trp Arg Leu

20 25 30

Ala Asp Glu Arg Cys Asp Leu Arg Ala Met Glu Thr Asp Tyr Val Arg

35 40 45

Arg Phe His Arg His Glu Pro Arg Asp His Gln Cys Ser Ser Ala Val

50 55 60

Ala Lys His Ile Lys Ala Pro Val His Leu Val Trp Ser Leu Val Arg

65 70 75 80

Arg Phe Asp Gln Pro Gln Leu Phe Lys Pro Phe Val Ser Arg Cys Glu

85 90 95

Met Lys Gly Asn Ile Glu Ile Gly Ser Val Arg Glu Val Asn Val Lys

100 105 110

Ser Gly Leu Pro Ala Thr Arg Ser Thr Glu Arg Leu Glu Leu Leu Asp

115 120 125

Asp Asp Glu Arg Ile Leu Ser Val Arg Phe Val Gly Gly Asp His Arg

130 135 140

Leu Gln Val Cys Ser Val Leu His Leu Ser Ile Phe Cys Ala Ala His

145 150 155 160

Ala Arg Tyr Phe Ala His His Leu Lys Cys Val Leu Glu Phe Leu Cys

165 170 175

Gln Met His Leu Asp Val Leu Pro Cys Asp Asp Ala Ile Leu Glu

180 185 190

<210>5

<211>1993

<212>DNA

<213> Artificial sequence

<220>

<223> prZmUbi1 (maize ubiquitin promoter)

<400>5

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca ccggcagcta cgggggattc ctttcccacc 840

gctccttcgc tttcccttcc tcgcccgccg taataaatag acaccccctc cacaccctct 900

ttccccaacc tcgtgttgtt cggagcgcac acacacacaa ccagatctcc cccaaatcca 960

cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc cccccccccc cctctctacc 1020

ttctctagat cggcgttccg gtccatggtt agggcccggt agttctactt ctgttcatgt 1080

ttgtgttaga tccgtgtttg tgttagatcc gtgctgctag cgttcgtaca cggatgcgac 1140

ctgtacgtca gacacgttct gattgctaac ttgccagtgt ttctctttgg ggaatcctgg 1200

gatggctcta gccgttccgc agacgggatc gatttcatga ttttttttgt ttcgttgcat 1260

agggtttggt ttgccctttt cctttatttc aatatatgcc gtgcacttgt ttgtcgggtc 1320

atcttttcat gctttttttt gtcttggttg tgatgatgtg gtctggttgg gcggtcgttc 1380

tagatcggag tagaattctg tttcaaacta cctggtggat ttattaattt tggatctgta 1440

tgtgtgtgcc atacatattc atagttacga attgaagatg atggatggaa atatcgatct 1500

aggataggta tacatgttga tgcgggtttt actgatgcat atacagagat gctttttgtt 1560

cgcttggttg tgatgatgtg gtgtggttgg gcggtcgttc attcgttcta gatcggagta 1620

gaatactgtt tcaaactacc tggtgtattt attaattttg gaactgtatg tgtgtgtcat 1680

acatcttcat agttacgagt ttaagatgga tggaaatatc gatctaggat aggtatacat 1740

gttgatgtgg gttttactga tgcatataca tgatggcata tgcagcatct attcatatgc 1800

tctaaccttg agtacctatc tattataata aacaagtatg ttttataatt attttgatct 1860

tgatatactt ggatgatggc atatgcagca gctatatgtg gattttttta gccctgcctt 1920

catacgctat ttatttgctt ggtactgttt cttttgtcga tgctcaccct gttgtttggt 1980

gttacttctg cag 1993

<210>6

<211>2181

<212>DNA

<213> Artificial sequence

<220>

<223> prAct1 (Rice actin promoter)

<400>6

tgcagcccat ccctcagccg cctttcacta tcttttttgc ccgagtcatt gtcatgtgaa 60

ccttggcatg tataatcggt gaattgcgtc gattttcctc ttataggtgg gccaatgaat 120

ccgtgtgatcgcgtctgatt ggctagagat atgtttcttc cttgttggat gtattttcat 180

acataatcat atgcatacaa atatttcatt acactttata gaaatggtca gtaataaacc 240

ctatcactat gtctggtgtt tcattttatt tgcttttaaa cgaaaattga cttcctgatt 300

caatatttaa ggatcgtcaa cggtgtgcag ttactaaatt ctggtttgta ggaactatag 360

taaactattc aagtcttcac ttattgtgca ctcacctctc gccacatcac cacagatgtt 420

attcacgtct taaatttgaa ctacacatca tattgacaca atattttttt taaataagcg 480

attaaaacct agcctctatg tcaacaatgg tgtacataac cagcgaagtt tagggagtaa 540

aaaacatcgc cttacacaaa gttcgcttta aaaaataaag agtaaatttt actttggacc 600

acccttcaac caatgtttca ctttagaacg agtaatttta ttattgtcac tttggaccac 660

cctcaaatct tttttccatc tacatccaat ttatcatgtc aaagaaatgg tctacataca 720

gctaaggaga tttatcgacg aatagtagct agcatactcg aggtcattca tatgcttgag 780

aagagagtcg ggatagtcca aaataaaaca aaggtaagat tacctggtca aaagtgaaaa 840

catcagttaa aaggtggtat aaagtaaaat atcggtaata aaaggtggcc caaagtgaaa 900

tttactcttt tctactatta taaaaattga ggatgttttt gtcggtactt tgatacgtca 960

tttttgtatg aattggtttt taagtttatt cgcttttgga aatgcatatc tgtatttgag 1020

tcgggtttta agttcgtttg cttttgtaaa tacagaggga tttgtataag aaatatcttt 1080

aaaaaaaccc atatgctaat ttgacataat ttttgagaaa aatatatatt caggcgaatt 1140

aattctcaca atgaacaata ataagattaa aatagctttc ccccgttgca gcgcatgggt 1200

attttttcta gtaaaaataa aagataaact tagactcaaa acatttacaa aaacaacccc 1260

taaagttcct aaagcccaaa gtgctatcca cgatccatag caagcccagc ccaacccaac 1320

ccaacccaac ccaccccagt ccagccaact ggacaatagt ctccacaccc ccccactatc 1380

accgtgagtt gtccgcacgc accgcacgtc tcgcagccaa aaaaaaaaaa agaaagaaaa 1440

aaaagaaaaa gaaaaaacag caggtgggtc cgggtcgtgg gggccggaaa cgcgaggagg 1500

atcgcgagcc agcgacgagg ccggccctcc ctccgcttcc aaagaaacgc cccccatcgc 1560

cactatatac ataccccccc ctctcctccc atccccccaa ccctaccacc accaccacca 1620

ccacctccac ctcctccccc ctcgctgccg gacgacgagc tcctcccccc tccccctccg 1680

ccgccgccgc gccggtaacc accccgcccc tctcctcttt ctttctccgt tttttttttc 1740

cgtctcggtc tcgatctttg gccttggtag tttgggtggg cgagaggcgg cttcgtgcgc 1800

gcccagatcg gtgcgcggga ggggcgggat ctcgcggctg gggctctcgc cggcgtggat 1860

cgatccggcc cggatctcgc ggggaatggg gctctcggat gtagatctgc gatccgccgt 1920

tgttggggga gatgatgggg ggtttaaaat ttccgccatg ctaaacaaga tcaggaagag 1980

gggaaaaggg cactatggtt tatattttta tatatttctg ctgcttcgtc aggcttagat 2040

gtgctagatc tttctttctt ctttttgtgg gtagaatttg aatccctcag cattgttcat 2100

cggtagtttt tcttttcatg atttgtgaca aatgcagcct cgtgcggagc ttttttgtag 2160

gtagaagctg gctgacgccg g 2181

<210>7

<211>1035

<212>DNA

<213> Artificial sequence

<220>

<223> tUbi1 (maize ubiquitin terminator)

<400>7

gtcatgggtc gtttaagctg ccgatgtgcc tgcgtcgtct ggtgccctct ctccatatgg 60

aggttgtcaa agtatctgct gttcgtgtca tgagtcgtgt cagtgttggt ttaataatgg 120

accggttgtg ttgtgtgtgc gtactaccca gaactatgac aaatcatgaa taagtttgat 180

gtttgaaatt aaagcctgtg ctcattatgt tctgtctttc agttgtctcc taatatttgc 240

ctgcaggtac tggctatcta ccgtttctta cttaggaggt gtttgaatgc actaaaacta 300

atagttagtg gctaaaatta gttaaaacat ccaaacacca tagctaatag ttgaactatt 360

agctattttt ggaaaattag ttaatagtga ggtagttatt tgttagctag ctaattcaac 420

taacaatttt tagccaacta acaattagtt tcagtgcatt caaacacccc cttaatgtta 480

acgtggttct atctaccgtc tcctaatata tggttgattg ttcggtttgt tgctatgcta 540

ttgggttctg attgctgcta gttcttgctg aatccagaag ttctcgtagt atagctcaga 600

ttcatattat ttatttgagt gataagtgat ccaggttatt actatgttag ctaggttttt 660

tttacaagga taaattatct gtgatcataa ttcttatgaa agctttatgt ttcctggagg 720

cagtggcatg caatgcatga cagcaacttg atcacaccag ctgaggtaga tacggtaaca 780

aggttcttaa atctgttcac caaatcattg gagaacacac atacacattc ttgccagtct 840

tggttagaga aatttcatga caaaatgcca aagctgtctt gactcttcac ttttggccat 900

gagtcgtgac ttagtttggt ttaatggacc ggttctccta gcttgttcta ctcaaaactg 960

ttgttgatgc gaataagttg tgatggttga tctctggatt ttgttttgct ctcaatagtg 1020

gacgagatta gatag 1035

<210>8

<211>856

<212>DNA

<213> Artificial sequence

<220>

<223> prHvLPT2 (barley aleurone layer specific lipocalin promoter)

<400>8

ctctagagct agtggatctc gatgtgtagt ctacgagaag ggttaaccgt ctcttcgtga 60

gaataaccgt ggcctaaaaa taagccgatg aggataaata aaatgtggtg gtacagtact 120

tcaagaggtt tactcatcaa gaggatgctt ttccgatgag ctctagtagt acatcggacc 180

tcacatacct ccattgtggt gaaatatttt gtgctcattt agtgatgggt aaattttgtt 240

tatgtcactc taggttttga catttcagtt ttgccactct taggttttga caaataattt 300

ccattccgcg gcaaaagcaa aacaatttta ttttactttt accactctta gctttcacaa 360

tgtatcacaa atgccactct agaaattctg tttatgccac agaatgtgaa aaaaaacact 420

cacttatttg aagccaaggt gttcatggca tggaaatgtg acataaagta acgttcgtgt 480

ataagaaaaa attgtactcc tcgtaacaag agacggaaac atcatgagac aatcgcgttt 540

ggaaggcttt gcatcacctt tggatgatgc gcatgaatgg agtcgtctgc ttgctagcct 600

tcgcctaccg cccactgagt ccgggcggca actaccatcg gcgaacgacc cagctgacct 660

ctaccgaccg gacttgaatg cgctaccttc gtcagcgacg atggccgcgt acgctggcga 720

cgtgcccccg catgcatggc ggcacatggc gagctcagac cgtgcgtggc tggctacaaa 780

tacgtacccc gtgagtgccc tagctagaaa cttacacctg caactgcgag agcgagcgtg 840

tgagtgtagc cgagta 856

<210>9

<211>678

<212>DNA

<213> Artificial sequence

<220>

<223> cRed (Red fluorescent protein gene)

<400>9

atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60

accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

cacaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240

gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360

aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420

atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480

acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540

tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660

caccacctgt tcctgtag 678

<210>10

<211>318

<212>DNA

<213> Artificial sequence

<220>

<223> tPI-15 (tomato proteinase inhibitor II terminator)

<400>10

agacttgtcc atcttctgga ttggccaact taattaatgt atgaaataaa aggatgcaca 60

catagtgaca tgctaatcac tataatgtgg gcatcaaagt tgtgtgttat gtgtaattgc 120

tagttatctg aataaaagag aaagagatca tccatatttc ttatcctaaa tgaatgtcac 180

gtgtctttat aattctttga tgaaccagat gcatttcatt aaccaaatcc atatacatat 240

aaatattaat catatataat taatatcaat tgggttagca aaacaaatct agtctaggtg 300

tgttttgcga atgcggcc 318

<210>11

<211>552

<212>DNA

<213> Artificial sequence

<220>

<223> cPAT (Soybean codon-optimized phosphinothricin acetyltransferase gene)

<400>11

atgtctccag agagaaggcc agttgagatt agacctgcta ctgcggccga tatggcagct 60

gtttgtgata ttgttaacca ttatattgag acttctactg ttaacttcag aactgagcca 120

caaactcctc aagagtggat tgatgatctt gagagacttc aagatagata cccttggctt 180

gttgctgagg ttgagggagt tgttgctgga attgcttatg ctggaccttg gaaggctaga 240

aacgcttatg attggactgt tgagtctact gtttatgttt ctcatagaca tcaaagactt 300

ggacttggat ctactcttta tactcatctt cttaagtcta tggaggctca aggattcaag 360

tctgttgttg ctgttattgg acttccaaac gatccatctg ttagacttca tgaggctctt 420

ggatatactg ctagaggaac tcttagagct gctggatata agcatggagg atggcatgat 480

gttggattct ggcaaagaga tttcgagctt ccagctccac caagaccagt tagaccagtt 540

actcaaattt ga 552

<210>12

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223> t35S (cauliflower mosaic virus 35S terminator)

<400>12

cttagtatgt atttgtattt gtaaaatact tctatcaata aaatttctaa ttcctaaaac 60

caaaatccag 70

<210>13

<211>1176

<212>DNA

<213> Artificial sequence

<220>

<223> cPIM (6-phosphomannose isomerase gene)

<400>13

atgcaaaaac tcattaactc agtgcaaaac tatgcctggg gcagcaaaac ggcgttgact 60

gaactttatg gtatggaaaa tccgtccagc cagccgatgg ccgagctgtg gatgggcgca 120

catccgaaaa gcagttcacg agtgcagaat gccgccggag atatcgtttc actgcgtgat 180

gtgattgaga gtgataaatc gactctgctc ggagaggccg ttgccaaacg ctttggcgaa 240

ctgcctttcc tgttcaaagt attatgcgca gcacagccac tctccattca ggttcatcca 300

aacaaacaca attctgaaat cggttttgcc aaagaaaatg ccgcaggtat cccgatggat 360

gccgccgagc gtaactataa agatcctaac cacaagccgg agctggtttt tgcgctgacg 420

cctttccttg cgatgaacgc gtttcgtgaa ttttccgaga ttgtctccct actccagccg 480

gtcgcaggtg cacatccggc gattgctcac tttttacaac agcctgatgc cgaacgttta 540

agcgaactgt tcgccagcct gttgaatatg cagggtgaag aaaaatcccg cgcgctggcg 600

attttaaaat cggccctcga tagccagcag ggtgaaccgt ggcaaacgat tcgtttaatt 660

tctgaatttt acccggaaga cagcggtctg ttctccccgc tattgctgaa tgtggtgaaa 720

ttgaaccctg gcgaagcgat gttcctgttc gctgaaacac cgcacgctta cctgcaaggc 780

gtggcgctgg aagtgatggc aaactccgat aacgtgctgc gtgcgggtct gacgcctaaa 840

tacattgata ttccggaact ggttgccaat gtgaaattcg aagccaaacc ggctaaccag 900

ttgttgaccc agccggtgaa acaaggtgca gaactggact tcccgattcc agtggatgat 960

tttgccttct cgctgcatga ccttagtgat aaagaaacca ccattagcca gcagagtgcc 1020

gccattttgt tctgcgtcga aggcgatgca acgttgtgga aaggttctca gcagttacag 1080

cttaaaccgg gtgaatcagc gtttattgcc gccaacgaat caccggtgac tgtcaaaggc 1140

cacggccgtt tagcgcgtgt ttacaacaag ctgtaa 1176

<210>14

<211>253

<212>DNA

<213> Artificial sequence

<220>

<223> tNOS (Agrobacterium nopaline synthase gene terminator)

<400>14

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 180

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

<210>15

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> forward primer ZmADH1

<400>15

gaacgtgtgt tgggtttgca t 21

<210>16

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> ZmADH1 reverse primer

<400>16

tccagcaatc cttgcacctt 20

<210>17

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> ZmADH1 Probe

<400>17

tgcagcctaa ccatgcgcag ggta 24

<210>18

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> PMI Forward primer

<400>18

gctgtaagag cttactgaaa aaattaaca 29

<210>19

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223> PMI reverse primer

<400>19

cgatctgcag gtcgacgg 18

<210>20

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> PMI Probe

<400>20

tgccgccaac gaatcaccgg 20

<210>21

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> Red Forward primer

<400>21

aagtccatct acatggccaa gaa 23

<210>22

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> Red reverse primer

<400>22

gtgggaggtg atgtccagct t 21

<210>23

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Red Probe

<400>23

cagctgcccg gctactacta cgtggac 27

<210>24

<211>17

<212>DNA

<213> Artificial sequence

<220>

<223> ZmEF Forward primer

<400>24

gcgccgtcac cgtatcc 17

<210>25

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223> ZmEF reverse primer

<400>25

gctcgtcggg cgtcagta 18

<210>26

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> ZmEF Probe

<400>26

atcagaggcg agcagaaacc acaccac 27

<210>27

<211>2049

<212>DNA

<213> Artificial sequence

<220>

<223> prOsPSI33kd (33 kd gene promoter of Rice photosynthesis center I)

<400>27

ggcggattca ctgccattgt tgacgttaag tataaacttt aaccatcaac tcctgcgtta 60

aaaaaataaa atacactatc aaaacttagt ggtaggagtt tactactaac catttccatt 120

agttttgata catataagta tgcgggtcaa ataaggaaaa aatacatccg tcatctgaca 180

aaaatgaagc tctggccaat caagcgcgag cacaaggact aaagggccca tctgactaat 240

caagcgcgag cacaagaact aaagggccca cctgactgtc aaaaccgatt tgagataggg 300

ccaaaccatc tttaaccgtc ataagagtcc acgtatcagt aactgtccaa aatcggtggc 360

cagaaggcgg aggcctagtt cggctgaaca agccgtggtg cccctggcta cccctttcaa 420

tgtggcagct ccccattgga ttgactatgg ctgttatgtg tgcaccaacc tcactaatca 480

ccattacaac catcatttgg cactatgaaa ggaggacctc aacacacttc acaacacaca 540

acaaagtaaa gttttttttt acttagttta cttgagtgat aaatattctc atcgatgcgg 600

gttcgttgct tagttgcaac tgctctagta ctaggactct ataaagaagg aagtttctgt 660

ggaaggttag agattgtgtg ctccacgcaa agtgaggtgg gtagcaggtg gtgacagccc 720

tgcccgtact ttgcatccct ccacgttcgg gcatatcata tagctcaagg ccagactcaa 780

cctaacagat taagggatag ccggtgcgaa acatacgata gagttctatc tttaacttaa 840

gtcaactagt gaagtccata tgaatcctct cttgccaatc ttatcatcaa ttgttgtcct 900

tgggggaatt ctgtttgtag atagtacaca cacgtcttta tttttgatac ccttaaaata 960

ctctaagaga aaatgctaca tcattatttg tgcgcttacg gatttatcag tatgcgtagc 1020

aaataccaac agccaccacc atagagtata gatgagaaaa gtattactct attgtttgtc 1080

tatttctaga agagtataga tgagaaaagt attactctat tgttgtggat atatatatat 1140

ataatgtgat tcagttagga aaatttacaa atagctgttg accatttcca tctacaacga 1200

tgtaaggccc aatgtttttt ttttataatt cctgtttcat ctaacacatt acaaatgtcg 1260

gtcttatgag cgagatcttt aatttttagc attttctttg ggttccctgt gccttcaaga 1320

gaataggttc gtttgtctct tccattcctg acgtggcaag ccttcgttgg ctggaagtag 1380

gatcttcaca gcgccagccc cacaaatgaa agagcccacc accacacgcc ggggaaggag 1440

tggcacctgg gcgtgccacg tcgacgtcca gctcagcatc accatagccc caagccacca 1500

atgggaggcc acgccttatc caatcctctt atcctcctct gccccccttg ctctgcgata 1560

gataacactg tcccgccctc acaaaacgcc cttcacgata caacccacac ggacacggcc 1620

acaccaccca ccaactgaga gctgagcagg cgagcgagcg gacatcgcag catcgctcca 1680

agccgcggcc accctgtagc agccggccaa gctcggcggc cgggcctcct ccgccgcgct 1740

gccatcgcgc ccgtcttcgc acgtcgccag ggcgttcggc gtcgacaccg gtgccgccgg 1800

caggatcacg tgctccctgc agtccgacat ccgggaggtc gccaacaagt gcgccgatcc 1860

cgccaagctc gccggcttcg ccctcgccac ctcagctctg ctcgtctcgg taagacctta 1920

attaggattt aggagtatgt tgcatggcgc gatggccaag gccaaggtgg aaacgatcga 1980

attactatat atgtaacgcc gtgcatgtgg tggccggccg gtgtagggcg ccagcgcgga 2040

gggtaaacc 2049

<210>28

<211>1506

<212>DNA

<213> Artificial sequence

<220>

<223> prAtRD29A (Arabidopsis thaliana drought corresponding gene 29A promoter)

<400>28

gttagcgtca gatatttaat tattcgaaga tgattgtgat agatttaaaa ttatcctagt 60

caaaaagaaa gagtaggttg agcagaaaca gtgacatctg ttgtttgtac catacaaatt 120

agtttagatt attggttaac atgttaaatg gctatgcatg tgacatttag accttatcgg 180

aattaatttg tagaattatt aattaagatg ttgattagtt caaacaaaaa ttttatatta 240

aaaaatgtaa acgaatattt tgtatgttca gtgaaagtaa aacaaattaa attaacaaga 300

aacttataga agaaaatttt tactatttaa gagaaagaaa aaaatctatc atttaatctg 360

agtcctaaaa actgttatac ttaacagtta acgcatgatt tgatggagga gccatagatg 420

caattcaatc aaactgaaat ttctgcaaga atctcaaaca cggagatctc aaagtttgaa 480

agaaaattta tttcttcgac tcaaaacaaa cttacgaaat ttaggtagaa cttatataca 540

ttatattgta attttttgta acaaaatgtt tttattatta ttatagaatt ttactggtta 600

aattaaaaat gaatagaaaa ggtgaattaa gaggagagag gaggtaaaca ttttcttcta 660

ttttttcata ttttcaggat aaattattgt aaaagtttac aagatttcca tttgactagt 720

gtaaatgagg aatattctct agtaagatca ttatttcatc tacttctttt atcttctacc 780

agtagaggaa taaacaatat ttagctcctt tgtaaataca aattaatttt ccttcttgac 840

atcattcaat tttaatttta cgtataaaat aaaagatcat acctattaga acgattaagg 900

agaaatacaa ttcgaatgag aaggatgtgc cgtttgttat aataaacagc cacacgacgt 960

aaacgtaaaa tgaccacatg atgggccaat agacatggac cgactactaa taatagtaag 1020

ttacatttta ggatggaata aatatcatac cgacatcagt tttgaaagaa aagggaaaaa 1080

aagaaaaaat aaataaaaga tatactaccg acatgagttc caaaaagcaa aaaaaaagat 1140

caagccgaca cagacacgcg tagagagcaa aatgactttg acgtcacacc acgaaaacag 1200

acgcttcata cgtgtccctt tatctctctc agtctctcta taaacttagt gagaccctcc 1260

tctgttttac tcacaaatat gcaaactaga aaacaatcat caggaataaa gggtttgatt 1320

acttctattg gaaagaaaaa aatctttgga aaatcgatca aacagaggaa ccaccactca 1380

acacacacca gtagcaccca ggtagattct aatttcagaa acttatattt tttttaagtg 1440

acaatcctct gaatttactt aaacttattg tgatttatgg atacagaagt agttgaacat 1500

aaaacc 1506

<210>29

<211>1870

<212>DNA

<213> Artificial sequence

<220>

<223> prAt1G22690 (Arabidopsis gibberellin regulatory gene promoter)

<400>29

tctcgggtca ttttcctttc tccctcacaa ttaatgtaga ctttagcaat ttgcacgctg 60

tgctttgtct ttatatttag taacacaaac attttgactt gtcttgtaga gtttttctct 120

tttatttttc tatccaatat gaaaactaaa agtgttctcg tatacatata ttaaaattaa 180

agaaacctat gaaaacacca atacaaatgc gatattgttt tcagttcgac gtttcatgtt 240

tgttagaaaa tttctaatga cgtttgtata aaatagacaa ttaaacgcca aacactacat 300

ctgtgttttc gaacaatatt gcgtctgcgt ttccttcatc tatctctctc agtgtcacaa 360

tgtctgaact aagagacagc tgtaaactat cattaagaca taaactacca aagtatcaag 420

ctaatgtaaa aattactctc atttccacgt aacaaattga gttagcttaa gatattagtg 480

aaactaggtt tgaattttct tcttcttctt ccatgcatcc tccgaaaaaa gggaaccaat 540

caaaactgtt tgcatatcaa actccaacac tttacagcaa atgcaatcta taatctgtga 600

tttatccaat aaaaacctgt gatttatgtt tggctccagc gatgaaagtc tatgcatgtg 660

atctctatcc aacatgagta attgttcaga aaataaaaag tagctgaaat gtatctatat 720

aaagaatcat ccacaagtac tattttcaca cactacttca aaataactaa tcaagaaatt 780

tgaagaagtt gattgtggtg gcttttgtta cgctgatcat ctcttttctt ctgctttctc 840

aggtacgccg ctcgtcctcc cccccccccc ctctctacct tctctagatc ggcgttccgg 900

tccaaggtta gggcccggta gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt 960

gttagatccg tgctgctagc gttcgtacac ggatgcgacc tgtacgtcag acacgttctg 1020

attgctaact tgccagtgtt tctctttggg gaatcctggg atggctctag ccgttccgca 1080

gacgggatcg atttcatgat tttttttgtt tcgttgcata gggtttggtt tgcccttttc 1140

ctttatttca atatatgccg tgcacttgtt tgtcgggtca tcttttcatg cttttttttg 1200

tcttggttgt gatgatgtgg tctggttggg cggtcgttct agatcggagt agaattctgt 1260

ttcaaactac ctggtggatt tattaatttt ggatctgtat gtgtgtgcca tacatattca 1320

tagttacgaa ttgaagatga tggatggaaa tatcgatcta ggataggtat acatgttgat 1380

gcgggtttta ctgatgcata tacagagatg ctttttgttc gcttggttgt gatgatgtgg 1440

tgtggttggg cggtcgttca ttcgttctag atcggagtag aatactgttt caaactacct 1500

ggtgtattta ttaattttgg aactgtatgt gtgtgtcata catcttcata gttacgagtt 1560

taagatggat ggaaatatcg atctaggata ggtatacatg ttgatgtggg ttttactgat 1620

gcatatacat gatggcatat gcagcatcta ttcatatgct ctaaccttga gtacctatct 1680

attataataa acaagtatgt tttataatta ttttgatctt gatatacttg gatgatggca 1740

tatgcagcag ctatatgtgg atttttttag ccctgccttc atacgctatt tatttgcttg 1800

gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg ttacttctgc aggtacttgc 1860

agagtaaacc 1870

Claims

1. A method of increasing seedling vigor in a maize plant at seedling stage comprising overexpressing in said maize plant a polynucleotide sequence encoding an abscisic acid receptor, wherein the amino acid sequence of the abscisic acid receptor is selected from the group consisting of SEQ ID NOs 2 and 4.

2. A method of increasing seedling vigor in a maize plant at seedling stage comprising overexpressing in said maize plant a polynucleotide sequence encoding an abscisic acid receptor, wherein said polynucleotide sequence encoding an abscisic acid receptor is selected from the group consisting of SEQ ID NOs 1 and 3.

3. The method of claim 1 or 2, wherein the overexpression is driven by a plant ubiquitin promoter or a plant actin promoter.

4. The method of claim 3, wherein the plant ubiquitin promoter is the maize ubiquitin promoter prZmUbi1, the sequence of which is shown in SEQ ID NO 5.

5. The method of claim 3, wherein the plant actin promoter is the rice actin promoter, prAct1, the sequence of which is shown in SEQ ID NO 6.

6. The method of claim 1 or 2, wherein the overexpression is driven by a plant inducible promoter or a plant organ specific promoter.

7. The method of claim 6, wherein the plant-inducible promoter is the Arabidopsis drought-inducible promoter prAtRD29A shown in SEQ ID NO 28 or other drought-inducible promoters.

8. The method of claim 6, wherein said plant organ-specific promoter is the green organ-specific promoter prOsPSI33kd shown in SEQ ID NO. 27, the stomata-specific promoter prAt1G22690 shown in SEQ ID NO. 29, or a similar promoter.

9. The method of claim 1 or 2, wherein the overexpression is achieved by modulating DNA methylation or histone modification or variable cleavage.

10. The method according to claim 1 or 2, wherein said overexpression is achieved by means of gene editing.