CN114317549A - Application of muscarinic C-type acetylcholine receptors in the control of migratory locusts - Google Patents

Abstract

The invention belongs to the field of biotechnology, and in particular relates to the application of a muscarinic C-type acetylcholine receptor (C-typemuscarinic acetylcholine receptor, mAChR-C) in the control of migratory locusts. The present invention shows that after silencing the expression of the mAChR-C gene of the migratory locust larvae, a large number of lethal and eclosion hindwing deformities occur, and the population growth and migration harm of the migratory locust population are effectively suppressed. The expression of mAChR‑C gene can achieve a good effect on the control of migratory locusts. The cultivation of transgenic crops stably expressing mAChR-C double-stranded RNA provides a new method for field control of migratory locusts.

Description

Application of muscarinic C-type acetylcholine receptors in the control of migratory locusts

technical field

The invention belongs to the field of biotechnology, and in particular relates to the application of muscarinic C-type acetylcholine receptors in the control of migratory locusts.

Background technique

The migratory locust (Locusta migratoria) is a migratory omnivorous pest that likes to eat wheat, corn and other food crops, and is an important agricultural pest in my country and even in the world. The reason why migratory locusts are prone to outbreaks is closely related to their long-distance migration ability and high fecundity. At present, the prevention and control of pests is mainly based on the control strategy of chemical pesticides, but the implementation and use of pesticides not only easily lead to the increase of pest resistance and the increase of control costs, but also cause pesticide residues, pollute the ecological environment, and endanger human health. Therefore, it is urgent to find efficient, specific and sustainable green locust control methods to replace chemical pesticides.

RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing phenomenon caused by small double-stranded RNA (dsRNA). It has the characteristics of high efficiency and specificity, and has gradually become a potential pest control technology. The technical key of RNA interference for pest control is to obtain dsRNA with high interference efficiency against pest target genes, and the more important technical difficulty is how to effectively transfer dsRNA into pests in the field to achieve gene silencing and pest control. Apply the effect. In the past, RNAi-mediated pest control often achieved gene silencing by injection, mixed feed feeding, etc., but these methods were less applicable in field pest control. In 2007, the first report of using transgenic plants to express pest gene dsRNA to control cotton bollworm appeared. The way of expressing dsRNA of pest target gene in transgenic plants provides an effective solution for field management of pests.

G-protein coupled receptors (GPCRs) are a superfamily of seven-transmembrane proteins that mediate extracellular signal transduction into cells and play an important role in the regulation of insect physiological processes. Through previous work, the inventors identified a gene encoding a GPCR protein in migratory locusts. Sequence analysis and alignment showed that the GPCR was homologous to the identified Drosophila muscarinic acetylcholine receptor (mAChR-C) protein. However, the specific role of mAChR-C in insect growth and development has not been reported.

SUMMARY OF THE INVENTION

The present invention finds that after using RNA technology to interfere with mAChR-C expression, locust larvae appear a large number of lethal and eclosion hindwing deformities; in addition, the present invention adopts the method of transgenic crops to successfully cultivate a stable expression of mAChR-C double-stranded RNA. Maize plants, feeding experiments showed that after the locust larvae fed the transgenic plants, the expression of the target gene mAChR-C decreased by 79%, resulting in the death of the locust larvae and the deformity of the hind wings after eclosion. The total lethality and wing deformity rate reached 73.9 %, which can effectively inhibit the growth and migration of migratory locust populations. The invention provides a new method for the prevention and treatment of migratory locusts, and has a large application prospect.

The present invention adopts following technical scheme:

According to the locust mAChR-C gene sequence, design and synthesize double-stranded RNA (dsmAChR-C), inject dsmAChR-C into the fifth instar larvae within 12 hours of molting, and inject green fluorescent protein double-stranded RNA (dsGFP) at the same time. The fifth instar larvae of the locust molting within 12 hours were used as the control group. Wherein, the sequence of the migratory locust mAChR-C gene is as shown in SEQ ID NO:1, and the amino acid sequence encoded by the migratory locust mAChR-C gene is as shown in SEQ ID NO:2, which is used to synthesize dsmAChR-C and dsGFP. The DNA template sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

The results showed that when the interference efficiency of mAChR-C was 82%, the mortality rate of locust larvae was 53.1%, the rate of eclosion hind wing deformity was 18.6%, the combined lethal rate and wing deformity rate reached 71.7%, and the survival rate of normal eclosion was 71.7%. 28.3%, the normal survival rate was significantly lower than the dsGFP control group (100%).

In order to analyze the role of mAChR-C in the growth and development of locust larvae, and the molecular mechanism of larval death and hindwing deformity after silencing mAChR-C expression, after interfering with mAChR-C gene expression, qRT-PCR was used to detect mAChR - Gene expression related to chitin synthesis and degradation in the C interference group and the GFP control group. The results showed that mAChR-C interference group chitin degradation related genes chitinase5-1 (CHT5-1), chitinase5-2 (CHT5-2), chitinase 10 (CHT10), and chitin synthesis related gene chitinsynthesis 1 (CHS1) , UDP-N-acetylglucosamine pyrophosphorylase 2 (UAP2) mRNA level decreased significantly. The above results indicate that mAChR-C is involved in regulating the expression of chitin metabolism-related genes, which in turn affects epidermal chitin metabolism during larval growth and development. The epidermis of the fifth instar larvae on the 5th day after dsRNA treatment in the mAChR-C interference group and the GFP control group were further selected, and tissue section staining was performed to observe the epidermal morphology. The results of chitin staining showed that the thickness of the old epidermis was significantly increased and the thickness of the new epidermis was significantly decreased in the dsmAChR-C-treated larvae compared with the control group, indicating that after mAChR-C expression silencing, the exfoliation of the old epidermis and the formation of the new epidermis were inhibited. In conclusion, after RNAi technology inhibited mAChR-C expression, the normal growth of epidermis was affected, which hindered the normal growth of locust larvae, resulting in death and deformity of the eclosion hind wings.

In order to verify the application prospect of RNAi technology-mediated mAChR-C expression silencing in crop pest control. The template for synthesizing dsmAChR-C shown in SEQ ID NO: 3 was integrated into the genome of maize immature embryos by Agrobacterium transformation method to obtain transgenic maize stably expressing mAChR-C double-stranded RNA. The leaves of transgenic maize were fed to fifth-instar larvae of locusts. The results of the feeding experiment showed that the survival rate of individuals fed wild-type maize leaves was 97.2%. The mAChR-C expression level of individuals fed dsmAChR-C transgenic maize leaves decreased by 79.0% compared with the wild-type maize control group, and the mortality rate was 53.2%. The mortality rate and wing deformity rate totaled 73.9%. The survival rate of normal molting and feathering was 26.1%, and the survival rate was significantly lower than that of the dsGFP control group (97.2%).

The beneficial effects of the present invention are:

Through in vitro injection and feeding on transgenic crops, it has been proved that after the silencing of mAChR-C gene expression in migratory locust larvae, a large number of larvae are killed and the hind wings deformed after emergence, which effectively inhibits the growth of the migratory locust population and the harm of migration. Inhibiting the expression of mAChR-C can achieve a good effect on the control of migratory locusts. The cultivation of transgenic crops stably expressing mAChR-C double-stranded RNA provides a new method for field control of migratory locusts.

Description of drawings

Figure 1 shows the gene interference efficiency after double-stranded RNA injection in epidermal tissue. *** indicates P<0.001.

Figure 2 shows the effect of interfering mAChR-C expression on larval survival rate and eclosion hindwing type. (A) Survival of locust larvae after interference with mAChR-C expression. (B) Phenotypic statistics of larvae after interference with mAChR-C expression. (C) Statistics of fifth instar larvae after interference with mAChR-C expression. (* means P<0.05; ** means P<0.01).

Figure 3 shows the effects of dsmAChR-C injection on chitin metabolism genes and epidermal chitin. (A) Expression levels of genes related to chitin degradation and synthesis after dsmAChR-C injection. (B) Larval body wall staining after dsmAChR-C injection. Nuclei were labeled with propidium iodide (PI); chitin was stained with Fluorescent Brightener 28 (FB 28). The ruler length is 50 μm. During normal molting, the old epidermis separates from the epithelial cell layer, sloughs off, and is replaced by a new epidermis. (C) Epidermal thickness index after dsmAChR-C injection. ** means P<0.01; *** means P<0.001.

Figure 4 shows PCR identification of positive transgenic maize plants. Note: Maker: DL1500; mAChR-C represents a synthetic template that has been integrated into the maize genome and can stably express dsmAChR-C.

Figure 5 shows the effect of feeding transgenic maize on larval survival rate and eclosion hindwing type. (A) Interference efficiency of mAChR-C gene in larval epidermis after feeding transgenic maize. (B) Survival of larvae after feeding transgenic maize. (C) Phenotypic statistics of locusts after feeding transgenic maize. (D) Statistics of fifth instar larvae after feeding transgenic maize. (** means P<0.01; *** means P<0.001).

Detailed ways

The present invention will be described in more detail below through specific embodiments, so as to facilitate the understanding of the technical solutions of the present invention, but it is not intended to limit the protection scope of the present invention.

1. Obtaining the full-length coding sequence of the locust toadstool type C-type acetylcholine receptor gene

Based on the locust transcriptome database (http://159.226.67.243/), the sequence of the locust muscarinic C-type acetylcholine receptor (mAChR-C) gene was searched by bioinformatics methods, and the mAChR-C gene was obtained. partial sequence. Primer premier 6.0 software was used to design the RACE primers required for the rapid cDNA end cloning technology for this part of the sequence, and sent to Beijing Liuhe Huada Gene Technology Co., Ltd. for synthesis.

The primer sequences used to amplify the 5' and 3' ends of the mAChR-C gene by the cDNA end rapid cloning technique are as follows: mAChR-C-5'RACE (SEQ ID NO: 5): 5'-ACCCAAGACCAAAAGTACGACCTGGA-3'; mAChR-C - 3'RACE (SEQ ID NO: 6): 5'-TGATAGTCTCAGTCGGCTGGATCCTTTC-3'.

RACE 5’/3’试剂盒说明书步骤)扩增获得mAChR-C基因5`端和3`端序列，并将此片段送北京六合华大基因科技有限公司测序(后续所有引物合成和测序均在北京六合华大基因科技有限公司完成)。利用BioEdit软件将飞蝗转录组数据库序列和PCR扩增的序列进行拼接及比对后，获得mAChR-C全长开放阅读框(Open Reading Frame,ORF)，ORF序列全长为1005bp，如SEQ ID NO:1所示；该ORF序列编码334个氨基酸，如SEQ ID NO:2所示。Select healthy adult migratory locusts (gregarious East Asian locust population), and extract total RNA from epidermis by Trizol method. According to the instructions of Tiangen's FastKing cDNA first-strand synthesis kit, the above-mentioned total RNA was reverse transcribed to synthesize the first cDNA. Using this cDNA as a template, combined with the upstream and downstream primers shown in SEQ ID NO: 5 and SEQ ID NO: 6, through the cDNA end rapid cloning technology (according to Clontech company

RACE 5'/3' kit instructions) to amplify the 5' and 3' ends of mAChR-C gene, and send this fragment to Beijing Liuhe Huada Gene Technology Co., Ltd. for sequencing (all subsequent primer synthesis and sequencing are performed in Beijing Liuhe Huada Gene Technology Co., Ltd. completed). After splicing and aligning the locust transcriptome database sequence and PCR-amplified sequence using BioEdit software, the full-length open reading frame (ORF) of mAChR-C was obtained, and the full-length ORF sequence was 1005 bp, as shown in SEQ ID NO: 1; the ORF sequence encodes 334 amino acids, as shown in SEQ ID NO: 2.

2. Acquired locust mAChR-C double-stranded RNA

Based on the above-obtained ORF sequence of mAChR-C shown in SEQ ID NO: 1, primers for synthesizing DNA templates of dsRNA were designed using primerpremier 6.0 software, the sequences of which are SEQ ID NO: 7 and SEQ ID NO: 8, respectively. Then it was sent to Beijing Liuhe Huada Gene Technology Co., Ltd. for synthesis.

Primers used to amplify mAChR-C dsRNA template:

SEQ ID NO: 7: 5'-GTGCTGCCACAAGCCTATATC-3';

SEQ ID NO: 8: 5'-ACCAACAGATGGAGAATGAACC-3'.

Using the cDNA synthesized by reverse transcription in 1 as a template, using the upstream and downstream primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 to carry out PCR amplification, the PCR reaction conditions are (1) pre-denaturation 95 ° C, 3min ; (2) 95°C, 30s; 58°C, 30s; 72°C, 40s, a total of 35 cycles; (3) extension at 72°C, 5min. The single product obtained by PCR amplification was ligated into pGEM-T (Tiangen) vector to obtain the recombinant plasmid pGEM-T-mAChR-C. The sequencing result showed that the PCR amplification product was 202bp in size, and its nucleotide sequence was shown in SEQ ID NO:3.

SV Gel and PCR Clean-Up System(Promega)试剂盒纯化目的片段。NanoDrop 2000测浓度，并确定其浓度在125～1000ng/μl。The recombinant plasmid pGEM-T-mAChR-C obtained above was used as a template, and the paired primer dsmAChR-C-T7-F/dsmAChR-C-T7-R with the T7 promoter sequence was used for PCR amplification to obtain a synthetic DNA template of double-stranded RNA (that is, the sequence shown in SEQ ID NO: 3 with T7 promoter at both ends, underlined as T7 promoter sequence), the PCR reaction conditions are (1) pre-denaturation at 95°C for 3 min; ( 2) 95°C, 30s; 58°C, 30s; 72°C, 40s, a total of 35 cycles; (3) extension at 72°C, 5min. use

SV Gel and PCR Clean-Up System (Promega) kits were used to purify the target fragments. NanoDrop 2000 measured the concentration and determined its concentration to be between 125 and 1000ng/μl.

dsmAChR-C-T7-F:

5'- TAATACGACTCACTATAGGGTGCTGCCACAAGCCTATATC -3';

dsmAChR-C-T7-R:

5'- TAATACGACTCACTATAGGACCAACAGATGGAGAATGAACC -3'.

Using the DNA obtained above with the T7 promoter sequence at both ends as a template, according to the instructions of the T7RiboMAX ^™ ExpressRNAi System (Promega) kit, double-stranded RNA was synthesized by in vitro transcription. Use NanoDrop 2000 to measure the concentration and put it at -20°C for use.

3. The locust mAChR-C double-stranded RNA interferes with locust larvae

3.1 Double-stranded RNA injection in locusts

The fifth instar larvae within 12 hours after molting were selected as experimental materials, and randomly divided into dsmAChR-C treatment group and dsGFP control group (because there is no green fluorescent protein GFP gene in migratory locusts, it can be used as a negative control), each Group 28 to 30 heads, repeat 3 times. 9μg dsmAChR-C was injected from the larval abdominal third somite with a 10μL microinjector, and the larvae injected with the same dose of dsGFP were used as the control group. The injected locusts were reared in a well-ventilated metal cage (25cm×25cm×25cm), the temperature was 30±2°C, and the photoperiod was 14L:10D, and they were fed with fresh wheat seedlings and wheat bran, twice a day. The death of larvae was observed and counted every day after injection, and the wing deformity rate and the fifth instar development period were counted after eclosion.

3.2 Detection of locust mAChR-C double-stranded RNA interference efficiency

After 48 hours of dsRNA injection, 8 larvae were randomly selected from the dsmAChR-C treatment group and the dsGFP control group to detect the efficiency of mAChR-C double-stranded RNA interference. The total RNA of the epidermal tissue of the migratory locust larvae in the interference group and the control group was extracted, and the first-strand cDNA was synthesized by reverse transcription. qRT-PCR upstream and downstream primers of C and qRT-PCR upstream and downstream primers of β-actin were performed on LightCycler 96 (Roche) to detect the target gene (mAChR-C) and the reference gene (β-actin) respectively. The PCR reaction conditions were (1) 95°C for 10 min; (2) 95°C, 10s; 58°C, 30s; 72°C, 30s, a total of 40 cycles; (3) dissolution curve analysis 95°C, 60s ; 65℃, 30s; 95℃, 30s. Then, the relative expression of mAChR-C in the epidermis of larvae in the treatment group and the control group was calculated according to the 2- ^ΔΔCt method, and the gene silencing efficiency was analyzed. The results are shown in Figure 1. Compared with the dsGFP control group, mAChR-C expression in the dsmAChR-C-treated group decreased by 82%, indicating that mAChR-C gene expression was effectively silenced.

qRT-PCR primers:

mAChR-C-qRT-F: 5'-CAGAGAAAGTGATATGGGCAACAA-3';

mAChR-C-qRT-R: 5'-GAACTGGCAGGAAGTATAACAAGT-3'.

β-actin-qRT-F: 5'-AATTACCATTGGTAACGAGCGATT-3';

β-actin-qRT-R: 5'-TGCTTCCATACCCAGGAATGA-3'.

3.3 Interfering with mAChR-C expression leads to larval lethality and deformity of the eclosion hindwing

After the double-stranded RNA injection, the phenotype of the locust larvae was observed every day until the eclosion of all experimental larvae was completed. The results showed that the mortality rate of the dsmAChR-C interference group was 53.1%, the deformity rate of the eclosion hindwing was 18.6%, and the proportion of normal molting eclosion was 28.3%, which was significantly lower than the survival rate of the normal molting eclosion in the dsGFP control group (100.0%). As shown in Figures 2A and 2B. In addition, the fifth instar development period of larvae in the dsmAChR-C treatment group was significantly longer than that in the control group, as shown in Figure 2C.

4. The mechanism of mAChR-C in the process of locust emergence

In order to analyze the role of mAChR-C in the growth and development of locust larvae, and the molecular mechanism of lethality and wing deformity after mAChR-C expression silencing, after interfering with mAChR-C expression, qRT-PCR was used to detect the interaction with chitin. The expression of synthesis and degradation-related genes was further observed by tissue section staining to further observe the changes of epidermal morphology in the interference group (dsmAChR-C) and the control group (dsGFP).

4.1 Expression of chitin metabolism-related genes

Using the samples of the interference group (dsmAChR-C) and the control group (dsGFP) 48 hours after the dsRNA injection obtained in 3.1, the expression of five genes related to chitin metabolism after mAChR-C gene silencing was detected by qRT-PCR.

qRT-PCR primers:

Gene Forward primer (5'-3') Reverse primer (5'-3') CHS1 CTTGAGCCAATTGGTTTGGT TGAGTTCTGTGGATGCAAGG UAP2 GTACCTAAATGCTCATGGTGTGGAT GTCCACCTGGCAAACAACTCCT CHT5-1 CATCAAAGCGAAGGGGCTACGGC AGATTAGTGCGTCCTTCGGGCCA CHT5-2 CAAGGATTATGTGGAGAACC TCCACAGTGTTTGTTTTCTTTGATT CHT10 GCAATTGGTGGTTGGAATGAT GGTCTAGTCCTTCAAATCCATACTTTTC β-actin AATTACCATTGGTAACGAGCGATT TGCTTCCATACCCAGGATGA

The results are shown in Figure 3. Chitin synthase 1 (CHS1), UDP-N-acetylglucosamine phosphorylase 2 (UDP-N-acetylglucosamine phosphorylase, UAP2), chitinase 5 The transcript levels of -1 (Chitinse5-1, CHT5-1), chitinase 5-2 (Chitinse5-2, CHT5-2), and chitinase 10 (Chitinse 10, CHT10) were significantly lower than those of the control group. The transcript levels of the genes CHS1 and UAP2 related to chitin synthesis decreased by 76.0% and 82.0%, respectively, and the transcript levels of the genes CHT5-1, CHT5-2 and CHT10 related to chitin degradation decreased by 58.0%, 93.6% and 58.6%, respectively. 86.1%. The results indicated that mAChR-C was involved in regulating the expression of chitin metabolism-related genes, which in turn affected epidermal chitin metabolism during larval growth and development.

4.2 Histological observation of epidermal changes

In order to further detect the effect of mAChR-C on epidermal chitin, in this example, the method of tissue section staining was used to microscopically observe the epidermis of sections 3 to 4 of the migratory locusts in the interference group and the control group on the 5th day after dsRNA injection. Propidium iodide (PI) stained cell nuclei (red), and Fluorescent Brightener 28 (FB 28) stained chitin (blue). The results are shown in Figures 3B and 3C, in the larval epidermis of the interference group, the thickness of the old epidermis was significantly higher than that of the larvae of the control group, while the thickness of the new epidermis of the larvae of the interference group was significantly lower than that of the control group. After measurement and statistics, the average thickness index of the new epidermis in the interference group was 95.0% lower than that in the control group, while the average thickness index of the old epidermis in the interference group was significantly higher than that in the control group by 2.5 times. Causes of hindwing deformities and developmental delays.

5. Application of mAChR-C double-stranded RNA transgenic maize in the control of migratory locusts

5.1 Construction of transformation vector

Design primers containing two restriction sites of BamHI and SpeI, use pGEM-T-mAChR-C plasmid as a template, carry out PCR amplification, and recover and purify the PCR product (that is, SEQ ID NO: 3 containing BamHI and SpeI in the upstream and downstream, respectively ). Through double digestion and infusion reaction, the gene fragment (SEQ ID NO: 3) of the dsmAChR-C synthetic template was connected to the two multiple cloning sites of BamHI and SpeI on the pWMB006 vector in forward and reverse directions respectively. After successful connection, E. coli was transformed, and positive clones were screened. The positive clones with correct sequencing were the recombinant plasmids pWMB006-mAChR-C.

5.2 Agrobacterium-mediated construction of transgenic maize stably expressing mAChR-C double-stranded RNA

Maize transgenic manipulation using Agrobacterium transformation method. The experimental flow of maize genetic transformation is as follows:

(1) The pWMB006-mAChR-C recombinant plasmid was transferred into Agrobacterium EHA105 by electroporation and identified by PCR.

(2) Using corn variety KN5855, using freshly peeled corn embryos of about 1 mm as the material, put the peeled corn embryos into a 2 mL plastic centrifuge tube containing 1.8 mL of Agrobacterium suspension, and treat the immature within 30 minutes. 150 immature embryos; suck off the Agrobacterium suspension, the remaining corn embryos are in the tube, then add 1.0 mL of the Agrobacterium suspension, and leave it for 5 minutes.

(3) The immature embryos in the centrifuge tube were suspended and poured onto the co-culture medium, and the excess Agrobacterium liquid on the surface was removed with a pipette, and co-cultured at 23° C. in the dark for 3 days.

(4) After co-cultivation, transfer the immature embryos to the resting medium, and after culturing in the dark at 28°C for 6 days, put them on the screening medium containing bialaphos, start the screening culture for two weeks, and then replace with a new screening medium basal screening culture for 2 weeks.

(5) Transfer the resistant callus to differentiation medium at 25°C, 5000lx, and cultivate in light for 3 weeks; transfer the differentiated seedlings to rooting medium, at 25°C, 5000lx, and cultivate in light until rooting; Transfer to a small pot for growth, transplant in a greenhouse after a certain growth stage, and harvest offspring seeds after 3 to 4 months. The seeds are transgenic maize seeds stably expressing mAChR-C double-stranded RNA.

(6) Extracting the genomic DNA of the maize leaves of the T0 generation, after PCR detection, positive plants were obtained, as shown in Figure 4, the positive plants were taken for the next feeding experiment.

5.3 Detection of locust control effect of transgenic maize stably expressing mAChR-C double-stranded RNA

Transgenic maize leaves stably expressing mAChR-C double-stranded RNA were fed to observe and analyze the effects on the growth and development of fifth instar larvae of migratory locusts.

(1) Select fifth instar larvae within 12 hours after molting, 17 to 20 larvae in each group, and repeat 3 times. Leaves were clipped from plants identified as positive, carefully cleaned and fed to larvae, while larvae fed wild-type maize leaves were used as a control group.

(2) Feed an appropriate amount of corn leaves according to the number of larvae, and keep corn leaves sufficient.

(3) After 48 hours of feeding, 5 larvae were randomly picked from the treatment group (fed with transgenic maize) and the control group (fed with wild-type maize), and their epidermal tissues were collected. Expression of mAChR-C in tissues (ie, detection of gene interference efficiency). The detection method is the same as 3.2.

(4) From the day of feeding, observe and record larval death, developmental duration and post-eclosion deformity phenotypes in the transgenic maize feeding group and the wild-type maize feeding group every day.

The results showed that the expression level of mAChR-C decreased by 79% in larvae fed on transgenic maize leaves, as shown in Figure 5A; the survival rate of individuals fed on wild-type maize leaves was 97.2%; the mortality rate of larvae fed transgenic maize was 53.2%, eclosion The hindwing deformity rate was 20.7%, the lethality rate and wing deformity rate totaled 73.9%, and the survival rate of normal molting and eclosion was 26.1%, as shown in Figures 5B and 5C; The wild-type maize control group fed the transgenic maize larvae had an instar age of 7.2 days, which was significantly longer than that fed the wild-type maize larvae (6.2 days), as shown in Figure 5D.

The above-mentioned embodiments are only preferred embodiments of the present invention and do not limit the scope of implementation of the present invention. Therefore, any equivalent changes or modifications made in accordance with the structures, features and principles described in the patent scope of the present invention are It should be included in the scope of the patent application of the present invention.

SEQUENCE LISTING

<110> Henan University

Application of <120> C-type acetylcholine receptor in locust control

<130> None

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 1005

<212> DNA

<213> locusta migratoria

<400> 1

atgtcaggac cttccaatga aaccttgttg gggaactatt caacagaaac tgaagacgag 60

atattatttg gaatgccaga gaaagtgata tgggcaacaa ttgatggggc cctgatgata 120

ccaatattag cagggaacat cataacaatc tgtgcaattt tatggtgtcg acgtctgtca 180

agtgtactat cgaaccagtt tatcttgaac ttggcaatat cggatttgtt agtaggtcta 240

ttttttgccat atcacatggc attctcaata atcactgaac tgaacaagta caagaacacc 300

tgtttactgc ggtttatact tgttatactt cctgccagtt cttcaatata taatctcata 360

gcaattgcta ctgataggta tatttctatt gtgtacccac tacattattc aacatacatg 420

acagcaagga aagccttact gatagtctca gtcggctgga tcctttctgc cattgtatca 480

acaatgccaa gctattggaa taaatacagt gcagacaagg catgtttggt tgacaatgtg 540

ctgccacaag cctatatcat aggtatcatc acaccagcat ttgttctggt gctgatagcc 600

atgttggtac tttactggcg aatatggaag gaagcttcag aacaagccag aagacttcga 660

aatgttacaa actctcactc agattggaaa tctgtccagg tcgtactttt ggtcttgggt 720

tcattctcca tctgttggtt accctacttc acagtcatct gttgccgcgt agctggtgca 780

aaatcttata catccttcat ggtttataaa gcagcatttt ctatggggat ggccaactcg 840

tgcataaatc cactgattta tgcatggaaa aacaccgaat ttaagaatgc ttttagaaat 900

atacttcatt gtaaatcacc aaaccgagca gatcatctac tagaaactat aactacacat 960

actgaactgc atactattga cagctcatgt ggaggtttca attaa 1005

<210> 2

<211> 334

<212> PRT

<213> Locusta migratoria

<400> 2

Met Ser Gly Pro Ser Asn Glu Thr Leu Leu Gly Asn Tyr Ser Thr Glu

1 5 10 15

Thr Glu Asp Glu Ile Leu Phe Gly Met Pro Glu Lys Val Ile Trp Ala

20 25 30

Thr Ile Asp Gly Ala Leu Met Ile Pro Ile Leu Ala Gly Asn Ile Ile

35 40 45

Thr Ile Cys Ala Ile Leu Trp Cys Arg Arg Leu Ser Ser Val Leu Ser

50 55 60

Asn Gln Phe Ile Leu Asn Leu Ala Ile Ser Asp Leu Leu Val Gly Leu

65 70 75 80

Phe Leu Pro Tyr His Met Ala Phe Ser Ile Ile Thr Glu Leu Asn Lys

85 90 95

Tyr Lys Asn Thr Cys Leu Leu Arg Phe Ile Leu Val Ile Leu Pro Ala

100 105 110

Ser Ser Ser Ile Tyr Asn Leu Ile Ala Ile Ala Thr Asp Arg Tyr Ile

115 120 125

Ser Ile Val Tyr Pro Leu His Tyr Ser Thr Tyr Met Thr Ala Arg Lys

130 135 140

Ala Leu Leu Ile Val Ser Val Gly Trp Ile Leu Ser Ala Ile Val Ser

145 150 155 160

Thr Met Pro Ser Tyr Trp Asn Lys Tyr Ser Ala Asp Lys Ala Cys Leu

165 170 175

Val Asp Asn Val Leu Pro Gln Ala Tyr Ile Ile Gly Ile Ile Thr Pro

180 185 190

Ala Phe Val Leu Val Leu Ile Ala Met Leu Val Leu Tyr Trp Arg Ile

195 200 205

Trp Lys Glu Ala Ser Glu Gln Ala Arg Arg Leu Arg Asn Val Thr Asn

210 215 220

Ser His Ser Asp Trp Lys Ser Val Gln Val Val Leu Leu Val Leu Gly

225 230 235 240

Ser Phe Ser Ile Cys Trp Leu Pro Tyr Phe Thr Val Ile Cys Cys Arg

245 250 255

Val Ala Gly Ala Lys Ser Tyr Thr Ser Phe Met Val Tyr Lys Ala Ala

260 265 270

Phe Ser Met Gly Met Ala Asn Ser Cys Ile Asn Pro Leu Ile Tyr Ala

275 280 285

Trp Lys Asn Thr Glu Phe Lys Asn Ala Phe Arg Asn Ile Leu His Cys

290 295 300

Lys Ser Pro Asn Arg Ala Asp His Leu Leu Glu Thr Ile Thr Thr His

305 310 315 320

Thr Glu Leu His Thr Ile Asp Ser Ser Cys Gly Gly Phe Asn

325 330

<210> 3

<211> 202

<212> DNA

<213> Artificial sequences

<400> 3

gtgctgccac aagcctatat cataggtatc atcacaccag catttgttct ggtgctgata 60

gccatgttgg tactttactg gcgaatatgg aaggaagctt cagaacaagc cagaagactt 120

cgaaatgtta caaactctca ctcagattgg aaatctgtcc aggtcgtact tttggtcttg 180

ggttcattct ccatctgttg gt 202

<210> 4

<211> 260

<212> DNA

<213> Artificial sequences

<400> 4

cttcaaaatt agacacaaca ttgaagatgg aagcgttcaa cttgcagacc attatcaaca 60

aaatactcca attggcgatg gccctgtcct tttaccagat aaccattacc tgtccacaca 120

atctaccctt tccaaagatc ccaacgaaaa gagagatcac atgatctatt ttgagtttgt 180

aacagctgct gcgattacac atggcatgga tgaattatac aaataaatgt atagacttca 240

agttgacact aacgtgtccg 260

<210> 5

<211> 26

<212> DNA

<213> Artificial sequences

<400> 5

acccaagacc aaaagtacga cctgga 26

<210> 6

<211> 28

<212> DNA

<213> Artificial sequences

<400> 6

tgatagtctc agtcggctgg atcctttc 28

<210> 7

<211> 21

<212> DNA

<213> Artificial sequences

<400> 7

gtgctgccac aagcctatat c 21

<210> 8

<211> 22

<212> DNA

<213> Artificial sequences

<400> 8

accaacagat ggagaatgaa cc 22

Claims (8)

1. the application of the toadstool type C type acetylcholine receptor gene in the control of migratory locusts, it is characterized in that, the toadstool type C type acetylcholine receptor gene in the silencing migratory locust larvae is to realize the control of migratory locusts, and the toadstool type C type acetylcholine receptor gene is affected by the control of migratory locusts. The sequence of the somatic gene mAChR-C is shown in SEQ ID NO:1. 2. application according to claim 1, is characterized in that, by RNA interference technology silencing the toadstool type C-type acetylcholine receptor gene in migratory locust larvae. 3. The application of the double-stranded RNA synthesized based on the muscarinic type C-type acetylcholine receptor gene in the control of migratory locusts, the sequence of the DNA template for synthesizing the double-stranded RNA is shown in SEQ ID NO: 3. 4. application according to claim 3, is characterized in that, locust larvae are injected double-stranded RNA in vitro to realize locust control. 5. application according to claim 3, it is characterised in that migratory locust larvae eat transgenic crops to realize locust control, and described transgenic crops are crops that are transferred into exogenous sequences shown in SEQ ID NO:3. 6. The application according to claim 5, wherein the crop is corn. 7. the application of the double-stranded RNA based on the synthesis of the mushroom type C-type acetylcholine receptor gene in suppressing the synthesis of the new epidermis of migratory locusts and the degradation of the old epidermis and chitin metabolism, it is characterized in that, for synthesizing the double-stranded RNA The sequence of the DNA template is shown in SEQ ID NO:3. 8. the application of the double-stranded RNA based on the synthesis of the mushroom type C-type acetylcholine receptor gene in suppressing the expression of chitin metabolism-related genes, characterized in that the chitin metabolism-related genes are CHS1 , UAP2 , CHT5-1 , CHT5-2 , CHT5-10 .

Images