CN114317487B - Kinase protein and coding gene for improving bacterial leaf blight resistance of rice - Google Patents

Abstract

The invention discloses a kinase protein for improving bacterial leaf blight resistance of rice and a coding gene OsSnRK1c thereof, wherein the amino acid sequence of the kinase protein is shown as SEQ ID NO. 3, and the nucleotide sequence of the gene OsSnRK1c is shown as SEQ ID NO. 2. Studies show that the full length of the OsSnRK1c genome is 5136bp, the full length of the transcriptome sequence is 2204bp, and the genome has 10 exons and 9 introns, wherein the CDS sequence is 1527bp. OsSnRK1C protein N-terminal has a typical serine threonine domain S_ TKc and an intermediate ubiquitin binding domain UBA and a C-terminal kinase-like domain KA1. Experiments prove that the protein and the encoding gene thereof can effectively improve the bacterial leaf blight resistance of rice.

Description

Kinase protein and coding gene for improving bacterial leaf blight resistance of rice

Technical Field

The invention relates to the field of biotechnology, in particular to a kinase protein and a coding gene for improving bacterial leaf blight resistance of rice.

Background

Sucrose non-fermentation-1 (snf 1) protein kinase (SnRKs) is a major family of protein kinases in plants, associated with metabolism and stress regulation (Halford and Hey,2009;Hey et al,2010). The plant SnRKs family is divided into 3 subfamilies, which are SnRK1, snRK2, snRK3 (Halford, 2005), where SnRK1 is reported to be found in animals and plants, AMPK (adenosine monophosphate-activated protein kinase) in mammals and SNF1 in yeast, and this subfamilies is mainly involved in energy regulation (Smeekens et al, 2010). While SnRK2 and SnRK3 do not have any counterparts in fungal or animal cells, are characteristic in plants (Halford and Hey, 2009). As orthologs in yeast and mammals, it was found that both AMPK and SnRK1 proteins were similar and different in structure, e.g.both comprising an N-terminal serine/threonine Kinase Domain (KD), followed by a triple helix bundle of the self-inhibitory domain (AID) of AMPK and the ubiquitin-related domain (UBA) of SnRK1 (Emanuele et al, 2018), where the KD domain is 67-77% homologous in animals and plants, whereas the homology of AID and UBA is only about 33%.

SnRK1 is a global regulator of plant metabolism, controlling energy-efficient processes and the transfer of alternative energy sources, including sucrose, starch, cell wall compounds, amino acids and lipids; furthermore, snRK1 is involved in the basic developmental process from germination to reproduction and senescence (Shen et al,2011;Cho et al,2012;Coello et al,2011). More and more studies have found that SnRK1 plays a key role in plants and in the management of different types of pathogens (viruses, bacteria, fungi, oomycetes) and herbivores (Hulsmans et al 2016). Such as tomato SnRK1, limit infection of tomato yellow leaf curl geminivirus by phosphorylating acidic residues in protein bC1 (Shen et al, 2011). SnRK1 phosphorylates cabbage leaf curl virus (CalCuV) and tomato mottle virus (ToMoV) AL2/C2 proteins, thereby delaying arabidopsis infection (Shen et AL, 2014). The inhibition of the HR response by avrbss 1, an effector protein, depends on SnRK1 (Szczesny et al, 2010). The transcription of SnRK1 in orange plants (citrus) was up-regulated in vivo after infection with xanthomonas citrus canker Xaa (Xanthomonas axonopodis pv. Aurentifolii pathtype C, xaa) (Cernadas et al, 2010). At present, related researches on the resistance of SnRKs to bacterial leaf blight of rice are still rarely reported.

Disclosure of Invention

In view of the shortcomings of the prior art, the gene, the protein structure and the upstream promoter region of OsSnRK1c are analyzed through bioinformatics analysis and TBtools software, and meanwhile, the function of OsSnRK1c in disease resistance stress is studied through expression profiling analysis and disease resistance identification of transgenic materials.

The scheme of the invention comprises the following contents:

in one aspect, the invention firstly provides a kinase protein which can be used for improving bacterial leaf blight resistance of rice, the amino acid sequence of the kinase protein is shown as SEQ ID NO. 1, and the protein is named OsSnRK1c. The coding gene sequence of the protein is shown as SEQ ID NO. 2, and the gene is named OsSnRK1c.

On the other hand, based on the current research results, the invention also provides the kinase protein and the application of the coding gene thereof.

Specifically comprises the application in improving the bacterial leaf blight resistance of rice, the application in improving the active oxygen content in rice, the application in improving the phenylalanine enzyme activity and the application in improving the lignin content of rice.

Further research of the invention shows that the expression of the OsSnRK1c gene is induced by the pathogenic bacteria PXO99 and is also induced by simulated drought, temperature and salt, which suggests that the OsSnRK1c may be involved in biotic and abiotic stress or interact in biotic and abiotic stress responses through different signaling pathways. In view of this, the present invention provides a method for increasing the expression level of the coding gene in rice plants.

Preferably, the abiotic stress comprises temperature stress, osmotic stress or salt stress.

Preferably, the temperature stress comprises a low temperature stress and a high temperature stress, wherein the low temperature stress is that the leaves are treated at 4 ℃ for at least 48 hours, and the high temperature stress is that the leaves are treated at 40 ℃ for 24-48 hours.

Preferably, the osmotic stress is the salt stress is the treatment of leaves with 20wt% PEG6000 for 12-48 hours and the salt stress is the treatment of leaves with 200mM NaCl for 12-48 hours.

Compared with the prior art, the invention has the beneficial effects that:

the invention discovers a new kinase protein OsSnRK1c which can be used for improving the bacterial leaf blight resistance of rice, and provides a new way for improving the disease resistance of the rice.

The disease resistance identification result shows that the OsSnRK1cOE material improves the disease resistance of rice to PXO99, while the OsSnRK1cKO material increases the sensitivity to PXO99, thereby proving that OsSnRK1c positively regulates the resistance of rice to bacterial leaf blight.

Drawings

Fig. 1: analysis of OsSnRK1c expression after biotic and abiotic stress treatment;

fig. 2: identification of OsSnRK1c overexpression material; a: transcript level identification, B: protein expression level identification

Fig. 3: obtaining an OsSnRK1c knockout material; a: knocking out a sequencing diagram of a material, B: a knock-out material to wild type material sequence alignment;

fig. 4: identification of disease resistance of OsSnRK1c to bacterial xanthomonas; a: spot length B: patch phenotype after inoculation 14

Fig. 5: NBT dyeing is used for detecting ROS accumulation in the blade after PXO99 treatment;

fig. 6: PAL enzyme activity changes of different transgenic materials of OsSnRK1c after PXO99 treatment;

fig. 7: lignin content of OsSnRK1c different transgenic materials after PXO99 treatment

Detailed Description

For a clear and complete description of the technical solutions of the present invention, the inventors have described with reference to the examples and the accompanying drawings, but the following examples describe only some, but not all, of the examples of the present invention.

Examples: functional analysis of protein OsSnRK1c

1.1 plant Material

OsSnRK1c overexpression material and CRISPR/Cas9 gene editing material delegated the completion of the Jiangsu hundred organisms.

1.2 related primer sequences

TABLE 1 primer sequences

1.3 Gene structural analysis of OsSnRK1c

The structure of the OsSnRK1c gene is analyzed through an online website GSDS 2.0 (http:// gsds.cbi.pku.edu.cn /), and the derived result is visualized. The full length of the OsSnRK1c genome is 5136bp, the full length of the transcriptome sequence is 2204bp (SEQ ID NO: 1) and has 10 exons and 9 introns, and the CDS sequence is 1527bp (SEQ ID NO: 2).

1.4 Conserved domain analysis of OsSnRK1c proteins

Based on the amino acid sequence of the OsSnRK1C gene, the N-terminal of the OsSnRK1C protein is found to have a typical serine threonine domain S_ TKc, an intermediate ubiquitin binding domain UBA and a kinase-like domain KA1 at the C-terminal through a conserved domain CDD analysis.

1.5 promoter analysis of protein OsSnRK1c

In order to understand the possible functions of the OsSnRK1c gene, a sequence 2000bp upstream of the start codon of the OsSnRK1c gene is submitted to an online promoter analysis website plant CARE (http:// bioinformation. Psb. Ugent. Be/webtools/plant/html /) analysis, plant CARE analysis results are downloaded, cis-acting element analysis results are screened, and the screening results are visualized through TBtools software. The results show that the OsSnRK1c promoter has 2 MeJA response elements, 8 photoresponsive elements, 2 ABA response elements, 1 injury-related response element and 7 MYB, 3 MYC binding sites, and also has other low-temperature response elements, drought induction corresponding elements and the like. This result suggests that OsSnRK1c may be involved in plant biotic and abiotic stress responses.

1.6 phosphorylation site lookup of protein OsSnRK1c

The possible phosphorylation sites on the OsRLCK118 protein are predicted by the netPhos and the plantants of the online website, and the credible value is set to be more than or equal to 0.5 (maximum: 1). The results show that the site of possible phosphorylation in 508 amino acids (SEQ ID NO: 3) of protein OsSnRK1c is 30 in total, including 6 tyrosine (Tyr) residues, 9 threonine (Thr) residues and 15 serine (Ser) residues. The amino acid sequence of OSK3 is further submitted to a website online three-dimensional structure prediction website (https:// swissmodel. Expasy. Org /), the three-dimensional structure is predicted, then a PDB format file is saved, and the three-dimensional structure of the protein and the predicted phosphorylation site are displayed by adopting protein three-dimensional structure graphic display software PyMOL.

1.7 analysis of expression Profile of protein OsSnRK1c

From the previous promoter analysis, it was found that OsSnRK1c was likely to respond to biotic and abiotic stresses, and to further investigate the possible functions of OsSnRK1c, a batch of seedlings of wild type TP309 of rice were uniformly germinated, and treated with low temperature (Cold, 4 ℃) at one heart stage, high temperature (Hot, 40 ℃), salt stress (200 mM NaCl), osmotic stress (20% PEG 6000), and Xanthomonas PXO 99. Sampling at equal time points of 0h, 12h, 24h and 48h, detecting the expression of OsSnRK1c under different stress by qRT-PCR means, wherein FIG. 1 shows that the expression level of OsSnRK1c after Cold injury (Cold, 4 ℃) treatment shows a trend of descending and ascending, and the expression level (about 2) of OsSnRK1c is 2 times that of the OsSnRK1c after Cold injury treatment for 48 h; the high temperature can induce the expression of OsSnRK1c, the expression level reaches a peak value (expression level: 2.75) after the high temperature treatment for 24 hours, which is about 3 times of that of the untreated (expression level: 1), and then the expression level of 48 hours is reduced compared with 24 hours, which is about 2 times of that of the untreated; when salt damage treatment is simulated, the expression quantity of OsSnRK1c gradually rises, and the peak value is reached in 48 hours; osSnRK1c responds most strongly to simulated drought stress, and the expression level of OsSnRK1c reaches a peak after 48h of treatment, wherein the OsSnRK1c is 8 times that of the OsSnRK1c when the OsSnRK1c is untreated; after the treatment of pathogenic bacteria PXO99, the transcription level of OsSnRK1c is also improved, and the expression is induced at 24h and 48h. It is shown that the expression of OsSnRK1c is induced by biotic and abiotic stresses.

1.8 acquisition of transgenic Material of protein OsSnRK1c

(1) Obtaining of OsSnRK1c overexpression Material

Constructing 35S driven by a 35S strong promoter, namely OsSnRK1c, namely Myc, carrying out genetic transformation by taking rice wild type TP309 as a background, obtaining a transgenic over-expression pure line after multiple generations of screening, detecting the transcription level of a target gene OsSnRK1c in an over-expression material by adopting a real-time fluorescence quantitative PCR method, extracting total protein of rice leaves by adopting a Tris method, and carrying out WB detection on the protein expression condition. As shown in FIG. 2, the transfer level of the OsSnRK1c gene in the OsSnRK1cOE and OsSnRK1cOE strains is about 2 times that of the wild type, and WB experiments prove that the expression of the OsSnRK1c-Myc fusion protein exists in the over-expression material.

(2) Obtaining of OsSnRK1c knockout Material

Target searching and analysis are carried out on genome sequences of OsSnRK1c through an online website http:// CRISPR. Hzau. Edu. Cn/CRISPR2, a CRISPR/Cas9 vector is obtained, and a genetic transformation experiment is carried out on Jiangsu hundred-cell organisms to obtain the OsSnRK1cKO knockout material taking TP309 as a background. Extracting seedling DNA, carrying out PCR amplification by using msg11826 primer pair (specific primers on two sides of sgRNA), carrying out TA cloning on amplified connection products, and then carrying out monoclonal sequencing, wherein sequencing results are shown in FIG. 3 and are all single peaks (KO 10: atggatggaaatgct-ggg; KO3: atggatggaaatgct-ggg); comparing the sequencing result with a wild type (sgRNA: atggatggaaatgctaaaggcggtggg) through DNAMAN, and finding that the obtained knockout material OsSnRK1cKO10 has 8 base deletion before PAM, and OsSnRK1cKO3 has 1 base deletion at the 4 th base before PAM, which shows that a single base deletion purified material is obtained.

1.9 detection of disease resistance of OsSnRK1c transgenic Material

(1) Inoculating bacterial leaf blight pathogen in living body

The wild type TP309 and OsSnRK1c transgenic rice in the booting stage are respectively inoculated by cutting leaves, and the length of the lesion is investigated 14 days after inoculation. As a result, it was found (FIG. 4) that the length of the wild type lesion was 9.65cm, the length of the lesions of the two OsSnRK1cOE transgenic lines (OsSnRK 1cOE4, osSnRK1cOE 14) was 8.53cm, and the length of the lesions of the two OsSnRK1cKO knockout lines (OsSnRK 1cKO3, osSnRK1cKO 10) was 12.8cm at the time of booting. Analysis of variance and analysis of difference significance found that OsSnRK1c overexpressing material lesions were significantly smaller than wild-type, whereas gene knockout material (OsSnRK 1 cKO) lesions were significantly longer than wild-type. It is demonstrated that OsSnRK1c positively regulates the resistance of rice to bacterial leaf blight pathogens.

(2) Physiological and biochemical index determination before and after pathogen treatment

(1) NBT staining for determination of reactive oxygen species

In the experiment, the accumulation condition of ROS in leaves at 3 time points such as 0, 24hpi and 48hpi after the PXO99 is inoculated to an OsSnRK1c transgenic material and a wild material is respectively observed by adopting an NBT histochemical staining method, so that the disease resistance response of plants is strong and weak. As shown in FIG. 5, blue precipitation of 24hpi and 48hpi bacteria appeared and the precipitation was gradually increased after the WT inoculation of the leaves was stained with NBT; the OsSnRK1cOE material also showed blue precipitation of 48hpi over time after inoculation, and more precipitate than wild-type WT; whereas the knockout material blue precipitate is relatively less.

(2) PAL enzyme activity assay

After the bacterial leaf blight pathogen PXO99 is inoculated to the OsSnRK1c transgenic material, the change condition of the PAL enzyme activity in leaf tissues is shown in figure 6, and when the pathogenic bacteria is treated for 12 hours, the PAL enzyme activity of the OsSnRK1cOE material is dramatically enhanced and is 2.1 times that of the PAL enzyme activity when the pathogenic bacteria is not treated; in the knockdown material, no increase in PAL enzyme activity was found, but rather a down-regulation trend was shown. This result indicates that OsSnRK1c has positive regulation effect on PAL enzyme activity, similar to OsRLCK 118.

(3) Lignin content determination

Transgenic plants with good consistent growth vigor, such as wild type TP309, osSnRK1cOE over-expression, osSnRK1cKO and the like, are selected, and sampling is carried out at equal time points of 0, 12 and 24 hours after PXO99 inoculation to detect lignin content change. The results are shown in figure 7, where lignin content in plants showed a slow increase trend over 24h after treatment, whether WT, OE or KO material. Except that OsSnRK1cKO increased less than WT, and hardly increased; while OsSnRK1cOE material increased more than WT. The trend of lignin changes before and after treatment is consistent with the disease resistance identification.

The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.

Sequence listing

<110> university of Hainan

<120> a kinase protein and coding gene useful for improving bacterial leaf blight resistance of rice

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2204

<212> DNA/RNA

<213> Rice (Oryza sativa L)

<400> 1

attaaagtga agtgtgagct ccaagtccga accccccaaa acctcccgtc tcttcccgtc 60

cccgctccag tgggcgggct ctctccctct tcctcctccg ctccgctcca cctcggttga 120

ccaccacccg atcggcggcg agggcgggga gctccggcgt gctcagtgaa aatggatgga 180

aatgctaaag gcggtgggca ttctgaggca ctgaagaact acaatcttgg aagaacttta 240

ggtattggct catttggaaa agtgaagatt gcagagcata agcttacagg acacagagtt 300

gctataaaga tcctgaaccg ccgccaaatg agaaatatgg aaatggagga gaaagcaaag 360

agagaaatca agatactgag attgttcatt catccccata tcattcgcct ttatgaggtt 420

atatacactc ctacggatat atatgttgtg atggagtact gcaagtttgg agaactgttt 480

gattacattg ttgagaaagg caggttgcag gaagatgagg ctcgccgaat cttccagcag 540

attatatctg gggttgaata ctgccacaga aacatggtgg ttcatcgtga tctgaagcca 600

gaaaacttgc tactggattc aaagtataat gtaaagcttg ctgactttgg tttgagtaac 660

gtcatgcatg atggccattt tttgaagaca agctgtggga gtccaaacta tgctgctcca 720

gaggtgatct ctggtaaatt atatgctgga cctgaggttg atgtatggag ctgtggagtg 780

atcctttatg ctctcctttg tggtactctt ccatttgatg atgagaatat ccccaaccta 840

ttcaaaaaga taaagggtgg tatatatact ctcccaagtc atttatctgc tctggccaga 900

gatttgatcc caaggatgct tgttgttgat ccaatgaaga gaatcacaat tcgtgaaatt 960

cgagagcatc agtggtttca gattcgcctt cctcgttact tagcagtgcc tccaccagac 1020

acagcacagc aagccaaaat gattgatgaa gatacccttc aagatgtcgt aaacttgggt 1080

tatggaaagg accatgtgtg tgaatctctg cgcaatagac tgcagaatga ggcaactgtt 1140

gcatattatt tactcttgga caatcgattc cgagctacca gtggctattt gggagcagac 1200

tatcaagaat ctttggagag gaattttaat cgctttgctt catcggaatc agcaagttca 1260

aatacaaggc attatcttcc aggaagcagt gatcctcatg ccagtggttt gcgcccacat 1320

tatcctgttg aaagaaaatg ggctcttgga cttcagtcac gagctcaacc tcgcgagata 1380

atgattgagg tcctaaaggc acttcaagac ttaaatgtct cctggaagaa gaatggacag 1440

tacaacatga aatgcagatg gagcgttggg actcaggcca ctgatatgtt agatgttaac 1500

aacagctttg ttgatgactc aatcataatg gataacggtg atgtaaatgg gaggctacct 1560

gctgtgatca agtttgaaat ccagctttac aagaccagag acgagaagta tctgctggat 1620

atgcagagag ttacggggcc tcagctcctt ttcctggact tctgtgcaga cttccttacc 1680

aagctgaggg ttctatagta cccttgtgtt ggcttcagtg aaaaaccaaa cctagggttt 1740

tatcatgtgc ggtttttcac tgcaataatg aataaaggac accatgtaaa taggcagctg 1800

tgactttctt cccagtcctt agacagcgaa ggttgttgtt tgagtgacta gtgttgtgtt 1860

aagcaccaaa atgttggttg ttacagactt acatagtata tagatcttta taagctatct 1920

gggtgggcga atgcttgatt tctaattttt gcaggctgca gctatactgc tggtgatgcc 1980

gcagtacaag cttttctttt tgctcctgca cacggttatt atacgtgtgc atggaaattt 2040

tgctactgct aggaagaagc tagtaagaat atcagcccct tgctgccggg ttgtggtata 2100

aatgtagatg acagcaaatt tagtggaata tttctatgac aacaaatgta gtcgtatgat 2160

catgctcatg cccccctatg gagaatcgag atatcctttc tctt 2204

<210> 2

<211> 1527

<212> DNA/RNA

<213> Rice (Oryza sativa L)

<400> 2

atggatggaa atgctaaagg cggtgggcat tctgaggcac tgaagaacta caatcttgga 60

agaactttag gtattggctc atttggaaaa gtgaagattg cagagcataa gcttacagga 120

cacagagttg ctataaagat cctgaaccgc cgccaaatga gaaatatgga aatggaggag 180

aaagcaaaga gagaaatcaa gatactgaga ttgttcattc atccccatat cattcgcctt 240

tatgaggtta tatacactcc tacggatata tatgttgtga tggagtactg caagtttgga 300

gaactgtttg attacattgt tgagaaaggc aggttgcagg aagatgaggc tcgccgaatc 360

ttccagcaga ttatatctgg ggttgaatac tgccacagaa acatggtggt tcatcgtgat 420

ctgaagccag aaaacttgct actggattca aagtataatg taaagcttgc tgactttggt 480

ttgagtaacg tcatgcatga tggccatttt ttgaagacaa gctgtgggag tccaaactat 540

gctgctccag aggtgatctc tggtaaatta tatgctggac ctgaggttga tgtatggagc 600

tgtggagtga tcctttatgc tctcctttgt ggtactcttc catttgatga tgagaatatc 660

cccaacctat tcaaaaagat aaagggtggt atatatactc tcccaagtca tttatctgct 720

ctggccagag atttgatccc aaggatgctt gttgttgatc caatgaagag aatcacaatt 780

cgtgaaattc gagagcatca gtggtttcag attcgccttc ctcgttactt agcagtgcct 840

ccaccagaca cagcacagca agccaaaatg attgatgaag atacccttca agatgtcgta 900

aacttgggtt atggaaagga ccatgtgtgt gaatctctgc gcaatagact gcagaatgag 960

gcaactgttg catattattt actcttggac aatcgattcc gagctaccag tggctatttg 1020

ggagcagact atcaagaatc tttggagagg aattttaatc gctttgcttc atcggaatca 1080

gcaagttcaa atacaaggca ttatcttcca ggaagcagtg atcctcatgc cagtggtttg 1140

cgcccacatt atcctgttga aagaaaatgg gctcttggac ttcagtcacg agctcaacct 1200

cgcgagataa tgattgaggt cctaaaggca cttcaagact taaatgtctc ctggaagaag 1260

aatggacagt acaacatgaa atgcagatgg agcgttggga ctcaggccac tgatatgtta 1320

gatgttaaca acagctttgt tgatgactca atcataatgg ataacggtga tgtaaatggg 1380

aggctacctg ctgtgatcaa gtttgaaatc cagctttaca agaccagaga cgagaagtat 1440

ctgctggata tgcagagagt tacggggcct cagctccttt tcctggactt ctgtgcagac 1500

ttccttacca agctgagggt tctatag 1527

<210> 3

<211> 508

<212> PRT

<213> Rice (Oryza sativa L)

<400> 3

Met Asp Gly Asn Ala Lys Gly Gly Gly His Ser Glu Ala Leu Lys Asn

1 5 10 15

Tyr Asn Leu Gly Arg Thr Leu Gly Ile Gly Ser Phe Gly Lys Val Lys

20 25 30

Ile Ala Glu His Lys Leu Thr Gly His Arg Val Ala Ile Lys Ile Leu

35 40 45

Asn Arg Arg Gln Met Arg Asn Met Glu Met Glu Glu Lys Ala Lys Arg

50 55 60

Glu Ile Lys Ile Leu Arg Leu Phe Ile His Pro His Ile Ile Arg Leu

65 70 75 80

Tyr Glu Val Ile Tyr Thr Pro Thr Asp Ile Tyr Val Val Met Glu Tyr

85 90 95

Cys Lys Phe Gly Glu Leu Phe Asp Tyr Ile Val Glu Lys Gly Arg Leu

100 105 110

Gln Glu Asp Glu Ala Arg Arg Ile Phe Gln Gln Ile Ile Ser Gly Val

115 120 125

Glu Tyr Cys His Arg Asn Met Val Val His Arg Asp Leu Lys Pro Glu

130 135 140

Asn Leu Leu Leu Asp Ser Lys Tyr Asn Val Lys Leu Ala Asp Phe Gly

145 150 155 160

Leu Ser Asn Val Met His Asp Gly His Phe Leu Lys Thr Ser Cys Gly

165 170 175

Ser Pro Asn Tyr Ala Ala Pro Glu Val Ile Ser Gly Lys Leu Tyr Ala

180 185 190

Gly Pro Glu Val Asp Val Trp Ser Cys Gly Val Ile Leu Tyr Ala Leu

195 200 205

Leu Cys Gly Thr Leu Pro Phe Asp Asp Glu Asn Ile Pro Asn Leu Phe

210 215 220

Lys Lys Ile Lys Gly Gly Ile Tyr Thr Leu Pro Ser His Leu Ser Ala

225 230 235 240

Leu Ala Arg Asp Leu Ile Pro Arg Met Leu Val Val Asp Pro Met Lys

245 250 255

Arg Ile Thr Ile Arg Glu Ile Arg Glu His Gln Trp Phe Gln Ile Arg

260 265 270

Leu Pro Arg Tyr Leu Ala Val Pro Pro Pro Asp Thr Ala Gln Gln Ala

275 280 285

Lys Met Ile Asp Glu Asp Thr Leu Gln Asp Val Val Asn Leu Gly Tyr

290 295 300

Gly Lys Asp His Val Cys Glu Ser Leu Arg Asn Arg Leu Gln Asn Glu

305 310 315 320

Ala Thr Val Ala Tyr Tyr Leu Leu Leu Asp Asn Arg Phe Arg Ala Thr

325 330 335

Ser Gly Tyr Leu Gly Ala Asp Tyr Gln Glu Ser Leu Glu Arg Asn Phe

340 345 350

Asn Arg Phe Ala Ser Ser Glu Ser Ala Ser Ser Asn Thr Arg His Tyr

355 360 365

Leu Pro Gly Ser Ser Asp Pro His Ala Ser Gly Leu Arg Pro His Tyr

370 375 380

Pro Val Glu Arg Lys Trp Ala Leu Gly Leu Gln Ser Arg Ala Gln Pro

385 390 395 400

Arg Glu Ile Met Ile Glu Val Leu Lys Ala Leu Gln Asp Leu Asn Val

405 410 415

Ser Trp Lys Lys Asn Gly Gln Tyr Asn Met Lys Cys Arg Trp Ser Val

420 425 430

Gly Thr Gln Ala Thr Asp Met Leu Asp Val Asn Asn Ser Phe Val Asp

435 440 445

Asp Ser Ile Ile Met Asp Asn Gly Asp Val Asn Gly Arg Leu Pro Ala

450 455 460

Val Ile Lys Phe Glu Ile Gln Leu Tyr Lys Thr Arg Asp Glu Lys Tyr

465 470 475 480

Leu Leu Asp Met Gln Arg Val Thr Gly Pro Gln Leu Leu Phe Leu Asp

485 490 495

Phe Cys Ala Asp Phe Leu Thr Lys Leu Arg Val Leu

500 505

Claims (1)

1. The application of the kinase protein or the coding gene thereof in improving bacterial leaf blight resistance of rice is characterized in that the amino acid sequence of the kinase protein is shown as SEQ ID NO. 3, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2.

Images