CN109575114B - Rice grain shape and grain weight related gene, protein, molecular marker and application - Google Patents

Abstract

The invention relates to the field of plant genetic engineering, and discloses a rice grain shape and grain weight gene TGW2(Seq ID No: 1, 2), a protein coded by the gene (Seq ID No: 3) and application of the gene or the protein in regulation and control of plant grain shape and grain weight. The invention also discloses the application of the 5' non-coding region DNA sequence, mutant gene and mutant protein of the gene in regulating and controlling plant grain shape weight. The invention also discloses a molecular marker closely linked with the gene and application thereof. The cloning and application of the TGW2 gene can effectively improve the yield of rice by regulating the grain weight of rice.

Description

Rice grain shape and grain weight related gene, protein, molecular marker and application

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a rice grain shape and grain weight related gene, protein, molecular marker and application.

Background

Rice is not only monocotyledon model plant, but also important food crop in our country. The size of rice grains is an important factor influencing the yield and quality of rice, and the rice grains are always concerned in the long-term rice breeding process. The grain shape and the grain weight of rice are direct factors influencing the yield, the thousand grain weight is one of the three factors of the rice yield, and the grain weight is mainly determined by the grain shape. Meanwhile, the grain shape also has important influence on the quality of rice, in particular to the appearance quality (chalky grain rate and chalky degree) and the grinding processing quality (brown rice rate, polished rice rate and whole polished rice rate) of rice and the like. The 4 key factors controlling grain shape are grain length, grain width, grain thickness and aspect ratio, respectively.

However, grain size is a complex quantitative trait controlled by multiple genetic loci, and until now, scientists have successfully cloned a series of Quantitative Trait Loci (QTL) for regulating and controlling rice grain shape variation by using a map-based cloning method. These QTLs influence grain formation primarily by regulating the size of rice glumes, wherein the genes associated with grain width and grain weight are GW2(SongXJ, Huang W, Shi M, Zhu MZ, Lin HX.A QTL for grain width and weight advantageously not found in rice grain width and weight, E3 ubquitin lipid. nat Genet.2007,39(5):623 630), qSW5/GW5(Shomura A, Izawa T, Ebana K, Ebituani T, Kanegae H, Konishi S, Yanom. deletion gene associated with grain width grain size degradation products, grain width degradation, Na J7H, J8, 2008, G8, G11J, G11J 7, G11, G12, G11J 7, G11, G7J 7, G11, G7, G III, G7, G III, G3, GS5(Li Y, Fan C, Xing Y, Jiang Y, LuoL, Sun L, Shao D, Xu C, Li X, Xiao J, He Y, Zhang Q. Natural variation in GS5 plan variation in dimension in nat Genet.2011,43(12):1266-, wu K, Qian Q, LiuQ, Li Q, Pan Y, Ye Y, Liu X, Wang J, Zhang J, Li S, Wu Y, Fu X.non-canonicalization of SPL translation forces by a human OTUB1-like de-ubricated effects a new plant type associated with high yield grain in CellRes.2017,27(9): 1142-1156). Therefore, the rice grain shape gene is cloned, corresponding molecular markers are developed, and the rice grain shape is improved through molecular breeding, so that the rice yield can be improved, and the rice quality can be improved.

The TGW2 gene is the same gene as the rice fruit-like heavy gene OsFWL 1. The OsFWL1 protein has a CLITCVCPC structural domain and contains 2 transmembrane regions. Expressed in root, stem, ear and seedling tissues, and found on the cell membrane at subcellular locations (XuJ, Xiong W, Cao B, Yan T, Luo T, Fan T, Luo M. molecular characterization and functional analysis of "free-weight 2.2-like" gene family in rice plant.2013, 238(4): 643. 655). The protein has high homology (82% similarity) to ZmCNR1 of corn (Guo M, Simmons CR. cell number counts- -the fw2.2and CNR genes and antigens for controlling plant front and organ size. plant Sci.2011,181(1): 1-7). However, the function of the compound has not yet been clarified.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a rice grain shape and weight gene TGW2 for regulating and controlling rice grain shape and weight and protein coded by the gene, and develop related application based on the gene.

In order to solve the technical problems, the invention adopts the following technical scheme:

in one aspect, the invention provides an application of a protein in regulation and control of rice grain shape and grain weight, wherein the protein has a sequence shown in (A) or (B):

(A) seq ID No: 3;

(B) protein which is derived from (A) and has the same function by adding and/or substituting and/or deleting one or more amino acids in the amino acid sequence defined by (A);

the grain shape is grain width.

Wherein Seq ID No: the protein shown in 3 belongs to a novel protein rich in a cysteine structural domain and has 181 amino acids. The analogue for regulating the particle size weight function can be obtained by carrying out amino acid substitution, deletion and addition on the non-structural domain region outside the conserved region, and the function of the protein can not be influenced.

On the other hand, the invention provides an application of the gene for coding the protein in regulating and controlling the grain weight of rice.

Further, the gene TGW2 encoding the rice grain weight protein has a sequence as shown in (a), (b), (c) or (d):

(a) seq ID No: 1;

(b) seq ID No: 2;

(c) the (a) sequence is preceded by a 5' non-coding region DNA sequence, such as SeqID No: 5;

(d) a mutant gene, allele or derivative which can code for a protein having the function of regulating the weight of the granule formed by adding and/or substituting and/or deleting one or more nucleotides in the nucleotide sequence shown in (a), (b) or (c).

Wherein Seq ID No: 1 has 877 nucleotides in total, Seq ID No: 2 has a total of 546 nucleotides (including the terminator TAG). The addition, substitution and deletion of nucleotides in the region except the conserved region can also encode and obtain the analogue for regulating the particle weight function, and the function of the protein cannot be influenced.

Wherein, Seq ID No: the sequence shown in 5 is a 5 ' non-coding region DNA sequence of the petit 64s, correspondingly, the 5 ' non-coding region DNA sequence plays a role in regulating and controlling the grain size weight, and the grain width and thousand grain weight of the petit 64s are relatively small, just because of the negative regulation and control effect of the 5 ' non-coding region DNA sequence.

Furthermore, because the gene belongs to a negative regulatory gene, the grain width and the grain weight of the rice can be improved through gene knockout; the gene knockout vector is a CRISPR/Cas9 vector; the target joint primer for knocking out the target sequence of the gene comprises the following components:

cas-F1：ggcaCGATGAACACCCCACGCAC；

cas-R1：aaacGTGCGTGGGGTGTTCATCG；

or:

cas-F2：gccgGGCTGACGCGATGGTCCAC；

cas-R2：aaacGTGGACCATCGCGTCAGCC。

further, the sequence of (a) is preceded by a 5' non-coding region DNA sequence, such as the sequence of Seq ID No: 4, Seq ID No: 4, the 5 'non-coding region DNA sequence of 93-11, correspondingly, the 5' non-coding region DNA sequence has a regulation function on the grain shape and the grain width and thousand seed weight of 93-11 are relatively large, and just because of the regulation function of the 5 'non-coding region DNA sequence, the (a) sequence containing the 5' non-coding region DNA sequence can be transferred into rice by a transgenic method to improve the grain width and the grain weight of the rice.

In one aspect, the invention provides a protein encoded by a rice grain weight mutant gene, such as Seq ID No: 6 or Seq ID No: 7.

In another aspect, the present invention provides a mutant gene of the rice grain weight gene TGW2 encoding the above protein, having the sequence shown in (a), (b), (c) or (d):

(a) seq ID No: 1 at position 107 and at position 134, respectively;

(b) seq ID No: 2, a cDNA nucleotide sequence of each of the insertions T at positions 107 and 134;

(c) seq ID No: 1 at position 107 and at position 134, respectively;

(d) seq ID No: 2, A at positions 107 and 134, respectively.

In another aspect, the invention provides an application of the mutant protein and the mutant gene in regulation and control of rice grain shape and grain weight, wherein the grain shape is grain width.

The application of the mutant gene is mainly to transfer the mutant gene into rice by a transgenic method so as to improve the grain width and the grain weight of the rice.

In still another aspect, the present invention provides a molecular marker closely linked to a rice grain weight gene, wherein the molecular marker is P2-1, P2-2, P2-3, P2-4, P2-5, P2-6, P2-7, 2-8 or P2-9; the primer sequences corresponding to the molecular markers are respectively as follows:

P2-1：

F,5’-TCTGCTCGAAATTAAGTTCAC-3’

R,5’-ACGCTAATAGTTTTCTCACTTTTG-3’；

P2-2：

F,5’-GGCTGCTACTACTGTGCT-3’

R,5’-CATATGCGGAAAAAGGGAAG-3’；

P2-3：

F,5’-CGCAATACCGGATATCTCAA-3’

R,5’-TAAGTGCCACATGAGACAAA-3’；

P2-4：

F,5’-TATTACACATTTGTAGTTAC-3’

R,5’-TAAAACTAGCATGGTGGTCC-3’；

P2-5：

F,5’-ATGTGAATGTAGTGTTGTAT-3’

R,5’-GCTCACTTCGGTGGCAATCC-3’；

P2-6：

F,5’-AGGAATTTGACTTGTGGGTG-3’

R,5’-TAGTTTGGGCTGCATATGTT-3’；

P2-7：

F,5’-GTTGATCTTTTGCTTTTCTAGT-3’

R,5’-CTAGGTTGAAAAGGCTCACT-3’；

P2-8：

F,5’-CTTTCTGAAGCACAAATATGGT-3’

R,5’-AGTAAACAAGCAACAGAGGA-3’；

P2-9：

F,5’-CCGTTGATCGAATCATGGA-3’

R,5’-TGTCTCTTCGTATTTGGTGG-3’。

in a further aspect, the invention provides an application of the molecular marker closely linked with the rice grain shape weight gene in molecular marker-assisted selective breeding, wherein the application is used for assisting in selecting rice grain shape weight-related traits.

The molecular marker is a molecular marker which is obtained in the process of carrying out the positioning cloning of the rice grain weight gene and is closely linked with the rice grain weight gene, so that the molecular marker can be used for carrying out molecular marker-assisted selective breeding, such as screening and identifying the characters related to the rice grain weight.

The specific technical steps for realizing the invention are as follows:

first, fine localization and candidate gene determination of TGW2 gene:

large-scale Recombinant Inbred Line (RIL) populations were constructed using parent cultivars with significant differences in grain width and grain weight, petunia 64s and 93-11 (FIG. 1, FIG. 2). In combination with the high-density SNP map of the RIL core population, we detected a new major QTL-qGW 2/qTGW2 (FIG. 3) on chromosome 2 of rice that controls grain width and grain weight. Large-scale BC using Pedopt 64s as recurrent parent₄F₂The population further pinpoints the QTL within a physical distance of about 7.6kb between two enzyme amplified length polymorphism (CAPS) markers P2-4 and P2-5 (FIG. 4a), wherein only 1 Open Reading Frame (ORF) is available, and the encoded product has high homology with the protein for regulating the cell number and is temporarily named as TGW 2. DNA sequencing revealed 6 Single Nucleotide Polymorphisms (SNPs) and 3 indels (InDel) within 2kb of the non-coding region of TGW 25' of the parent plant FIG. 64s and 93-11 (FIG. 4 b).

II, identification and functional analysis of TGW2 gene:

through a transgenic technology, results show that the transgenic over-expression japonica rice plants with significantly reduced grain width and thousand kernel weight, the japonica rice plants with TGW2 gene driven by the non-coding region of TGW 25' of trans-cultivated dwarf 64s and gene knockout cultivated dwarf 64s strains with significantly increased grain width and thousand kernel weight (fig. 5-fig. 12) are obtained, and the TGW2 gene is proved to be correctly cloned by the invention. Amino acid sequence analysis shows that TGW2 encodes protein for regulating cell number, and the 93-11 type near isogenic line NIL-TGW2 is used as TGW2 gene against culture dwarf 64s background^93-11And TGW2 gene as a type of plant-dwarf 64s near isogenic line NIL-TGW2^{Cultivate short 64s}The observation of the tissue cytology of the young ear at the booting stage of the female ear shows that NIL-TGW2^93-11The number of glume cross section cells is more NIL-TGW2^{Cultivate short 64s}Significantly increased (fig. 13, fig. 14); the ploidy detection result of the scion cells of the near isogenic line by using the flow cytometer shows that NIL-TGW2^93-11The ratio of the number of cells in the S phase and G2/M phase representing mitosis in the middle of the cycle is NIL-TGW2^{Cultivate short 64s}The gene is proved to regulate the cell number by obviously increasing (figure 15), the grain width and the thousand seed weight (figure 16; figure 17).

The invention adopts the map-based cloning technology to utilize rice BC₄F₂The population is cloned to the granule weight gene TGW2 in rice for the first time, and the functions of the gene are identified through a transgenic over-expression experiment, a Pythium 64s gene 5' non-coding region driven TGW2 gene expression experiment, a gene knockout experiment and a near isogenic line. The cloning and application of the TGW2 gene can effectively regulate the grain weight and yield of rice, and the TGW2 gene can also be applied to other monocotyledons to regulate the grain weight and yield. Meanwhile, the invention is helpful for the clarification of the regulation and control mechanism of the rice grain shape and grain weight and lays a solid theoretical foundation for the high-yield breeding of rice.

Drawings

FIG. 1 is a representation of the grain phenotype of rice cultivars dwarf 64s and 93-11; wherein a is seeds of dwarf 64s, b is seeds of 93-11, and c-1cm scale;

FIG. 2 is a comparison of grain width and thousand kernel weight for rice cultivars dwarf 64s and 93-11; mean ± standard deviation (n ═ 10);

FIG. 3 shows the position of the major QTL-qGW 2/qTGW2 on rice chromosome for controlling rice grain width and grain weight;

FIG. 4 fine mapping of TGW2 gene; wherein the upper part of the vertical line is marked with a molecular marker, the lower part of the vertical line represents the number of exchanged individuals, and ATG and TAG respectively represent the start codon and the stop codon of the TGW2 gene;

FIG. 5pCAMBIA1300S-TGW2 overexpression vector map (a) and pCAMBIA1300S-pTGW2^{Cultivate short 64s}-TGW2 expression vector map (b);

FIG. 6 is TGW2 overexpressing T₀The grain phenotype of the transgenic rice generation; wherein a is the seeds of Nipponbare, b is the seeds of TGW2 transgenic over-expression vector strains, c is the seeds of TGW2 gene expression vector strains driven by TGW 25' non-coding regions of transgenic dwarf for 64s, and d-1cm ruler;

FIG. 7 is a comparison of grain width and thousand kernel weight for Nipponbare and TGW2 overexpression vector line, TGW 25' non-coding region driven TGW2 gene expression vector line of transgenic dwarf 64 s; mean ± standard deviation (n ═ 10);

FIG. 8 is a comparison of the expression of TGW2 transcription levels of Nipponbare and TGW2 overexpression vector line, a TGW 25' non-coding region driven TGW2 gene expression vector line of Trypan 64 s; mean ± standard deviation (n ═ 3);

FIG. 9pCAS9-TGW2-f vector map;

FIG. 10 depicts the TGW2 gene structure of 64s and 2 knock-out lines;

FIG. 11 is the granulometric phenotype of TGW2 knock-out strain; wherein a is seeds of dwarf 64s, b is seeds of a gene knockout strain-1, c is seeds of a gene knockout strain-2, and a d-1cm scale;

FIG. 12 is a comparison of grain width and thousand kernel weight for the dwarf 64s and TGW2 gene knock-out lines; mean ± standard deviation (n ═ 10);

FIG. 13 shows the near isogenic line NIL-TGW2^{Cultivate short 64s}And NIL-TGW2^93-11Crosscutting the glumes; a is NIL-TGW2^{Cultivate short 64s}B is NIL-TGW2^93-11C-50 μm scale, d-50 μm scale;

FIG. 14 shows the near isogenic line NIL-TGW2^{Cultivate short 64s}And NIL-TGW2^93-11Comparing the number of glume cells of (a); mean ± standard deviation (n ═ 10);

FIG. 15 shows the isogenic line NIL-TGW2^{Cultivate short 64s}And NIL-TGW2^93-11Comparing the proportion of glume cells at different stages of the cell cycle; mean ± standard deviation (n ═ 3);

FIG. 16 shows the near isogenic line NIL-TGW2^{Cultivate short 64s}And NIL-TGW2^93-11(ii) a grain phenotype; wherein a is NIL-TGW2^{Cultivate short 64s}B is NIL-TGW2^93-11C-1cm scale;

FIG. 17 shows the near isogenic line NIL-TGW2^{Cultivate short 64s}And NIL-TGW2^93-11Comparing the grain width with the thousand grain weight; mean ± standard deviation (n ═ 10);

Detailed Description

Example 1:

1. rice material

Japonica rice is (Oryza sativa L.japonica) Nipponbare, indica rice is (Oryza sativa L.indica) 93-11 and 'perdwarfing 64 s', TGW2 gene overexpression strain and TGW2 gene knockout strain are transferred, TGW2 gene on the background of perdwarfing 64s is replaced by 93-11 type near-isogenic line NIL-TGW2^93-11And TGW2 gene as a type of plant-dwarf 64s near isogenic line NIL-TGW2^{Cultivate short 64s}。

2. STS and CAPS markers for fine localization of TGW2 gene

The rapid extraction method of rice trace DNA is adopted to extract the genome DNA for gene localization from rice leaves. 0.2g of rice leaf was frozen and ground into powder with liquid nitrogen, transferred to a 1.5ml centrifuge tube to extract DNA, and the obtained DNA precipitate was dissolved in 150. mu.l of ultrapure water. Mu.l of DNA sample was used for each PCR reaction.

Primary localization of TGW2 gene: hybridizing Panzhi 64s with 93-11, F₁The generation begins to self-cross for single-seed 13 generations to generate RIL population. By combining the high-density SNP map of the RIL core population, a new major QTL-qTGW 2 for controlling the grain width and grain weight of rice on chromosome 2 of rice is detected, and the contribution rates are respectively 11% and 18% (FIG. 3).

Fine localization of TGW2 gene: large-scale BC using Pedopt 64s as recurrent parent₄F₂In the population, primers were designed based on the reference sequences of Panzhi 64s and 93-11 in the target region, and polymorphic primers were selected (Table 1), and the QTL was further mapped to a physical distance of about 7.6kb between the two CAPS markers P2-4 and P2-5 (FIG. 4 a).

3. Gene prediction and comparative analysis:

by RGAP website (http:// rice. plant biology. msu. edu /) analysis, 1 ORF was present in this interval, and genome sequencing revealed that the parental culture plants 64s and 93-11 had 6 SNPs and 3 InDel within 2kb of the 5' noncoding region of the gene (FIG. 4 b). Thus, the ORF may be a candidate gene for the trait.

TABLE 1 molecular markers for fine-localization development

F: a forward primer; r: and (3) a reverse primer.

Example 2:

plant transformation and functional analysis:

to verify that this ORF is a candidate gene, we amplified a sequence of 546bp in total from the start codon ATG to the stop codon TAG of 93-11 cDNA by PCR, then ligated this sequence into a binary expression vector pCAMBIA1300S (FIG. 5a), and then amplified 2kb of the 5 'noncoding region of petit 64S by PCR instead of 35S promoter to construct a TGW2 gene expression vector driven by the TGW 25' noncoding region of petit 64S (FIG. 5 b). Transferring the 2 vectors into Nipponbare respectively by an agrobacterium-mediated plant transformation method to obtain 10 transgenic plants respectively, wherein all the transgenic overexpression T₀The phenotype of the generation plants is that the grain width and the thousand seed weight are both reduced obviously (figure 6, figure 7), and the expression level of the gene transcription level is increased obviously (figure 8). This indicated that this ORF is the candidate gene TGW2 for controlling grain width and grain weight traits. To further validate this result, we constructed a CRISPR/Cas9 vector using the sequence on exon 1 of this ORF (fig. 9). Vector construction according to the method of Ma et al (Ma XL, Chen LT, ZhuQL, Chen YL, Liu YG. Rapid decoding of sequence-specific nucleic acid-induced hybridization and biological mutations by direct sequencing of PCRProducts. molecular Plant 2015,8: 1285-1287) the main steps are as follows:

(1) target site selection: finding 20 th base A at the upstream of NGG in the target section, and taking the sequence as a target sequence;

(2) preparing a target joint: dissolving the adaptor primer (cas-F1: ggcaCGATGAACACCCCACGCAC; cas-R1: aaacGTGCGTGGGGTGTTCATCG; cas-F2: gccgGGCTGACGCGATGGTCCAC; cas-R2: aaacGTGGACCATCGCGTCAGCC) to 10uM, respectively taking 20ul of the mixture, placing the mixture on a PCR instrument at 90 ℃ for 30 seconds, and cooling the mixture at room temperature;

(3) digestion of gRNA vector: 10ng of pYLgRNA-U3 plasmid was digested with 5U BsaI (NEB) for 15 minutes in 10ul of reaction system;

(4) gRNA expression cassette ligation: the reaction system for connecting the digested pYLgRNA-U3 plasmid with the target joint is as follows:

1 μ l T4DNA ligase buffer

10ng pYLgRNA-U3 vector

1ul target adaptor

0.1 μ l T4DNA ligase

Adding double distilled water to 10ul, putting the ligation mixture into a PCR instrument at room temperature, and carrying out a PCR execution program: 5 cycles of 5 minutes at 37 ℃ and 5 minutes at 20 ℃;

(5) amplifying the gDNA expression cassette: for the first round of amplification, 2ul ligation product was used as template, U-F and gRNA-R primers were 0.2uM each, and a 15ul PCR system was amplified with KOD-Plus enzyme according to the following PCR procedure: 1 minute at 95 ℃; 10 cycles of 95 ℃ for 10 seconds, 60 ℃ for 15 seconds, 68 ℃ for 20 seconds; 10 seconds at 95 ℃, 15 seconds at 60 ℃, 30 seconds at 68 ℃ and 20 cycles; and (2) performing second amplification, namely diluting the first PCR product by 100 times by using double distilled water, taking 1ul as a template, amplifying a corresponding U3-gRNA by using a primer pair B1'/BL, and amplifying a 50ul PCR reaction system by using KOD-Plus enzyme, wherein the PCR program is as follows: 1 minute at 95 ℃; 25 cycles of 95 ℃ for 10 seconds, 60 ℃ for 15 seconds, 68 ℃ for 20 seconds;

(6) after purifying the amplified U3-gRNA product, 70ng and 10ng of plasmid pYLCRISPR/Cas9-MH/B which is not digested are taken, 10U BsaI is used for digesting for 10 minutes at 37 ℃ in a 15ul reaction system, 1.5ul of DNA ligase buffer solution and 35U of T4DNA ligase are added, and then the following reactions are carried out in a PCR instrument: 5 minutes at 37 ℃, 5 minutes at 10 ℃, 5 minutes at 20 ℃ and 15 cycles;

(7) coli was transformed and identified by sequencing using the universal primers SP1(Seq ID No: 30) and SP2(Seq ID No: 31).

8 strains of T are obtained by agrobacterium-mediated transformation of Nipponbare callus₀Transgenic plants are generated. Through sequencing, 2 transgenic plants are subjected to homozygous mutation (a gene knockout line-1 and a gene knockout line-2), the gene knockout line-1 is subjected to 1 base T insertion at the 107 th site and the 134 th site of a CDS sequence of the exon 1 respectively, the gene knockout line-2 is subjected to 1 base A insertion at the 107 th site and the 134 th site of the CDS sequence of the exon 1 respectively, so that amino acid frame shifting is caused, translation is terminated early (figure 10), and the gene knockout plants show a phenotype that the grain width and the thousand seed weight are increased remarkably (figure 11 and figure 12). The above results fully demonstrate that the phenotype of grain width and grain weight is represented by the TGW2 gene mutationAnd (c) caused by the change.

To investigate the role of TGW2 in regulating cell number, we replaced the 93-11 type near isogenic line NIL-TGW2 for TGW2 gene against the Pepper 64s background^93-11And TGW2 gene as a type of plant-dwarf 64s near isogenic line NIL-TGW2^{Cultivate short 64s}Paraffin section and histological observation are carried out on young ear glumes at the booting stage, and NIL-TGW2 is found^93-11The number of glume cross section cells is more NIL-TGW2^{Cultivate short 64s}Significantly increased (fig. 13, fig. 14); the ploidy detection result of the scion cells of the near isogenic line by using the flow cytometer shows that the ploidy detection result is NIL-TGW2^{Cultivate short 64s}In contrast, NIL-TGW2^93-11The number of cells entering the S phase and G2/M phase representing mitosis increased significantly (FIG. 15), as did the width and thousand kernel weight (FIG. 16; FIG. 17). Therefore, the gene coded protein regulates the number of glume cells and increases the grain width.

The foregoing list is only illustrative of several embodiments of the present invention. It should be noted that the present invention is not limited to the above embodiments, and all modifications that can be directly derived or suggested to one skilled in the art from the disclosure of the present invention should be considered as the protection scope of the present invention.

Sequence listing

<110> institute of Rice research in China

<120> rice grain shape and grain weight related gene, protein, molecular marker and application

<160>31

<170>SIPOSequenceListing 1.0

<210>1

<211>877

<212>DNA

<213> Oryza sativa (Oryza sativa)

<400>1

atgtatccct ccgcccctcc cgacgcgtat aacaagtaca gcgccggtgc tccaccgacg 60

gcgccgccgc cggcaacgta ccagctgccg acgatgaaca ccccacgcac cggcgggggg 120

ctgacgcgat ggtccaccgg ccttttccac tgcatggacg atcccggaaa ctgtaagtcc 180

ttcagtcagt cagttttccc acatgttctt cagagttcag agttcagagc aatagatggt 240

tgccggccca tggttgctca atcacacctg tcgtttctct catgcaggtc tcatcacatg 300

cgtgtgcccc tgcatcacct ttgggcaggt cgctgacatc gtggacaagg gcacctgccg 360

tgagttctcc cttcttctcc ttcttaccag cgaaagattt tggtccattc accagcttgt 420

tcgttgattc ggtgcgtgtg aaactgtgat cgattttgca gcatgcctcg cgagcgggac 480

ggcttacgcg ctcctctgcg cgtcggggat ggggtgcctg tactcgtgct tctaccggtc 540

caagatgagg gctcagttcg acctggacga aggggattgc cccgatttcc tcgtccattt 600

ctgctgcgag tactgcgcgc tgtgccagga gtaccgggag ctcaagaacc gcggcttcga 660

cttggggatc ggtaggtgca agcactgaag cacagtagat tcttcgcttg caagcaagaa 720

atatcttcta ctagtactac ttttttgagg agcactcgaa ctgacgaata gtgttttctg 780

gtaaggttgg gctgccaatg tggacaggca gaggcgaggc gtcaccggag cgtcggtgat 840

gggagctcct ggcgtcccgg tcggcatgat gaggtag 900

<210>2

<211>546

<212>DNA

<213> Oryza sativa (Oryza sativa)

<400>2

atgtatccct ccgcccctcc cgacgcgtat aacaagtaca gcgccggtgc tccaccgacg 60

gcgccgccgc cggcaacgta ccagctgccg acgatgaaca ccccacgcac cggcgggggg 120

ctgacgcgat ggtccaccgg ccttttccac tgcatggacg atcccggaaa ctgtctcatc 180

acatgcgtgt gcccctgcat cacctttggg caggtcgctg acatcgtgga caagggcacc 240

tgcccatgcc tcgcgagcgg gacggcttac gcgctcctct gcgcgtcggg gatggggtgc 300

ctgtactcgt gcttctaccg gtccaagatg agggctcagt tcgacctgga cgaaggggat 360

tgccccgatt tcctcgtcca tttctgctgc gagtactgcg cgctgtgcca ggagtaccgg 420

gagctcaaga accgcggctt cgacttgggg atcggttggg ctgccaatgt ggacaggcag 480

aggcgaggcg tcaccggagc gtcggtgatg ggagctcctg gcgtcccggt cggcatgatg 540

aggtag 572

<210>3

<211>181

<212>PRT

<213> Oryza sativa (Oryza sativa)

<400>3

Met Tyr Pro Ser Ala Pro Pro Asp Ala Tyr Asn Lys Tyr Ser Ala Gly

1 5 10 15

Ala Pro Pro Thr Ala Pro Pro Pro Ala Thr Tyr Gln Leu Pro Thr Met

20 25 30

Asn Thr Pro Arg Thr Gly Gly Gly Leu Thr Arg Trp Ser Thr Gly Leu

35 40 45

Phe His Cys Met Asp Asp Pro Gly Asn Cys Leu Ile Thr Cys Val Cys

50 5560

Pro Cys Ile Thr Phe Gly Gln Val Ala Asp Ile Val Asp Lys Gly Thr

65 70 75 80

Cys Pro Cys Leu Ala Ser Gly Thr Ala Tyr Ala Leu Leu Cys Ala Ser

85 90 95

Gly Met Gly Cys Leu Tyr Ser Cys Phe Tyr Arg Ser Lys Met Arg Ala

100 105 110

Gln Phe Asp Leu Asp Glu Gly Asp Cys Pro Asp Phe Leu Val His Phe

115 120 125

Cys Cys Glu Tyr Cys Ala Leu Cys Gln Glu Tyr Arg Glu Leu Lys Asn

130 135 140

Arg Gly Phe Asp Leu Gly Ile Gly Trp Ala Ala Asn Val Asp Arg Gln

145 150 155 160

Arg Arg Gly Val Thr Gly Ala Ser Val Met Gly Ala Pro Gly Val Pro

165 170 175

Val Gly Met Met Arg

180

<210>4

<211>2000

<212>DNA

<213> Oryza sativa (Oryza sativa93-11)

<400>4

cttcatttta agaagatatt attttagcca agccggttta aaataaacga atcaaattta 60

cttaaatgag tatgtacaca caaatttact tcaaaaactt tattgttggt tatagatctg 120

cataagttca ttattagctt ttcattaatg attctaactc tgggaagctt caacagtgat 180

tctggaatcc atccactcgg agggtagtct gtgtagtcgc tagctgtgtt gccacttttg 240

gggacttgtt aggagtgtag tgcggctcag ctccttcccg ttgtttggag ttttgcttta 300

accgccgtag tttttctaag cttcagtttt ttattttgct ttttcttctt tcccctggta 360

taggccggtc tagctgattg tgttgtgtaa ctgtaacttt ttttttaata tattgacgtg 420

taatcttttg cgtattcgtg agaaaagctt caacagttat gcattattta gtacgacttg 480

actcttgacc gaagacttgt gagaaactct ttgggtcctt cctaacagcc gtgtcaaata 540

aaatcgaacc gagctcaccg taccaaacga aataggagta ctagttgtca cttgtcagag 600

ctgaagaatt gaacaagaag ttgtcctaac aaatttaaat aaaaaaaact gccattggcc 660

aattatgact gtaagattac agtttgttta tatcacacat ttatactctc tctctctctc 720

tcttcaaagt tacgggtttg tcctaactca gttttttttt cgagtttaac taaattcata 780

ggaaaacgta gtaacctcta caataataaa ttagttacat taaatatacc atttaataca 840

ttttttgtat tatttttttg ggggggtaaa tatcattatg tttttatatt aacttagtca 900

atttttcttt ataataattt gacgaggaca aatccaaaac aacttaatag aatgtagtac 960

aaacacatag aaaggaaaag gaaaagagtt ggcttttaca aaagagccaa ctttatatat 1020

gttatatcta agtgagacta gttaaaatca agaaattaga ggaaaaatgg aaatggtaaa 1080

agtggataga atatttcaaa ccattcatgt aattatactc catccattct aaaatataaa 1140

aatctagtat cagattagac attttatagt acaacaaatc tgattaaggg tgtgtttagt 1200

tcacgttaaa attgaaagtt tgactgaaat tggaacgata tgacagaaaa gttagaagtt 1260

tgtgtgtaga aaagttttga tgtgatgaaa aagttgaaag tttaaagaaa atgttgggaa 1320

ctaaaccaag cctaagcttt ctttttagat tcgtagtatt ataaaatatc taatccgata 1380

gttttgggac ggatggatcg aatagatgat atgaacaatt gaatactacg atgcggatgc 1440

acagctgcaa acactgtaac gatcattttt ttttgtgcat gatgataatg ttattgtaac 1500

tgccgcaaca agctgcaccg aacatgttca cagtttatac tcgccccttt caaaatacat 1560

caatttatgg ttggacaaga catatgattt gttcagatcc atagtaacag aataagctgc 1620

aacgaaggta cgagtagtac tgtagttaac agttgcctta aaagtttaca agtgatatta 1680

ctccaacggc tagacaatga agtgtgaatg atgagtacgc cctatatgtg ctggccgctg 1740

aggtatacag tatatgggcc aacggccaca tgacgaaaat atttattgac ttgaattggt 1800

tcctacactt cataccaact tgttgcttca attatccagc tttggaaact cgctgtttgt 1860

ttcttggttc gattaataat gagcccgacg gttcgacgta ctggagctgg agaatccttt 1920

aaaggacaac aaggtaagga gaaccaggtc ttgccttccg ctttagcaga ggcataaaca 1980

aaagtctgta ttcccaagca 2080

<210>5

<211>2002

<212>DNA

<213> Oryza sativa (Oryza sativa Pest 64s)

<400>5

cttcatttta agaagatatt attttagcca agccggttta aaataaacga atcaaattta 60

cttaaatgag tatgtacaca caaatttact tcaaaaactt tattgttggt tatagatctg 120

cataagttca ttattagctt ttcattaatg attctaactc tgggaagctt caacagtgat 180

tctgaaatcc atccactcgg agggtagtct gtgtagtcgc tagctgtgtt gccacttttg 240

gggacttgtt aggagtgtag tgcggctcag ccccttcctg ttgtttggag ttttgcttta 300

accgccgtag tttttctaag cttcagtttt ttattttgct ttttcttctt tcccctggta 360

tagaccggtc tagctgattg tgttgtgtaa ctgtaacttt tttttctaat atattgacgt 420

gtaatctttt gcgtattcgt gagaaaagct tcaacagtta tgcattattt agtacgactt 480

gactcttgac cgaagacttg tgagaagctc tttgggtcct tcctaacagc cgtgtcaaat 540

aaaatcgaac cgagctcacc gtaccaaacg aaataggagt actagttgtc acttgtcaga 600

gctgaagaat tgaacaagaa gttgtcctaa caaatttaaa taaaaaaaac tgccattggc 660

caattatgac tgtaagatta cagtttgttt atatcacaca tttatactct ctctctctct 720

cttcaaagtt acgggtttgt cctaactcag tttttttttc gagtttaact aaattcatag 780

gaaaacgtag taacctctac aataataaat tagttacatt aaatatacca tttaatacat 840

tttttgtatt attttttttg ggggggggta aatatcatta tgtttttata ttaacttagt 900

caatttttct ttataataat ttgacgagga caaatccaaa acaacttaat agaatgtagt 960

acaaacacat agaaaggaaa aggaaaagag ttggctttta caaaagagcc aactttatat 1020

atgttatatc taagtgagac tagttaaaat caagaaatta gaggaaaaat ggaaatggta 1080

aaagtggata gaatatttca aaccattcat gtaattatac tccatccatt ctaaaatata 1140

aaaatctagt atcagattag acattttatagtacaacaaa tctgattaag ggtgtgttta 1200

gttcacgtta aaattgaaag tttgactgaa attggaacga tatgacagaa aagttagaag 1260

tttgtgtgta gaaaagtttt gatgtgatgg aaaagttgaa agtttaaaga aaatgttggg 1320

aactaaacca agcctaagct ttctttttag attcgtagta ttataaaata tctaatccga 1380

tagttttggg acggatggat cgaatagatg atatgaacaa ttgaatacta cgatgcggat 1440

gcacagctgc aaacactgta acgatcattt ttttttgtgc atgatgataa tgttattgta 1500

actgccgcaa caagctgcac cgaacatgtt cacagtttat actcgcccct ttcaaaatac 1560

atcaatttat ggttggacaa gacatatgat ttgttcagat ccatagtaac agaataagct 1620

gcaacgaagg tacgagtagt actgtagtta acagttgcct taaaagttta caagtgatat 1680

tactccaacg gctagacaat gaagtgtgaa tgatgagtac gccctatatg tgctggccgc 1740

tgaggtatac agtatatggg ccaacggcca catgacgaaa atatttattg acttgaattg 1800

gttcctacac ttcataccaa cttgttgctt caattatcca gctttggaaa ctcgctgttt 1860

gtttcttggt tcgattaata atgagcccga cggttcgacg tactggagct ggagaatcct 1920

ttaaaggaca acaaggtaag gagaaccagg tcttgccttc cgctttagca gaggcataaa 1980

caaaagtctg tattcccaag ca 2081

<210>6

<211>110

<212>PRT

<213> Oryza sativa (Oryza sativa)

<400>6

Met Tyr Pro Ser Ala Pro Pro Asp Ala Tyr Asn Lys Tyr Ser Ala Gly

15 10 15

Ala Pro Pro Thr Ala Pro Pro Pro Ala Thr Tyr Gln Leu Pro Thr Met

20 25 30

Asn Thr Pro Arg His Arg Arg Gly Ala Asp Ala Met Val Ser Pro Ala

35 40 45

Phe Ser Thr Ala Trp Thr Ile Pro Glu Thr Val Ser Ser His Ala Cys

50 55 60

Ala Pro Ala Ser Pro Leu Gly Arg Ser Leu Thr Ser Trp Thr Arg Ala

65 70 75 80

Pro Ala His Ala Ser Arg Ala Gly Arg Leu Thr Arg Ser Ser Ala Arg

85 90 95

Arg Gly Trp Gly Ala Cys Thr Arg Ala Ser Thr Gly Pro Arg

100 105 110

<210>7

<211>110

<212>PRT

<213> Oryza sativa (Oryza sativa)

<400>7

Met Tyr Pro Ser Ala Pro Pro Asp Ala Tyr Asn Lys Tyr Ser Ala Gly

1 5 10 15

Ala Pro Pro Thr Ala Pro Pro Pro Ala Thr Tyr Gln Leu Pro Thr Met

20 25 30

Asn Thr Pro Arg His Arg ArgGly Ala Asp Ala Met Val Thr Pro Ala

35 40 45

Phe Ser Thr Ala Trp Thr Ile Pro Glu Thr Val Ser Ser His Ala Cys

50 55 60

Ala Pro Ala Ser Pro Leu Gly Arg Ser Leu Thr Ser Trp Thr Arg Ala

65 70 75 80

Pro Ala His Ala Ser Arg Ala Gly Arg Leu Thr Arg Ser Ser Ala Arg

85 90 95

Arg Gly Trp Gly Ala Cys Thr Arg Ala Ser Thr Gly Pro Arg

100 105 110

<210>8

<211>21

<212>DNA

<213> Artificial sequence ()

<400>8

tctgctcgaa attaagttca c 21

<210>9

<211>24

<212>DNA

<213> Artificial sequence ()

<400>9

acgctaatag ttttctcact tttg 24

<210>10

<211>18

<212>DNA

<213> Artificial sequence ()

<400>10

ggctgctact actgtgct 18

<210>11

<211>20

<212>DNA

<213> Artificial sequence ()

<400>11

catatgcgga aaaagggaag 20

<210>12

<211>20

<212>DNA

<213> Artificial sequence ()

<400>12

cgcaataccg gatatctcaa 20

<210>13

<211>20

<212>DNA

<213> Artificial sequence ()

<400>13

taagtgccac atgagacaaa 20

<210>14

<211>20

<212>DNA

<213> Artificial sequence ()

<400>14

tattacacat ttgtagttac 20

<210>15

<211>20

<212>DNA

<213> Artificial sequence ()

<400>15

taaaactagc atggtggtcc 20

<210>16

<211>20

<212>DNA

<213> Artificial sequence ()

<400>16

atgtgaatgt agtgttgtat 20

<210>17

<211>20

<212>DNA

<213> Artificial sequence ()

<400>17

gctcacttcg gtggcaatcc 20

<210>18

<211>20

<212>DNA

<213> Artificial sequence ()

<400>18

aggaatttga cttgtgggtg 20

<210>19

<211>20

<212>DNA

<213> Artificial sequence ()

<400>19

tagtttgggc tgcatatgtt 20

<210>20

<211>22

<212>DNA

<213> Artificial sequence ()

<400>20

gttgatcttt tgcttttcta gt 22

<210>21

<211>20

<212>DNA

<213> Artificial sequence ()

<400>21

ctaggttgaa aaggctcact 20

<210>22

<211>22

<212>DNA

<213> Artificial sequence ()

<400>22

ctttctgaag cacaaatatg gt 22

<210>23

<211>20

<212>DNA

<213> Artificial sequence ()

<400>23

agtaaacaag caacagagga 20

<210>24

<211>19

<212>DNA

<213> Artificial sequence ()

<400>24

ccgttgatcg aatcatgga 19

<210>25

<211>20

<212>DNA

<213> Artificial sequence ()

<400>25

tgtctcttcg tatttggtgg 20

<210>26

<211>23

<212>DNA

<213> Artificial sequence ()

<400>26

ggcacgatga acaccccacg cac 23

<210>27

<211>23

<212>DNA

<213> Artificial sequence ()

<400>27

aaacgtgcgt ggggtgttca tcg 23

<210>28

<211>23

<212>DNA

<213> Artificial sequence ()

<400>28

gccgggctga cgcgatggtc cac 23

<210>29

<211>23

<212>DNA

<213> Artificial sequence ()

<400>29

aaacgtggac catcgcgtca gcc 23

<210>30

<211>32

<212>DNA

<213> Artificial sequence ()

<400>30

aaaggatcca tgtatccctc cgcccctccc ga 32

<210>31

<211>33

<212>DNA

<213> Artificial sequence ()

<400>31

aaaggatcct acctcatcat gccgaccggg acg 33

Claims (4)

1. The application of protein in regulating and controlling the grain weight of plant grains is characterized in that the amino acid sequence of the protein is shown as SeqID No: 3 is shown in the specification;

the protein negatively regulates and controls the plant grain weight through a promoter of the gene;

the plant is rice, the grain shape is grain width, and the promoter sequence is Seq ID No: 4 or Seq ID No: 5, and a 5' non-coding region DNA sequence shown in the specification.

2. Use of a gene encoding the protein of claim 1 for regulating the grain size weight of a plant, wherein the plant is rice, the grain size is grain width, and the promoter sequence of the gene is Seq ID No: 4 or Seq ID No: 5, and a 5' non-coding region DNA sequence shown in the specification.

3. The use according to claim 2, wherein the gene encoding the protein has the sequence shown in (a) or (b):

(a) seq ID No: 1;

(b) seq ID No: 2;

4. the use according to claim 2 or 3, wherein the rice grain width and grain weight are increased by gene knock-out; the gene knockout vector is a CRISPR/Cas9 vector; the target joint primer for knocking out the target sequence of the gene comprises the following components:

cas-F1：ggcaCGATGAACACCCCACGCAC；

cas-R1：aaacGTGCGTGGGGTGTTCATCG；

or:

cas-F2：gccgGGCTGACGCGATGGTCCAC；

cas-R2：aaacGTGGACCATCGCGTCAGCC。

Images