CN114317469A - Flavin monooxygenase mutant and preparation and application thereof - Google Patents

Abstract

The invention belongs to the technical field of enzyme genetic engineering, and particularly relates to a flavin monooxygenase mutant with improved enzyme activity and preparation and application thereof. Wild type flavin monooxygenase genes from garlic (Allium sativum) are synthesized through whole genes, random mutation is carried out on the wild type flavin monooxygenase genes by utilizing an error-prone PCR technology to obtain a flavin monooxygenase mutant N91G and a coding gene asfmom thereof, recombinant plasmids are reconstructed, efficient expression of the flavin monooxygenase genes in escherichia coli and pichia pastoris is realized, and the flavin monooxygenase with further improved activity is obtained through technologies such as fermentation and extraction.

Description

Flavin monooxygenase mutant and preparation and application thereof

The technical field is as follows:

the invention belongs to the technical field of enzyme genetic engineering, and particularly relates to a flavin monooxygenase mutant with improved enzyme activity and preparation and application thereof.

Background art:

flavin-monooxygenase (FMO, EC 1.14.13.8), an enzyme that adds oxygen to the C, N and S atoms, catalyzes the binding of one oxygen atom of oxygen to a hydrogen atom provided by an electron donor to form water and the insertion of another oxygen atom into an organic substrate to form a new product, a reaction that is strictly cofactor dependent. Alliin, which is a unique sulfur-containing compound in garlic, can be used as a natural preservative, and has similar killing effect strength on various fungi to benzoic acid and sorbic acid which are chemical preservatives; has antioxidant and free radical scavenging activity, and can delay aging; meanwhile, the composition has important pharmacological effects of resisting bacteria and viruses, resisting tumors, synergistically reducing blood pressure and the like. Therefore, the alliin with various biological activity functions can be prepared by catalyzing the deoxyalliin with the flavin monooxygenase, and the alliin synthesized by the enzyme method can be applied to food preservatives, food seasonings, health-care foods, medicaments and the like, and has great utilization value and application prospect.

At present, people mainly obtain alliin by an extraction method and a chemical synthesis method, and the enzymatic synthesis method is less in use. However, the enzymatic synthesis is receiving attention due to its safety, high efficiency and high yield. The advantages of the enzymatic synthesis mainly lie in the following points: firstly, the enzymatic synthesis is safer and more green than the chemical synthesis, and the cost is lower; secondly, the extraction method has low efficiency, and a large amount of allicin is generated in the extraction process due to the reaction of alliin and alliinase, so that the quality of the alliin is reduced; the alliin is synthesized by the enzyme method, and a large amount of alliin can be synthesized according to will by utilizing the characteristics of quick growth and reproduction of microorganisms, easy control and the like.

The application of flavin monooxygenase is strictly limited by its enzymatic properties such as activity, specificity, optimum temperature and pH value, temperature and acid-base stability, solvent tolerance, etc. Therefore, it is necessary to increase the activity of the enzyme and obtain high-yield alliin, thereby realizing industrial production of alliin. However, very few flavin monooxygenases have been reported to catalyze the formation of alliin from deoxyalliin, with low catalytic efficiency and conversion. In the actual production process, the low enzyme activity not only limits the application range, but also increases the industrial application cost, and brings difficulty to the actual application. Therefore, the screening of high-activity flavin monooxygenase has important research significance. In order to solve these practical problems, researchers have improved the functions and characteristics of natural enzymes by protein engineering techniques to meet industrial applications, such as directed evolution, rational design, chemical modification, etc.

Directed evolution is one of the important means to improve the function and properties of enzymes, especially in terms of increasing the catalytic activity of enzymes. It belongs to the irrational design of protein, does not need to obtain the information of high-order structure and catalytic site of protein, only needs to make random mutation on protein amino acid sequence. It can simulate the evolution mechanism of natural selection in the laboratory, quickly establish a mutant library containing a large number of target protein coding genes in vitro by means of molecular biology, and quickly obtain the protein mutant which accords with the application value of human beings by a high-flux directional screening method. The core steps of directed evolution mainly include the construction of a diverse library of mutants and high throughput screening methods. Commonly used include: error-prone PCR, saturation mutagenesis, DNA shuffling, staggered extension PCR, and the like. Site-directed mutagenesis, i.e., rational design, is purposefully modified on the basis of the spatial structure, active site, catalytic mechanism and the like of protein, and only a few amino acids in natural enzyme protein can be replaced, deleted or inserted, so that the high-level structure of the enzyme protein is not changed, and the modification of the function and the characteristic of the enzyme is limited. Therefore, for enzymes with unknown structure and function, directed evolution can make up for the deficiency of rational design to some extent.

The expression system of exogenous gene of Escherichia coli is the most deeply researched and developed expression system, and a plurality of valuable polypeptides and proteins are efficiently expressed in Escherichia coli. It has been widely used in the fields of industry, agriculture, medicine, health, food, animal husbandry, aquatic product and scientific research as a safe, efficient, multifunctional and potentially-developed microbial strain.

The yeast expression system has the advantages of both prokaryotic and higher eukaryotic systems, has the characteristics of common culture conditions, high growth speed, relatively low cost, capability of protein post-translational processing, easy obtainment of soluble active recombinant protein and the like, and is widely used for the production and preparation of recombinant protein, particularly eukaryotic protein. The pichia pastoris has the advantages of high growth speed, abundant commercial expression vectors, capability of obtaining high-efficiency secretion expression and the like, so that the pichia pastoris becomes the preferred choice for expressing recombinant proteins by yeast. Compared with the common escherichia coli expression system, the method has the unique advantage that the product expressed by the target gene can be secreted to the outside of cells, thereby reducing the cost and the workload of further collecting, separating and purifying the gene expression product. With the development of molecular biology technology and the deep research of pichia pastoris, a large number of genes have been cloned and expressed by using a pichia pastoris expression system, and some genes have been subjected to large-scale industrial production, and various enzymes and clinically required chemicals or industrial products are produced by expression of pichia pastoris.

The invention content is as follows:

based on the problems in the prior art, the invention aims to provide a novel flavin monooxygenase with improved activity and preparation and application thereof.

The technical route for achieving the purpose of the invention is summarized as follows:

the method comprises the steps of obtaining a garlic (Allium sativum) wild type flavin monooxygenase (AsFMO) encoding gene through whole gene synthesis, constructing a recombinant vector through enzyme digestion, connection and the like, obtaining a wild type AsFMO sequence (shown as SEQ ID No.2) through sequencing, carrying out random mutation on the wild type AsFMO encoding gene by using an error-prone PCR technology, screening by using an escherichia coli expression system to obtain an AsFMO mutant N91G and an encoding gene AsFMO thereof, reconstructing the recombinant vector, realizing high-efficiency expression of the AsFMO mutant in escherichia coli and pichia pastoris, and obtaining the AsFMO mutant with improved activity through technologies of fermentation, extraction and the like.

The following definitions are used in the present invention:

1. nomenclature for amino acid and DNA nucleic acid sequences

The accepted IUPAC nomenclature for amino acid residues is used, in the form of a three letter code. DNA nucleic acid sequences employ the accepted IUPAC nomenclature.

Identification of AsFMO mutants

The "amino acid substituted at the original amino acid position" is used to indicate the mutated amino acid in the AsFMO mutant. E.g., Asn91Gly (N91G), representing the substitution of the amino acid at position 91 from Asn of wild type AsFMO to Gly, the numbering of the positions corresponding to the amino acid sequence numbering of wild type AsFMO in SEQ ID No. 1.

In the present invention, lower italic AsFMO represents the coding gene for wild type AsFMO and lower italic AsFMO represents the coding gene for mutant N91G, the information being as in the table below.

	Amino acid mutation site	Site of gene mutation	Amino acid SEQ ID No.	Nucleotide SEQ ID No.
					Wild type AsFMO	—	—	1	2
Mutant N91G	Asn91Gly	AAC→GGT	3	4

The expression vector of the AsFMO mutant N91G and the coding gene thereof is pET-28a or pPIC9K, and the host cell can be escherichia coli BL21(DE3) or pichia pastoris GS 115.

The experimental scheme of the invention is as follows:

1. obtaining the gene coded by the AsFMO mutant N91G, comprising the following steps:

(1) carrying out error-prone PCR random mutation by taking a garlic wild type AsFMO coding gene AsFMO (SEQ ID No.2) as a template;

(2) the randomly mutated AsFMO coding gene is subjected to enzyme digestion, connection and the like to construct a recombinant plasmid with pET-28a, then the recombinant plasmid is transferred into escherichia coli BL21(DE3), an AsFMO mutant with improved activity is obtained through screening, the AsFMO mutant coding gene asfmom is obtained through sequencing, the mutant is named as mutant N91G, and the plasmid pET-28a-asfmom containing mutant N91G coding gene asfmom and the recombinant bacterium are stored.

2.A pichia pastoris strain containing mutant N91G coding gene asfmom and a process for preparing AsFMO with improved activity by using the pichia pastoris strain comprises the following steps:

(1) the coding gene asfmom of the amplified mutant N91G is transformed into escherichia coli JM109 after constructing a recombinant plasmid with pPIC9K through enzyme digestion, connection and the like, and the plasmid pPIC9K-asfmom containing the asfmom gene and the recombinant bacterium are preserved.

(2) The recombinant plasmid is linearized and then transferred into pichia pastoris GS115, a recombinant strain is obtained through G418 resistance screening and enzyme digestion verification, and then the recombinant strain is cultured and fermented to obtain the AsFMO mutant N91G with improved activity.

3. The process for preparing the AsFMO mutant N91G with improved activity by using an escherichia coli strain containing asfmom gene and a pichia pastoris strain comprises the following steps:

culturing and fermenting a recombinant escherichia coli strain or a pichia pastoris strain containing an AsFMO mutant N91G encoding gene asfmom to obtain an AsFMO mutant N91G with improved activity;

further, the steps of inducing and expressing the AsFMO mutant N91G in an Escherichia coli recombinant strain are as follows:

(1) inoculating a single colony of the recombinant strain BL21(DE3)/pET-28a-asfmom into an LB liquid culture medium containing Kan, and carrying out overnight culture at the temperature of 33 ℃ and at the speed of 220 r/min;

(2) transferring 1mL of overnight-cultured bacterial liquid to 50mL of LB liquid medium containing Kan (the final concentration of Kan is 50 μ g/mL), culturing at 33 deg.C and 220r/min to OD of bacterial liquid₆₀₀0.6-0.8 (about 2-3 h);

(3) IPTG was added to a final concentration of 0.5mmol/L, followed by induction culture at 16 ℃ at a low temperature of 120r/min for 16 hours.

Further, the steps of inducing and expressing the AsFMO mutant N91G in a Pichia pastoris recombinant strain are as follows:

(1) activating GS115/pPIC9K-asfmom, selecting a single colony, inoculating the single colony to a YPD test tube, and culturing at 30 ℃ and 220r/min overnight;

(2) YPD seed solution was inoculated into a 500mL baffled flask containing 50mL BMGY medium to obtain the initial OD₆₀₀The value was 0.1 and the yeast transformants were precultured in BMGY medium at 30 ℃ for 16h at 220 r/min;

(3) the culture was then centrifuged at 6000r/min for 10min and subsequently resuspended in 50mL BMMY medium containing 0.5% methanol, incubated at 30 ℃ at 220r/min, and methanol was added to the medium every 12h to a final concentration of 0.5% and induced for 120 h.

Has the advantages that:

1. according to the invention, wild type AsFMO is subjected to random mutation by using an error-prone PCR technology to obtain the mutant N91G with improved activity, which is improved by 1.92 times compared with the wild type AsFMO enzyme activity.

2. According to the invention, a large intestine expression system and a pichia pastoris expression system are respectively used, so that the high-efficiency expression of the AsFMO mutant with improved activity in different modes is realized.

The attached drawings of the specification:

FIG. 1 is a PCR amplification electrophoresis chart of wild type AsFMO encoding gene of the present invention

Wherein: m is a DNA Marker, and 1 is a wild-type AsFMO coding gene;

FIG. 2 is a restriction enzyme digestion verification diagram of the recombinant plasmid pPIC9K-asfmom of the invention, wherein: m is DNA Marker, 1 is recombination plasmid pPIC9K-asfmom in pichia pastoris through BamHI and XhoI double digestion electrophoretogram;

FIG. 3 is the PCR verification chart of the Pichia pastoris positive transformant of the invention

Wherein: m is a DNA Marker, and 1 is an asfmom gene;

FIG. 4 is an SDS-PAGE pattern of a purified sample of mutant N91G of the present invention

Wherein: m is DNA Marker, and 1 is N91G purified sample.

The specific implementation mode is as follows:

the technical content of the present invention is further illustrated by the following examples, but the present invention is not limited to these examples, and the following examples should not be construed as limiting the scope of the present invention.

The culture medium used in the examples of the present invention was as follows:

LB culture medium: 5.0g/L of yeast extract, 10.0g/L of tryptone, 10.0g/L of NaCl and the balance of water.

MD culture medium: YNB 13.4g/L, glucose 20.0g/L, 4X 10^-5% biotin and the balance water.

YPD medium: peptone 20.0g/L, yeast extract 10.0g/L, glucose 20.0g/L, and water in balance.

BMGY medium: peptone 20.0g/L, yeast extract 10.0g/L, YNB 13.4g/L, 4X 10^-5% biotin, 10% 1mmol/L potassium phosphate buffer (pH 6.0), 0.5% glycerol, and the balance water.

BMMY medium: peptone 20.0g/L, yeast extract 10.0g/L, YNB 13.4g/L, 4X 10^-5% biotin, 10% 1mmol/L potassium phosphate buffer (pH 6.0), 0.5% methanol, and the balance water.

The solid culture medium of the above culture medium was supplemented with 2% agar.

Example 1: obtaining of wild-type AsFMO encoding Gene

1. The wild-type AsFMO encoding gene is from whole gene synthesis. According to the Codon preference of the Escherichia coli, the gene asfmo derived from the allicin monooxygenase is subjected to Codon optimization (shown in SEQ ID NO.2), and the Codon Usage frequency of the Escherichia coli is referred to Codon Usage Database. All codons were optimized without changing the amino acid sequence. The designed gene is handed over to Beijing Okkomy Splending Biotechnology Limited to be synthesized by the whole gene and inserted into a pET-28a cloning vector, and is named as pET-28 a-asfmo.

2. Amplification of wild-type AsFMO encoding genes

Designing an amplification primer of a wild-type AsFMO coding gene, wherein the sequence is as follows:

upstream P1(SEQ ID No. 5):

CGCGGATCCGTCTCTTCTTCTTGTTCCTCTATCC (underlined is the BamHI cleavage site)

Downstream P2(SEQ ID No. 6):

CCGCTCGAGCTAAGACAAAAACTTGGAGAAGGT (XhoI cleavage site underlined)

The reaction system for PCR amplification is 50 μ L, and comprises the following components:

PrimeSTAR Max	25μL
		upstream primer P1 (20. mu. mol/L)	2μL
Downstream primer P2 (20. mu. mol/L)	2μL
		Total gene synthetic sequence	2μL
ddH2O	19μL
		Total volume	50μL

Note: the above-mentioned required reagents are from Takara, a precious bioengineering Co., Ltd.

The setting of the amplification program is as follows:

a. pre-denaturation at 98 ℃ for 30 s;

b. denaturation: 10s at 98 ℃;

c. annealing: 8s at 54 ℃;

d. extension: 10s at 32 ℃;

e.b-d for 30 cycles;

f. extension at 32 ℃ for 10 min.

The PCR product was subjected to agarose gel electrophoresis to visualize the band of garlic wild type AsFMO encoding gene, about 1300bp (see FIG. 1), and then recovered from DNA gel cutting recovery kit and stored at-20 ℃.

Example 2: acquisition of AsFMO mutant N91G

1. Error-prone PCR: carrying out error-prone PCR by taking a wild-type AsFMO coding gene as a template, wherein the reaction system is as follows:

ddH2O	16.25μL
		recombinant plasmid pET-28a-asfmo (5 ng/. mu.L)	1μL
Upstream primer P1 (10. mu. mol/L)	2μL
		Downstream primer P2 (10. mu. mol/L)	2μL
Taq DNA polymerase	0.5μL
		10×Taq buffer	5μL
dATP(10mmol/L)	1μL
		dGTP(10mmol/L)	1μL
dTTP(10mmol/L)	5μL
		dCTP(10mmol/L)	5μL
MgCl2(25mmol/L)	10μL
		MnCl2(10mmol/L)	1.25μL
Total volume	50μL

Note: the above-mentioned required reagents are from Takara, a precious bioengineering Co., Ltd.

After the system is completed, an error-prone PCR reaction is performed, and the program is set as follows:

a. pre-denaturation at 95 deg.C for 5 min;

b. denaturation: 30s at 95 ℃;

c. annealing: 8s at 54 ℃;

d. extension: 90s at 32 ℃;

e.b-d for 35 cycles;

f. extension at 32 ℃ for 10 min.

After the PCR reaction is finished, BamHI and XhoI double digestion is carried out on the PCR product and the vector plasmid, purification and recovery are carried out, the error-prone PCR product is connected with the vector plasmid pET-28a which is also subjected to double digestion, and a transformant is obtained by transforming escherichia coli BL21(DE3), coating the escherichia coli BL21 on an LB solid culture medium containing Kan (100 mu g/mL) and carrying out standing culture in an incubator at 33 ℃ for 12 hours.

2. The screening method comprises the following steps: and (3) performing activity detection by adopting a colorimetric method. AsFMO can oxidize the deoxyalliin into alliin a system with FAD and NADPH, wherein the NADPH is reduced to NADP⁺This material has an absorbance at 340 nm. Therefore, the catalytic efficiency of the AsFMO in a certain time can be quantitatively calculated by detecting the content of NADPH, so that the enzyme activity of the AsFMO can be obtained.

3. Screening of mutant libraries: 200. mu.L of LB liquid medium containing Kan (100. mu.g/mL) was added to each well of a 96-well plate, and then a single clone of each transformant was picked up with a sterilized toothpick into the 96-well plate as much as possible so that just a small amount of the strain was stained each time. The 96-well plate was transferred to a shaker at 220r/min and incubated overnight at 33 ℃. The suspension was transferred to a new 96-well plate (20. mu.L seeds per well, containing 300. mu.L LB medium) and cultured to OD₆₀₀In a medium of 0.6-0.8, cool to 4 deg.C (refrigerator) for about 1 h. Thereafter, a final concentration of 0.5mM IPTG was added to the mixture for induction at 16 ℃ overnight, 120 r/min. Collecting thallus with microporous plate centrifuge, centrifuging at 5000r/min for 10min, and sucking up supernatant. Resuspend the cells in 100. mu.L of resuspension solution (50mM Tris-HCl, 2mM DTT), transfer to 96-well plate, add 10mg/mL lysozyme, react at 25 ℃ and 220r/min for 2 h. Collecting supernatant with a microplate centrifuge at 5000r/min, centrifuging10min, adding 25 μ L of the crushed supernatant into a 96-well plate 1 filled with 35 μ L of reaction solution, reacting at room temperature for 5min, and detecting OD in a microplate reader₃₄₀。

Reaction solution: 50mM Tris-HCl, 0.1mM NADPH, 1mM SAC, 0.1mM FAD, 0.25mM EDTA, 2mM DTT.

4. Selecting mutants with improved activity. According to the condition of the plate 1, calculating the enzyme activity of each mutant, selecting the mutant with the activity improved compared with that of a wild type, performing repeated experiments on the enzyme activity of the selected mutant to obtain the mutant with the activity higher than that of the wild type in 3 independent experiments, inoculating the mutant into a flat plate, and sending out a bacterial sample for sequencing.

Through error-prone PCR in the steps, mutants with improved activity are selected, sequencing is carried out to obtain a mutant containing an amino acid mutation, namely N91G (AAC → GGT), so that AsFMO mutant N91G (SEQ ID NO.3) and coding gene asfmom (SEQ ID NO.4) are obtained, and the recombinant bacterium BL21(DE3)/pET-28a-asfmom containing asfmom gene and pET-28a recombinant plasmid constructed in the embodiment is stored at-80 ℃.

Example 3: construction of recombinant Pichia pastoris strain with improved expression activity of AsFMO

1. Construction of an AsFMO expression plasmid pPIC9K-asfmom with improved Activity

Carrying out double enzyme digestion on the AsFMO mutant N91G encoding gene asfmom and a pichia pastoris expression vector pPIC9K through BamHI and Xho I, then carrying out connection to construct a recombinant plasmid pPIC9K-asfmom, transforming to escherichia coli JM109 competent cells, selecting positive transformants, extracting the plasmid, carrying out enzyme digestion verification (shown in figure 2) and sequencing, and determining that the construction is successful, thereby obtaining the recombinant expression plasmid pPIC 9K-asfmom.

2. Expression plasmid pPIC9K-asfmom transformation of Pichia pastoris GS115

Before the constructed recombinant plasmid is electrically transformed into pichia pastoris, the plasmid pPIC9K-asfmom needs to be subjected to linearization treatment to improve the integration efficiency of the recombinant plasmid on pichia pastoris chromosomes. The single digestion of pPIC9K-asfmom was carried out with SacI, purified and recovered to obtain linearized plasmid DNA.

Preparation of pichia pastoris GS115 competence:

(1) selecting an activated Pichia pastoris GS115 single colony from a YPD plate, inoculating the single colony in a YPD test tube, and carrying out shaking culture at 30 ℃ and 220r/min for 24 h;

(2) 2mL of the above culture medium was transferred to a liquid medium containing 50mL of YPD, and cultured under the above conditions until OD is reached₆₀₀About 1.4;

(3) centrifuging to collect thalli (4000r/min and 8min), mixing the thalli with precooled 30mL of sterile water uniformly, centrifuging to remove supernatant, and repeating the operation again;

(4) re-suspending and uniformly mixing the recovered thalli with 15mL of precooled sorbitol (1mol/L), standing on ice for 5min, centrifuging and removing supernatant;

(5) after resuspending and mixing the cells with 1mL of pre-cooled 1moL/L sorbitol (containing 15% glycerol), appropriate bacterial solution (80-100. mu.L/tube) was dispensed into 1.5mL of EP tube and stored at-80 ℃ for further use.

The linearized expression vector is used for electrically transforming pichia pastoris GS 115:

(1) turning on the electric rotating instrument in advance to preheat the electric rotating instrument;

(2) adding 10 mu L of the purified and recovered linearized product into 90 mu L of competent cells, slightly blowing and sucking the mixture by using a pipette, and uniformly mixing the mixture to completely add 100 mu L of the mixture into a 0.2cm electric transfer cup pre-cooled in advance;

(3) placing the electric rotating cup on ice for 6-8min, wiping the outer wall of the electric rotating cup with water, and immediately placing the electric rotating cup into an electric shock chamber;

(4) electric transfer parameters: 1.5kV, 5ms, 25 muF;

(5) after pulse, immediately adding 1mL of precooled 1mol/L sorbitol solution, blowing, sucking and uniformly mixing, and transferring the mixed solution into a new sterile EP tube;

(6) centrifuging at 4000r/min for 6min, discarding most of supernatant, leaving a small amount of liquid at the bottom to resuspend the thallus, coating on MD plate, and culturing at 30 deg.C for more than 60 h.

3. Screening of Pichia pastoris high copy transformants

(1) For all transformants on the MD plate, all transformants were spotted with sterilized toothpicks onto G418 YPD solid plates with a final concentration of 0.5 mg/mL;

(2) single colonies (larger diameter) were picked from YPD solid plates with a final concentration of 0.5mg/mL G418 and spotted with sterilized toothpicks onto YPD solid plates with a final concentration of 2mg/mL G418.

(3) Single colonies (larger in colony diameter) on YPD solid plates with a final concentration of 2mg/mL G418 were picked, and PCR-verified by a yeast genome-extracted group.

4. Identification of Pichia high copy transformants

Extraction of pichia pastoris genome:

(1) centrifuging to collect yeast cells after overnight culture, adding 300 μ L of genome lysate into the yeast cells, and repeatedly blowing and sucking the yeast cells by using a pipette to suspend the yeast cells;

(2) adding a certain amount of quartz sand and shaking on an oscillator for 25min to fully break the cell wall of the yeast;

(3) adding 400 mu L of genome lysate, and centrifuging at 12000r/min for 10 min;

(4) transferring the obtained supernatant to another EP tube, adding a mixed solution of Tris saturated phenol/chloroform (1:1) with the same volume, fully and uniformly mixing, centrifuging at 12000r/min for 15min, and transferring the supernatant to another EP tube;

(5) after repeated extraction for 2 times, extracting for 1 time by using chloroform with the same volume so as to remove residual phenol;

(6)12000r/min, centrifuging for 15min, transferring the supernatant to another EP tube, adding 0.6 times volume of isopropanol, turning upside down for several times, standing at-80 deg.C for 20min, centrifuging at 12000r/min for 8min to recover genome DNA precipitate;

(3) washing the precipitate with 30% ethanol for 2-3 times;

(8) the EP tube was dried in air for 20-30min, left free of alcoholic smell and 40. mu.L of sterile water was added to dissolve the precipitate.

PCR validation of positive transformants: PCR amplification reaction was performed using genomic DNA as a template, and the conditions of the PCR reaction were as in example 1, and the PCR was verified to be correct (see FIG. 3), thereby obtaining the Pichia pastoris recombinant strain GS115/pPIC 9K-asfmom.

Example 4: induction and expression of AsFMO mutant N91G in escherichia coli recombinant strain

The steps of inducing and expressing the AsFMO mutant N91G in an Escherichia coli recombinant strain are as follows:

(1) inoculating a single colony of the recombinant strain BL21(DE3)/pET-28a-asfmom into an LB liquid culture medium containing Kan, and carrying out overnight culture at the temperature of 33 ℃ and at the speed of 220 r/min;

(2) transferring 1mL of overnight-cultured bacterial liquid to 50mL of LB liquid medium containing Kan (the final concentration of Kan is 50 μ g/mL), culturing at 33 deg.C and 220r/min to OD of bacterial liquid₆₀₀0.6-0.8 (about 2-3 h);

(3) IPTG was added to a final concentration of 0.5mmol/L, followed by induction culture at 16 ℃ at a low temperature of 120r/min for 16 hours.

Example 5: induction and expression of AsFMO mutant N91G in pichia pastoris recombinant strain

The steps of the AsFMO mutant N91G for inducing expression in the pichia pastoris recombinant strain are as follows:

(1) GS115/pPIC9K-asfmom was activated, and a single colony was picked and inoculated into YPD tubes, and cultured overnight at 30 ℃ and 220 r/min.

(2) YPD seed solution was inoculated into a 500mL baffled flask containing 50mL BMGY medium to obtain the initial OD₆₀₀The value was 0.1, and the yeast transformants were precultured in BMGY medium at 30 ℃ and 220r/min for 16 h.

(3) The culture was then centrifuged at 6000r/min for 10min and subsequently resuspended in 50mL BMMY medium containing 0.5% methanol, incubated at 30 ℃ at 220r/min, and methanol was added to the medium every 12h to a final concentration of 0.5% and induced for 120 h.

Example 6: purification and preparation of activity-improved AsFMO in escherichia coli recombinant bacteria

The final fermentation broth of example 4 was centrifuged at 10000r/min for 8min, the supernatant was discarded, and then an appropriate amount of 0.02mol/L of LTris-HCl (pH3.4) (10 mL of 0.02mol/L of Tris-HCl (pH3.4) was added per 1g of wet biomass) to resuspend and mix well, and then cells were disrupted by sonication at 250W for 20 min. After the crushing is finished, centrifuging at 12000r/min for 30min to collect protein supernatant, and obtaining N91G crude enzyme liquid with improved enzyme activity.

The crude enzyme solution is firstly separated out by ammonium sulfate with 25 percent of saturation degree to remove foreign proteins, then the saturation degree is increased to 65 percent, and the target protein is precipitated. After dissolving, dialyzing to remove salt, dissolving the active component obtained after dialysis and desalting by using 0.02mol/L Tris-HCl (pH3.4) buffer solution, loading the active component to a cellulose ion exchange chromatographic column, eluting unadsorbed protein by using the same buffer solution, performing gradient elution by using 0.02mol/L Tris-HCl (pH3.4) buffer solution containing 0-1 mol/L NaCl, and collecting the target protein. The active component obtained by ion exchange is firstly balanced by 0.02mol/L Tris-HCl (pH3.4) buffer solution containing 0.15mol/L NaCl, the sample is loaded to sephadex g25 gel chromatographic column and then eluted by the same buffer solution at the speed of 0.5mL/min to obtain purified enzyme solution, and the purified enzyme solution is taken for SDS-PAGE analysis, and the result is shown in figure 4, and a single band with the size of 52kDa is obtained. And freeze-drying the purified enzyme solution to obtain the high-activity N91G enzyme powder.

Example 7: purification and preparation of activity-improved AsFMO in pichia pastoris recombinant strain

After the induction of the embodiment 5 is finished, the fermentation liquor is centrifuged for 10min at 6000r/min at 4 ℃, and fermentation supernatant is collected (pichia pastoris expression AsFMO is secretory expression and can be directly extracted and purified from the fermentation liquor), so that N91G crude enzyme liquid with improved enzyme activity is obtained. The method of example 6 is adopted, enzyme protein is precipitated by a fractional salting-out method, protein precipitate is collected, dissolved and dialyzed to remove salt, and then eluted enzyme liquid is obtained after ion exchange chromatography and gel chromatography, and the high-activity N91G enzyme powder is prepared by vacuum freeze drying.

Example 8: AsFMO enzyme activity assay

Principle of AsFMO enzyme activity determination

AsFMO can oxidize the deoxyalliin into alliin a system with FAD and NADPH, wherein the NADPH is reduced to NADP⁺This material has an absorbance at 340 nm. Therefore, the catalytic efficiency of the AsFMO in a certain time can be quantitatively calculated by detecting the content of NADPH, so that the enzyme activity of the AsFMO can be obtained.

Definition of AsFMO enzyme Activity

Under conditions of temperature and pH (30 ℃ C., pH3.4, as not specified), AsFMO oxidizes NADPH per minute to produce 1nmol of NADP⁺I.e. 1 enzyme activity unit (U).

The enzyme activity formula is as follows:

enzyme activity:

in the formula: Δ c represents the amount of change (mM) in NADPH concentration from before and after the reaction.

V1 represents the total volume (. mu.L) of the reaction system.

Δ t represents the time (min) taken from the start to the end of the reaction.

V2 represents the volume of enzyme solution (. mu.L).

Standard curve: delta OD₃₄₀＝1.66Δc-0.029

ΔOD₃₄₀The absolute value of the OD value at the beginning of the reaction was subtracted from the OD value measured at the time of 5min of the reaction.

AsFMO enzyme activity determination method and step

Adding 25 μ L of enzyme solution into 96-well plate containing 35 μ L of reaction solution, and reacting at 30 deg.C and pH of 3.4 for 5 min; the OD value was measured at 340nm using a microplate reader. The samples contained 3 sets of replicates.

Reaction solution: Tris-HCl 50mM, NADPH 0.1mM, SAC 1mM, FAD 0.1mM, EDTA 0.25mM, DTT 2 mM.

4. The results of the enzyme activity measurements are shown in the following table (taking crude N91G enzyme solutions prepared in examples 6 and 3 and crude wild-type AsFMO enzyme solution prepared by the same method as the experimental subject):

note: in the preparation of crude enzyme solutions of wild-type AsFMO, recombinant strains of wild-type enzyme were first constructed in the same manner as in examples 2 and 3, and then expression was induced by the same fermentation method as in examples 4 and 5, and crude enzyme solutions were prepared in the same manner as in examples 6 and 3.

Determination of specific Activity of AsFMO

The specific activities of the wild-type AsFMO and the mutant N91G were determined using the enzyme activity assay sample purified from the escherichia coli expression system used in example 6 and the enzyme activity assay method used in example 8, and the results were as follows: the specific activity of the wild type is 19.0U/mg, and the specific activity of the mutant N91G is 55.5U/mg.

Example 9: preparation of alliin

1. Preparation of SACS

The substrate was 1mg/mL SAC (deoxyalliin) in Tris-HCl (pH3.4), and AsFMO mutant N91G, which was prepared according to any one of examples 6-3 of the present invention (10U of enzyme powder was added during catalysis), was added. Reacting for 6h under the stirring action of a magnetic stirrer at room temperature, separating impurities by using an ultrafiltration tube to obtain a supernatant, performing liquid quality detection by using HPLC-MS, calculating the content of SACS (alliin) according to a standard, and further calculating to obtain the yield of SACS (SACS) (mol%) -SAC consumption/initial SAC amount multiplied by 100%.

The SACS yield of wild-type AsFMO was 3.04% as determined by the same method described above.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the claims.

SEQUENCE LISTING

<110> Tianjin science and technology university

<120> flavin monooxygenase mutant and preparation and application thereof

<130> 1

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 457

<212> PRT

<213> Garlic (Allium sativum)

<400> 1

Met Val Ser Ser Ser Cys Ser Ser Ile Pro Lys Met Pro Val Thr Pro

1 5 10 15

Leu Ser Leu Val Thr Arg His Val Ala Ile Ile Gly Ala Gly Ala Ala

20 25 30

Gly Leu Val Thr Ala Arg Glu Leu Arg Arg Glu Gly His Thr Thr Thr

35 40 45

Ile Phe Glu Arg Gly Ser Ser Ile Gly Gly Thr Trp Ile Tyr Thr Pro

50 55 60

Asp Thr Glu Pro Asp Pro Met Ser Gln Asp Ser Ser Arg Pro Ile Val

65 70 75 80

His Ser Ser Leu Tyr Lys Ser Leu Arg Thr Asn Leu Pro Arg Glu Val

85 90 95

Met Gly Phe Leu Asp Tyr Pro Phe Val Glu Lys Thr Asn Gly Gly Asp

100 105 110

Arg Arg Arg Phe Pro Gly His Glu Glu Val Leu Asp Tyr Leu Glu Arg

115 120 125

Phe Gly Arg Glu Phe Gly Val Ser Arg Glu Val Gly Met Glu Lys Glu

130 135 140

Val Val Arg Val Asp Met Glu Gln Gly Gly Lys Trp Thr Val Lys Trp

145 150 155 160

Lys Gly Lys Asp Gly Gly Gly Gly Glu Glu Gly Phe Asp Ala Val Val

165 170 175

Val Cys Asn Gly His Tyr Thr Glu Pro Arg Phe Ala Glu Ile Pro Gly

180 185 190

Ile Asp Val Trp Pro Gly Lys Gln Met His Ser His Asn Tyr Arg Ile

195 200 205

Pro Glu Pro Phe His Asp Gln Val Val Val Ile Ile Gly Ser Ser Ala

210 215 220

Ser Ala Val Asp Ile Ser Arg Asp Val Ala Arg Phe Ala Lys Glu Val

225 230 235 240

His Ile Ala Asn Arg Ser Ile Thr Glu Gly Thr Pro Ala Lys Gln Pro

245 250 255

Gly Tyr Asp Asn Met Trp Leu His Ser Met Ile Lys Ile Thr His Asn

260 265 270

Asp Gly Ser Val Val Phe His Asp Gly Cys Ser Val His Val Asp Val

275 280 285

Ile Met His Cys Thr Gly Tyr Val Tyr Asn Phe Pro Phe Leu Asn Thr

290 295 300

Asn Gly Ile Val Thr Val Asp Asp Asn Arg Val Gly Pro Leu Tyr Lys

305 310 315 320

His Val Phe Pro Pro Leu Leu Ala Pro Ser Leu Ser Phe Val Gly Ile

325 330 335

Pro Trp Lys Ile Val Pro Phe Pro Leu Cys Glu Leu Gln Ser Lys Trp

340 345 350

Ile Ala Ala Val Leu Ser Gly Arg Ile Ser Leu Pro Thr Lys Lys Glu

355 360 365

Met Met Glu Asp Val Glu Ala Tyr Tyr Lys Gln Met Glu Ala Ala Gly

370 375 380

Ile Pro Lys Arg Tyr Thr His Asn Ile Gly His Asn Gln Phe Asp Tyr

385 390 395 400

Asp Asp Trp Leu Ala Asn Glu Cys Gly Tyr Ser Cys Ile Glu Glu Trp

405 410 415

Arg Arg Leu Met Tyr Lys Glu Val Ser Lys Asn Arg Lys Glu Arg Pro

420 425 430

Glu Ser Tyr Arg Asp Glu Trp Asp Asp Asp His Leu Val Ala Gln Ala

435 440 445

Arg Glu Thr Phe Ser Lys Phe Leu Ser

450 455

<210> 2

<211> 1374

<212> DNA

<213> Garlic (Allium sativum)

<400> 2

atggtctctt cttcttgttc ctctatccca aagatgccag ttactccatt gtctttggtt 60

actagacacg tcgctattat tggtgctggt gctgctggtt tggttactgc tagagaattg 120

agaagagagg gtcataccac tactattttc gaacgcggtt cttccattgg tggtacttgg 180

atttacactc cagatactga accagatcca atgtctcaag attcttcccg tccaattgtt 240

cactcttctt tgtacaagtc cttgcgtact aacttgccaa gagaggttat gggttttttg 300

gactacccat tcgtcgaaaa gactaacggt ggtgacagaa gaagatttcc aggtcatgaa 360

gaggttttgg attacttgga gagatttggt cgtgaatttg gtgtttctag agaagttggt 420

atggagaagg aagttgtcag agtcgatatg gaacaaggtg gtaagtggac tgttaagtgg 480

aagggtaagg atggtggtgg tggtgaagaa ggttttgatg ctgttgttgt ctgtaacggt 540

cattacactg aaccacgttt tgctgaaatt cccggtattg atgtttggcc aggtaagcaa 600

atgcattctc acaactacag aatcccagag ccatttcacg atcaggttgt cgttatcatt 660

ggttcttctg cttccgctgt tgatatttcc agagatgttg ctagatttgc taaggaagtc 720

catattgcta accgttctat cactgaaggt actccagcta agcaaccagg ttacgataac 780

atgtggttgc actccatgat taagattact cacaacgacg gttctgttgt ttttcatgac 840

ggttgttctg tccatgtcga tgttattatg cactgtaccg gttacgttta caacttccca 900

ttcttgaaca ccaacggtat tgttactgtc gatgacaaca gagttggtcc attgtacaag 960

catgttttcc caccattgtt ggctccatct ttgtcttttg ttggtatccc ctggaagatt 1020

gttccatttc ccttgtgtga attgcagtct aagtggattg ctgctgtttt gtccggtaga 1080

atttctttgc caaccaagaa ggaaatgatg gaagacgttg aagcttacta caagcaaatg 1140

gaagctgctg gtattccaaa gagatacacc cacaacattg gtcataacca gttcgactac 1200

gatgattggt tggctaacga atgtggttac tcctgtattg aagaatggcg tcgtttgatg 1260

tacaaggaag tctccaagaa cagaaaggaa agaccagagt cttacagaga tgaatgggat 1320

gacgatcatt tggttgctca agctagagaa accttctcca agtttttgtc ttag 1374

<210> 3

<211> 457

<212> PRT

<213> Artificial sequence

<400> 3

Met Val Ser Ser Ser Cys Ser Ser Ile Pro Lys Met Pro Val Thr Pro

1 5 10 15

Leu Ser Leu Val Thr Arg His Val Ala Ile Ile Gly Ala Gly Ala Ala

20 25 30

Gly Leu Val Thr Ala Arg Glu Leu Arg Arg Glu Gly His Thr Thr Thr

35 40 45

Ile Phe Glu Arg Gly Ser Ser Ile Gly Gly Thr Trp Ile Tyr Thr Pro

50 55 60

Asp Thr Glu Pro Asp Pro Met Ser Gln Asp Ser Ser Arg Pro Ile Val

65 70 75 80

His Ser Ser Leu Tyr Lys Ser Leu Arg Thr Gly Leu Pro Arg Glu Val

85 90 95

Met Gly Phe Leu Asp Tyr Pro Phe Val Glu Lys Thr Asn Gly Gly Asp

100 105 110

Arg Arg Arg Phe Pro Gly His Glu Glu Val Leu Asp Tyr Leu Glu Arg

115 120 125

Phe Gly Arg Glu Phe Gly Val Ser Arg Glu Val Gly Met Glu Lys Glu

130 135 140

Val Val Arg Val Asp Met Glu Gln Gly Gly Lys Trp Thr Val Lys Trp

145 150 155 160

Lys Gly Lys Asp Gly Gly Gly Gly Glu Glu Gly Phe Asp Ala Val Val

165 170 175

Val Cys Asn Gly His Tyr Thr Glu Pro Arg Phe Ala Glu Ile Pro Gly

180 185 190

Ile Asp Val Trp Pro Gly Lys Gln Met His Ser His Asn Tyr Arg Ile

195 200 205

Pro Glu Pro Phe His Asp Gln Val Val Val Ile Ile Gly Ser Ser Ala

210 215 220

Ser Ala Val Asp Ile Ser Arg Asp Val Ala Arg Phe Ala Lys Glu Val

225 230 235 240

His Ile Ala Asn Arg Ser Ile Thr Glu Gly Thr Pro Ala Lys Gln Pro

245 250 255

Gly Tyr Asp Asn Met Trp Leu His Ser Met Ile Lys Ile Thr His Asn

260 265 270

Asp Gly Ser Val Val Phe His Asp Gly Cys Ser Val His Val Asp Val

275 280 285

Ile Met His Cys Thr Gly Tyr Val Tyr Asn Phe Pro Phe Leu Asn Thr

290 295 300

Asn Gly Ile Val Thr Val Asp Asp Asn Arg Val Gly Pro Leu Tyr Lys

305 310 315 320

His Val Phe Pro Pro Leu Leu Ala Pro Ser Leu Ser Phe Val Gly Ile

325 330 335

Pro Trp Lys Ile Val Pro Phe Pro Leu Cys Glu Leu Gln Ser Lys Trp

340 345 350

Ile Ala Ala Val Leu Ser Gly Arg Ile Ser Leu Pro Thr Lys Lys Glu

355 360 365

Met Met Glu Asp Val Glu Ala Tyr Tyr Lys Gln Met Glu Ala Ala Gly

370 375 380

Ile Pro Lys Arg Tyr Thr His Asn Ile Gly His Asn Gln Phe Asp Tyr

385 390 395 400

Asp Asp Trp Leu Ala Asn Glu Cys Gly Tyr Ser Cys Ile Glu Glu Trp

405 410 415

Arg Arg Leu Met Tyr Lys Glu Val Ser Lys Asn Arg Lys Glu Arg Pro

420 425 430

Glu Ser Tyr Arg Asp Glu Trp Asp Asp Asp His Leu Val Ala Gln Ala

435 440 445

Arg Glu Thr Phe Ser Lys Phe Leu Ser

450 455

<210> 4

<211> 1374

<212> DNA

<213> Artificial sequence

<400> 4

atggtctctt cttcttgttc ctctatccca aagatgccag ttactccatt gtctttggtt 60

actagacacg tcgctattat tggtgctggt gctgctggtt tggttactgc tagagaattg 120

agaagagagg gtcataccac tactattttc gaacgcggtt cttccattgg tggtacttgg 180

atttacactc cagatactga accagatcca atgtctcaag attcttcccg tccaattgtt 240

cactcttctt tgtacaagtc cttgcgtact ggtttgccaa gagaggttat gggttttttg 300

gactacccat tcgtcgaaaa gactaacggt ggtgacagaa gaagatttcc aggtcatgaa 360

gaggttttgg attacttgga gagatttggt cgtgaatttg gtgtttctag agaagttggt 420

atggagaagg aagttgtcag agtcgatatg gaacaaggtg gtaagtggac tgttaagtgg 480

aagggtaagg atggtggtgg tggtgaagaa ggttttgatg ctgttgttgt ctgtaacggt 540

cattacactg aaccacgttt tgctgaaatt cccggtattg atgtttggcc aggtaagcaa 600

atgcattctc acaactacag aatcccagag ccatttcacg atcaggttgt cgttatcatt 660

ggttcttctg cttccgctgt tgatatttcc agagatgttg ctagatttgc taaggaagtc 720

catattgcta accgttctat cactgaaggt actccagcta agcaaccagg ttacgataac 780

atgtggttgc actccatgat taagattact cacaacgacg gttctgttgt ttttcatgac 840

ggttgttctg tccatgtcga tgttattatg cactgtaccg gttacgttta caacttccca 900

ttcttgaaca ccaacggtat tgttactgtc gatgacaaca gagttggtcc attgtacaag 960

catgttttcc caccattgtt ggctccatct ttgtcttttg ttggtatccc ctggaagatt 1020

gttccatttc ccttgtgtga attgcagtct aagtggattg ctgctgtttt gtccggtaga 1080

atttctttgc caaccaagaa ggaaatgatg gaagacgttg aagcttacta caagcaaatg 1140

gaagctgctg gtattccaaa gagatacacc cacaacattg gtcataacca gttcgactac 1200

gatgattggt tggctaacga atgtggttac tcctgtattg aagaatggcg tcgtttgatg 1260

tacaaggaag tctccaagaa cagaaaggaa agaccagagt cttacagaga tgaatgggat 1320

gacgatcatt tggttgctca agctagagaa accttctcca agtttttgtc ttag 1374

<210> 5

<211> 34

<212> DNA

<213> Artificial sequence

<400> 5

cgcggatccg tctcttcttc ttgttcctct atcc 34

<210> 6

<211> 33

<212> DNA

<213> Artificial sequence

<400> 6

ccgctcgagc taagacaaaa acttggagaa ggt 33

Claims (7)

1.A flavin monooxygenase mutant is characterized in that the amino acid sequence of the mutant is shown in a sequence table SEQ ID No. 3.

2. The gene encoding a flavin monooxygenase mutant according to claim 1.

3. The gene encoding the flavin monooxygenase mutant according to claim 2, which is represented by SEQ ID No.4 of the sequence Listing.

4. A recombinant vector or recombinant strain comprising the gene of claim 2.

5. The recombinant vector or recombinant strain of claim 4, wherein the expression vector is pET-28a, and the host cell is E.coli BL21(ED 3); and the expression vector is pPIC9K, and the host cell is Pichia pastoris GS 115.

6. Use of the recombinant vector or recombinant strain according to claim 4 for the preparation of a flavin monooxygenase according to claim 1.

7. Use of a flavin monooxygenase according to claim 1 in the production of alliin.

Images