CN111500596B - Ephedra sinica gene CeSC20 and application thereof - Google Patents
Ephedra sinica gene CeSC20 and application thereof Download PDFInfo
- Publication number
- CN111500596B CN111500596B CN202010365498.7A CN202010365498A CN111500596B CN 111500596 B CN111500596 B CN 111500596B CN 202010365498 A CN202010365498 A CN 202010365498A CN 111500596 B CN111500596 B CN 111500596B
- Authority
- CN
- China
- Prior art keywords
- cesc20
- gene
- drought
- casuarina equisetifolia
- recombinant expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
Abstract
The invention provides an casuarina equisetifolia gene CeSC20 and application thereof, wherein the cDNA sequence of the casuarina equisetifolia gene CeSC20 is shown as SEQ ID No.1, or is a sequence which is completely complementary and matched with the SEQ ID No.1, or is a sequence of which the coding amino acid sequence is shown as SEQ ID No. 2. Functional research carried out by gene cloning discovers that the CeSC20 gene can improve the drought resistance of organisms, can be widely applied to improving the drought resistance of organisms, comprises the construction of drought-resistant saccharomyces cerevisiae engineering strains, the cultivation of drought-resistant plant varieties, the improvement of the drought resistance of plants and the like, and has wide application value in the fields of microorganisms and agriculture.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to an casuarina equisetifolia gene CeSC20 and application thereof.
Background
Environmental factors of plant growth, such as heavy metal, drought, high salt, high temperature and low temperature, can affect the growth and development of plants. Among the many factors that affect plant growth and development, drought and high salt are the most common types. Drought stress affects the distribution and transport of plant photosynthetic products, causing a decrease in plant productivity. Salt stress breaks the ionic balance of plant cells, disrupting the balance of production and clearance of reactive oxygen species in plant cells. The areas of global drought and high-salt regions are huge, the survival, growth and development of plants and crops face the challenges of drought and salt stress, and the research on the stress resistance genes responding to the drought and salt stress is beneficial to cultivating high-yield and high-adaptability crop varieties. The research on the adverse-resistant memory of the probiotics in the extreme environment can provide a research basis for molecular breeding and has guiding significance.
The casuarina equisetifolia grows quickly, has strong adaptability and has low requirements on the growth environment. The casuarina equisetifolia has developed root system and sunken leaf epidermis pores, and has good wind and sand fixing, alkali and drought resistance. The casuarina equisetifolia is an ideal tree species for constructing the wind-proof sand-fixing green land, is also an important tool species for vegetation recovery, is also a production raw material of wood, medicinal materials and the like, and has ecological value and economic value. At present, important anti-adversity genes of casuarina equisetifolia are still to be excavated and developed.
Disclosure of Invention
Based on the above, the casuarina equisetifolia gene CeSC20 and the application thereof are provided, and functional research is carried out through gene cloning to discover that the CeSC20 gene can improve the drought resistance of organisms, can be used for improving the drought resistance of plants and cultivating drought-resistant plant varieties.
The specific technical scheme is as follows:
a casuarina equisetifolia drought-resistant gene CeSC20 is characterized in that the cDNA sequence of the casuarina equisetifolia drought-resistant gene CeSC20 is shown as SEQ ID No.1, or is a sequence which is completely complementary and matched with the SEQ ID No.1, or is a sequence of which the coding amino acid sequence is shown as SEQ ID No. 2.
In some embodiments, the amino acid sequence of the expression protein of the casuarina equisetifolia drought-resistant gene CeSC20 is shown as SEQ ID No. 2.
The invention also provides application of the casuarina equisetifolia drought-resistant gene CeSC20 and expression protein of the casuarina equisetifolia drought-resistant gene CeSC20 in improving the drought-resistant performance of plants.
The invention also provides application of the casuarina equisetifolia drought-resistant gene CeSC20 and the casuarina equisetifolia drought-resistant gene CeSC20 in improving plant drought resistance in plant breeding.
In some of these embodiments, the plant is rice, maize, soybean.
The invention also provides a casuarina equisetifolia drought-resistant gene CeSC20 recombinant expression vector.
The specific technical scheme is as follows:
a casuarina equisetifolia drought-resistant gene CeSC20 recombinant expression vector is inserted with the casuarina equisetifolia drought-resistant gene CeSC 20.
The recombinant expression vector is applied to improving the drought resistance of plants.
In some of these embodiments, the recombinant expression vector is a saccharomyces cerevisiae recombinant expression vector.
In some of these embodiments, it is preferred that the recombinant expression vector is pYES-DEST52-CeSC 20.
The saccharomyces cerevisiae recombinant expression vector is applied to improving the drought resistance of the yeast strain.
In some of these embodiments, the recombinant expression vector is pCAMBIA1300-CeSC 20.
In some embodiments, in the pCAMBIA1300-CeSC20 recombinant expression vector, the promoter controlling the expression of the CeSC20 gene is a UBQ promoter.
The pCAMBIA1300-CeSC20 recombinant expression vector is applied to improving the drought resistance of plants.
The invention also provides a method for improving the drought resistance of the plant.
The specific technical scheme is as follows:
a method for improving drought resistance of plants is characterized in that the casuarina equisetifolia drought resistance gene CeSC20 is transferred into plants and expressed to obtain the drought resistance plants.
In some of these embodiments, the method of improving drought resistance in a plant comprises the steps of:
(1) inserting the cDNA sequence of the casuarina equisetifolia drought-resistant gene CeSC20 into a pCAMBIA1300 plasmid to obtain a pCAMBIA1300-CeSC20 recombinant expression vector;
(2) transforming agrobacterium with the pCAMBIA1300-CeSC20 recombinant expression vector in the step (1), and screening positive agrobacterium;
(3) infecting the positive agrobacterium in the step (2) on the plant to obtain the drought-resistant plant.
In some embodiments, the cDNA of the casuarina equisetifolia drought-resistant gene CeSC20 is obtained by:
(1) taking fresh roots and leaves of casuarina equisetifolia, and extracting to obtain RNA;
(2) carrying out reverse transcription on the RNA obtained in the step (1) to obtain cDNA;
(3) and (3) carrying out PCR amplification by using the cDNA obtained in the step (2) as a template and using an upstream primer shown in SEQ ID NO.3 and a downstream primer shown in SEQ ID NO.4 to obtain the cDNA of the casuarina equisetifolia drought-resistant gene CeSC 20.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides an casuarina equisetifolia drought-resistant gene CeSC20 and constructs a recombinant expression vector of the CeSC20 gene. Functional research is carried out through gene cloning, and the CeSC20 gene can improve the drought resistance of organisms. The recombinant expression vector of the CeSC20 gene is transformed into saccharomyces cerevisiae, and the overexpression of the gene in the saccharomyces cerevisiae is induced by galactose, so that the tolerance of the saccharomyces cerevisiae to oxidation stress can be improved under the stress treatment of high salt and hydrogen peroxide; the recombinant expression vector of the CeSC20 gene is transferred into a plant, so that the CeSC20 gene is over-expressed in the plant, and the drought resistance of the plant can be effectively improved. The CeSC20 gene can be widely applied to improving the drought resistance of organisms, including constructing drought-resistant saccharomyces cerevisiae engineering strains, cultivating drought-resistant plant varieties, improving the drought resistance of plants and the like, and has wide application value in the fields of microorganisms and agriculture.
Drawings
FIG. 1 is a diagram showing the result of agarose gel electrophoresis detection of the PCR amplification product of the CeSC20 gene.
FIG. 2 is a schematic structural diagram of the recombinant expression vector pYES-DEST52-CeSC20 constructed in example 2.
FIG. 3 is a schematic structural diagram of the pCAMBIA1300-CeSC20 recombinant expression vector constructed in example 3.
FIG. 4 is H2O2The result of an experiment on the tolerance of the sensitive yeast strain BY4741 to oxidative stress.
FIG. 5 is H2O2Results of experiments on the tolerance of susceptible yeast strain yap1 to oxidative stress.
Detailed Description
In order that the invention may be more readily understood, reference will now be made to the following more particular description of the invention, examples of which are set forth below. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. These embodiments are provided so that this disclosure will be thorough and complete. It is to be understood that the experimental procedures in the following examples, where specific conditions are not noted, are generally in accordance with conventional conditions, or with conditions recommended by the manufacturer. The various reagents used in the examples are commercially available.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
The cDNA sequence of the casuarina equisetifolia drought-resistant gene CeSC20 is shown as SEQ ID No.1, or is a sequence which is completely complementary and matched with the SEQ ID No.1, or is a sequence of which the coding amino acid sequence is shown as SEQ ID No. 2.
SEQ ID NO.1：
ATGACGGTGAAGCCTGTTAACGTGTCGCTGGACTGTGTTGCTGAAAGTCGGAAGCCGAAGGATTTCTCCTCGCCGGAGTGCGGTGATCTCGCGGGGAAGGTGTCGAGGGATGATCGGAGGGTGGAGGAGACTGAACGGTCGCCTAAGGCGGTGGGGAAATGGGGGAAGTACGTGCATAGCCAGATCCTGAGGATCAGGGAGGAGGACTCGCACCTCGGGGAGGAATTCAGTCTCGGCATCAAGGAGAACGTTCATCTTTCTCACCACCATCATTATGATCACGTGGATTTGCCGGACCCCGCGGTATTCTCCAAGCCGATCTTGCCGAGCTCCCCGCTCAGCCGCAAGACCAGCGCTGTAGAGGCGTTACTTTGA
It is understood that modifications of the base sequence of the above cDNA without changing the amino acid sequence in consideration of the degeneracy of codons also fall within the scope of the present invention.
The amino acid sequence of the expression protein of the casuarina equisetifolia drought-resistant gene CeSC20 is shown in SEQ ID No. 2.
SEQ ID NO.2：
MTVKPVNVSLDCVAESRKPKDFSSPECGDLAGKVSRDDRRVEETERSPKAVGKWGKYVHSQILRIREEDSHLGEEFSLGIKENVHLSHHHHYDHVDLPDPAVFSKPILPSSPLSRKTSAVEALL (. filled.) -end)
Example 1 Ephedra sinica drought-resistant gene CeSC20 and expression protein thereof
The cDNA sequence of the casuarina equisetifolia drought-resistant gene CeSC20 is shown in SEQ ID No.1, or is a sequence which is completely complementary and matched with SEQ ID No.1, or is a sequence of which the coding amino acid sequence is shown in SEQ ID No. 2.
The amino acid sequence of the expression protein of the casuarina equisetifolia drought-resistant gene CeSC20 is shown in SEQ ID No. 2.
The cDNA of the casuarina equisetifolia drought-resistant gene CeSC20 is obtained by the following method:
(1) extracting fresh root and leaf of Ephedra sinica Stapf to obtain RNA
Ephedra sinica RNA was extracted using the Plant RNA Kit, ultrafast Plant RNA extraction Kit, of Beijing Huayuyo Biotech Co., Ltd.
1) Weighing fresh root and leaf of Ephedra sinica Stapf 100mg, quickly placing into mortar, adding liquid nitrogen, and grinding.
2) The ground plant tissue was placed in a centrifuge tube and 1mL of cell lysate was added. The homogenate was transferred to a clean 1.5mL centrifuge tube.
3) Add 300. mu.L of deproteinized solution and 200. mu.L of chloroform to the centrifuge tube, and mix them by shaking for 30 s. Centrifuge at 12000g for 5min at room temperature and transfer the supernatant to a fresh clean 1.5mL centrifuge tube.
4) Adding the same volume of rinsing liquid, fully reversing and mixing uniformly. The mixture was added to a centrifugal adsorption column, centrifuged at 12000g at room temperature for 1min, and the permeate was discarded.
5) Adding 500 μ L of column washing solution, centrifuging at 12000g at room temperature for 1min, and removing the liquid. Add 500. mu.L of column wash and repeat one side. Then, the residue was removed by centrifugation at 12000g for 1min at room temperature.
6) Transferring the centrifugal adsorption column into RNase-free collection tube, adding 50 μ L RNA eluent, and standing at room temperature for 3-5 min.
7)12000g, centrifuging for 1min at room temperature, namely obtaining the casuarina equisetifolia RNA sample in a centrifuge tube, and storing at-80 ℃ for standby.
(2) Carrying out reverse transcription on the RNA obtained in the step (1) to obtain cDNA
The Ephedra sinica RNA obtained in step (1) was subjected to reverse transcription using Super M-MuLV reverse transcriptase from Diamond corporation.
1) The following system was configured in a sterile RNase-free centrifuge tube: mu.L Oligo (dT)18Primer, 2. mu.L dNTP mix (10mM), 1.5. mu.L casuarina total RNA, and RNase free ddH2The volume of O is up to 10 mu L.
2) Keeping the temperature at 65 ℃ for 5min, and then quickly placing on ice for more than 1 min.
3) The denatured solution of RNA was collected at the bottom of the centrifuge tube by centrifugation for several seconds.
4) Preparing a reverse transcription reaction solution in the centrifuge tube: RNA denaturation Solution 10. mu.L, 4. mu.L of 5 XPROMP LV Buffer, 2. mu.L of 10 XPsolving, 1. mu.L of RNase Inhibitor (40U/. mu.L), 1. mu.L of Super M-MuLV (200U/. mu.L), plus RNase free ddH2O is added to the volume of 20 mu L.
5) Flick the centrifuge tube, and keep the temperature at 37 ℃ for 60 min.
6) Keeping the temperature at 80 ℃ for 15min, and cooling on ice to obtain cDNA.
(3) Taking the cDNA obtained in the step (2) as a template, and carrying out PCR amplification by using an upstream primer shown as SEQ ID NO.3 and a downstream primer shown as SEQ ID NO.4
PCR amplification was performed using the high success rate PCR enzyme KOD FX of TOYOBO.
1) An amplification primer:
SEQ ID NO.3：5，-GCTTGGTACCGAGCTCGGATGACGGTGAAGCCTGTTAA-3，
SEQ ID NO.4：5，-GACATCTCCGCAATGAAACTCTTAAGACGTCTATAGGT-3，
2) preparation of PCR reaction solution
The following system was placed in a sterile DNase-free centrifuge tube: 25 μ L of 2 XPCR buffer for KOD FX, 10 μ L of dNTPs (2mM), 1.5 μ L of primer 1(10 pmol/. mu.L), 1.5 μ L of primer 2(10 pmol/. mu.L), 0.2 μ L of cDNA, 1 μ L of KOD FX (1.0U/. mu.L), plus distilled water to 50 μ L.
3) Setting PCR program
Step 1: preheating at 94 deg.C for 2 min;
step 2: denaturation, 98 ℃, 10 sec;
and step 3: annealing at 55 ℃ for 30 sec;
and 4, step 4: extension, at 68 ℃ for 2 min;
and 5: repeating the steps 2-4 for 40 cycles.
The agarose gel electrophoresis detection of the PCR reaction product comprises the following steps:
(1) preparing agarose gel: to 50mL of TAE (1X) was added 1g of agarose, the mixture was placed in a microwave oven and dissolved by heating, and 2. mu.L of Ethidium Bromide (EB) was added to the dissolved solution, which was then poured into a plate and cooled for 30 min.
(2) And putting the cooled agarose gel into an electrophoresis tank, and spotting the PCR product and the DNA marker into the tank for electrophoresis.
(3) Observing the electrophoresis result, and recovering the gel after cutting the strip.
The agarose gel electrophoresis detection result is shown in figure 1, and the casuarina equisetifolia drought-resistant gene CeSC20 is obtained by successful amplification.
The method for recovering the agarose gel electrophoresis detection strip by using the gel recovery kit of the biological engineering company Limited comprises the following steps:
(1) the gel containing the CeSC20 gene fragment was excised from the agarose gel and weighed.
(2) Add 600. mu.L of Buffer B2 per 100mg of gel block and water bath at 50 ℃ until the agarose gel dissolves.
(3) The sol solution was transferred to an adsorption column, centrifuged at 8000g for 30s and the liquid in the collection tube was decanted.
(4) Add 500. mu.L of Wash Solution, centrifuge for 30s at 9000g, and pour off the liquid in the collection tube.
(5) Repeat step 4 once.
(6) The empty adsorption column was centrifuged at 9000g for 1 min.
(7) The adsorption column was placed in a clean 1.5mL centrifuge tube, 25. mu.L of precipitation Buffer was added to the center of the adsorption membrane, and after standing at room temperature for 1min, the tube was centrifuged for 1min to preserve the DNA solution.
Example 2 recombinant expression vector pYES-DEST52-CeSC20 of CeSC20 Gene
The structural schematic diagram of the recombinant expression vector of the CeSC20 gene is shown in FIG. 2, and the recombinant expression vector is obtained by inserting the casuarina equisetifolia drought-resistant gene CeSC20 described in example 1 into a pYES-DEST52 yeast expression vector, and the specific construction method comprises the following steps:
1. obtaining of pYES-DEST52 enzyme digestion vector
Using an endonuclease and a buffer from Thermo Scientific
(1) Preparing pYES-DEST52 enzyme digestion reaction liquid: mu.L of yeast plasmid, 1. mu.L of BamHI, 1. mu.L of EcoRI, 5. mu.L of K buffer (1X), and distilled water to 50. mu.L.
(2) Placing the enzyme digestion reaction solution in a water bath kettle at 37 ℃ and carrying out water bath for 3 h.
2. The casuarina equisetifolia CeSC20 gene is connected to the digested pYES-DEST52 vector.
The ligation was performed using Ready-to-Use Seamless Cloning Kit (Biotechnology engineering Co., Ltd.).
(1) The Infusion system was formulated on ice: mu.L of the DNA solution obtained from the gel of example 1, 1. mu.L of the digested pYES-DEST52 vector, and 2.5. mu.L of the Seamless Cloning Master Mix (2X).
(2) And (3) putting the prepared Infusion system into a water bath kettle at 50 ℃ and carrying out water bath for 20 min.
(3) After completion of the water bath, ice bath was carried out for 2 min.
3. The product obtained in step 2 was introduced into E.coli (DH 5. alpha.).
The Escherichia coli competent strain DH 5. alpha. was used.
(1) The Infusion product was added to DH5 α.
(2) Ice-cooling for 30 min.
(3) Water bath at 42 deg.c for 1 min.
(4) Ice bath for 2 min.
(5) 600. mu.L of LB liquid medium was added to the clean bench.
(6) Shaking and culturing at 37 deg.C for 45 min.
(7) Taking out the cultured DH5 alpha, centrifuging by 10000g for 1 min.
(8) The supernatant was discarded in the clean bench (pipette, 20-50. mu.L remaining).
(9) Resuspend, pipette to bottom without precipitation.
(10) All were plated out in carbenicillin (cab) resistant (1. mu.L/mL) medium.
(11) After the medium was dried, the cells were cultured overnight in an incubator at 37 ℃.
4. Obtaining a yeast expression vector pYES-DEST52-CeSC20 plasmid with CeSC20 gene.
Single colonies were picked from the resistant medium, 600. mu.L of LB broth and 6. mu.L of cab antibiotic were added to a 1.5mL sterile centrifuge tube, and single colonies were added to the centrifuge tube and incubated overnight in a shaker at 37 ℃.
Plasmids were extracted using a crude SanPrep column plasmid DNA miniprep kit.
(1) The overnight cultured broth was centrifuged at 8000g for 2min, and the cells were collected and the medium was discarded.
(2) To the pellet was added 250. mu.L of Buffer P1 to thoroughly suspend the cells.
(3) Add 250. mu.L of Buffer P2, mix by immediately and gently inverting 5-10 times, and let stand at room temperature for 2-4 min.
(4) Add 350. mu.L of Buffer P3 and mix by immediately inverting gently 5-10 times.
(5) Centrifuging at 12000g for 5-10min, transferring supernatant into adsorption column, centrifuging at 8000g for 30s, and pouring out liquid in collection tube.
(6) mu.L of Buffer DW1 was added and centrifuged at 9000g for 30s and the collection tube was decanted.
(7) Add 500. mu.L of Wash Solution, centrifuge for 30s at 9000g, and pour off the liquid in the collection tube.
(8) Repeat step 7 once.
(9) The empty adsorption column was centrifuged at 9000g for 1 min.
(10) The adsorption column was placed in a clean 1.5mL centrifuge tube, 50. mu.L of precipitation Buffer was added to the center of the adsorption membrane, allowed to stand at room temperature for 1min, centrifuged at 9000g for 1min, and the DNA solution in the tube was stored.
(11) The obtained plasmid was sent to sequencing company for sequencing, which was done by Ongzhou Ongji Biopsis.
The plasmid with the correct sequencing result is the pYES-DEST52-CeSC20 recombinant expression vector.
Example 3 recombinant expression vector pCAMBIA1300-CeSC20 of CeSC20 Gene
The recombinant expression vector of the CeSC20 gene of the embodiment is shown in fig. 3, and is obtained by inserting the casuarina equisetifolia drought-resistant gene CeSC20 of embodiment 1 into a pCAMBIA1300 vector, and specifically comprises the following steps: the DNA solution obtained by recovering the glue in the embodiment 1 reacts with the pCAMBIA1300 vector through an Infusion system, then an Infusion product is introduced into a competent cell, a positive single colony is selected, amplification culture is carried out, plasmids are extracted, the obtained plasmids are sent to a sequencing company for sequencing, the sequencing is completed by Guangzhou Pongke biology company, and the plasmid with the correct sequencing result is the recombinant expression vector pCAMBIA1300-CeSC20 of the CeSC20 gene.
Example 4 overexpression of the CeSC20 Gene in Yeast improves the tolerance of Yeast to oxidative stress
The pYES-DEST52-CeSC20 recombinant expression plasmid with correct sequencing result is introduced into H2O2Sensitive strains BY4741 and yap1, empty pYES-DEST52 vector plasmid was introduced into the wild type BY4741 yeast strain as a control.
(1) Single colonies of BY4741 and yap1 were shaken in small conical flasks, respectively, with 20mL of liquid YPD medium and overnight at 28 ℃ as mother liquors.
(2) Taking part of the mother liquor to 20mL of liquid YPD medium, and adjusting initial OD600The value is 02-0.3. Shaking at 28 deg.C for 1.5-2h to OD600Is 0.4-0.6.
(3) The yeast in the conical flask is subpackaged into 15mL centrifuge tubes, 6000g is centrifuged for 5min, and the supernatant is discarded and then the yeast is resuspended by Li salt.
(4) mu.L of carp sperm DNA, 4. mu.L of empty pYES-DEST52 vector plasmid (control group) or pYES-DEST52-CeSC20 recombinant expression plasmid (experimental group), 100. mu.L of competent cells and 600. mu.L of PEG were added to the resuspended tubes, mixed and then cultured in a shaker at 28 ℃ for 30 min.
(5) Heat shock at 42 ℃ for 15min, cooling at 4 ℃ for 2min, centrifugation at 6000g for 30s at room temperature, discarding the supernatant, blotting the PEG, resuspending with 70. mu.L of 1 XTE, and plating onto solid YNB medium supplemented with the corresponding amino acids (830. mu.L each of histidine, leucine and methionine per 100mL of YNB).
(6) The medium was placed in an oven at 28 ℃ for 3 days and single colonies were picked into a centrifuge tube containing 1mL YNB broth.
(7) Placing the centrifuge tube with bacteria in 28 deg.C oven, shaking overnight, and adjusting to the same OD600And (6) finally. The bacterial solution was diluted to 10 ×, 100 × and 1000 ×, respectively, and spotted to H2O2YNB solid medium (830. mu.L each of histidine, leucine and methionine per 100mL of YNB) at concentrations of 0.75mM, 1mM and 1.5mM was oven-cultured at 37 ℃ for one week.
As shown in FIG. 4, in the absence of H2O2The growth of the recombinant expression plasmid containing pYES-DEST52-CeSC20 (represented BY CeSC20 in FIG. 4) and the growth of the strain of BY4741 containing the unloaded pYES-DEST52 plasmid (represented BY pYES2 in FIG. 4) were substantially the same in the YNB medium added. At 0.75mM H2O2Under the condition, the growth conditions of the two are similar; but at 1mM and 1.5mM H2O2The BY4741 growth of the recombinant expression plasmid pYES-DEST52-CeSC20 introduced on YNB medium was significantly better than the BY4741 introduced on the unloaded pYES-DEST52 plasmid.
As shown in FIG. 5, pYES-DEST52-CeSC20 recombinant expression plasmid (shown by CeSC20 in FIG. 5) was introduced into H2O2In the sensitive yeast yap1, the empty vector pYES-DEST52 plasmid (indicated BY pYES2 in FIG. 5) was introduced into BY 4741. In the absence of added H2O2The growth vigor of the YNB medium is basically consistent. At 0.75mM H2O2Under the conditions, H containing pYES-DEST52-CeSC20 recombinant expression plasmid2O2The growth condition of the sensitive yeast yap1 low-concentration bacterial liquid is better than that of BY4741 containing an empty vector pYES-DEST52 plasmid; at 1mM and 1.5mM H2O2The growth of the diluted yap1 yeast containing the recombinant expression plasmid pYES-DEST52-CeSC20 was better than that of the BY4741 yeast containing the empty vector pYES-DEST52 in YNB medium at higher concentrations.
The experimental results show that the pYES-DEST52-CeSC20 recombinant expression plasmid can obviously improve the anti-oxidative stress capability of the yeast, and the pYES-DEST52-CeSC20 recombinant expression plasmid can obviously improve the drought resistance of the yeast.
The technical features of the above embodiments can be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the above embodiments are not described, however, as long as there is no contradiction between the combinations of the technical features, the scope of the present description should be considered as being described in the present specification.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
SEQUENCE LISTING
<110> south China plant garden of Chinese academy of sciences
<120> casuarina equisetifolia gene CeSC20 and application thereof
<140> 202010365498.7
<141> 2020-04-30
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 375
<212> DNA
<213> Artificial Sequence
<400> 1
atgacggtga agcctgttaa cgtgtcgctg gactgtgttg ctgaaagtcg gaagccgaag 60
gatttctcct cgccggagtg cggtgatctc gcggggaagg tgtcgaggga tgatcggagg 120
gtggaggaga ctgaacggtc gcctaaggcg gtggggaaat gggggaagta cgtgcatagc 180
cagatcctga ggatcaggga ggaggactcg cacctcgggg aggaattcag tctcggcatc 240
aaggagaacg ttcatctttc tcaccaccat cattatgatc acgtggattt gccggacccc 300
gcggtattct ccaagccgat cttgccgagc tccccgctca gccgcaagac cagcgctgta 360
gaggcgttac tttga 375
<210> 2
<211> 124
<212> PRT
<213> Artificial Sequence
<400> 2
Met Thr Val Lys Pro Val Asn Val Ser Leu Asp Cys Val Ala Glu Ser
1 5 10 15
Arg Lys Pro Lys Asp Phe Ser Ser Pro Glu Cys Gly Asp Leu Ala Gly
20 25 30
Lys Val Ser Arg Asp Asp Arg Arg Val Glu Glu Thr Glu Arg Ser Pro
35 40 45
Lys Ala Val Gly Lys Trp Gly Lys Tyr Val His Ser Gln Ile Leu Arg
50 55 60
Ile Arg Glu Glu Asp Ser His Leu Gly Glu Glu Phe Ser Leu Gly Ile
65 70 75 80
Lys Glu Asn Val His Leu Ser His His His His Tyr Asp His Val Asp
85 90 95
Leu Pro Asp Pro Ala Val Phe Ser Lys Pro Ile Leu Pro Ser Ser Pro
100 105 110
Leu Ser Arg Lys Thr Ser Ala Val Glu Ala Leu Leu
115 120
<210> 3
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 3
gcttggtacc gagctcggat gacggtgaag cctgttaa 38
<210> 4
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 4
tggatatctg cagaattctc aaagtaacgc ctctacag 38
Claims (7)
1. The casuarina equisetifolia gene CeSC20 is characterized in that the casuarina equisetifolia gene CeSC20 has a cDNA sequence shown as SEQ ID No.1, or the casuarina equisetifolia gene CeSC20 has a nucleotide sequence shown as SEQ ID No.2 in an encoding amino acid sequence.
2. An expression protein of casuarina equisetifolia gene CeSC20 is characterized in that the amino acid sequence of the expression protein of casuarina equisetifolia gene CeSC20 is shown in SEQ ID No. 2.
3. Use of the Ephedra distachya gene CeSC20 of claim 1 or the Ephedra distachya gene CeSC20 of claim 2 for improving the oxidative stress resistance of Saccharomyces cerevisiae cells.
4. An casuarina equisetifolia gene CeSC20 recombinant expression vector, wherein the casuarina equisetifolia gene CeSC20 of claim 1 is inserted on the recombinant expression vector.
5. The casuarina gene CeSC20 recombinant expression vector of claim 4, wherein the recombinant expression vector is pCAMBIA1300-CeSC 20.
6. The use of the casuarina equisetifolia gene CeSC20 recombinant expression vector of claim 4 or 5 in improving the resistance of saccharomyces cerevisiae strains to oxidative stress.
7. An engineered strain of saccharomyces cerevisiae, wherein the casuarina equisetifolia gene CeSC20 recombinant expression vector of claim 4 or 5 is transferred.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010365498.7A CN111500596B (en) | 2020-04-30 | 2020-04-30 | Ephedra sinica gene CeSC20 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010365498.7A CN111500596B (en) | 2020-04-30 | 2020-04-30 | Ephedra sinica gene CeSC20 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111500596A CN111500596A (en) | 2020-08-07 |
| CN111500596B true CN111500596B (en) | 2020-12-25 |
Family
ID=71873833
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010365498.7A Active CN111500596B (en) | 2020-04-30 | 2020-04-30 | Ephedra sinica gene CeSC20 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111500596B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015003171A3 (en) * | 2013-07-03 | 2015-03-12 | Roka Bioscience, Inc. | Compositions, kits, and related methods for detecting and/or monitoring shiga toxin producing escherichia coli |
| CN109503703A (en) * | 2019-01-18 | 2019-03-22 | 中国科学院华南植物园 | Salt tolerance and drought resistance gene IpNY-B1 and its coding albumen and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111040956B (en) * | 2019-12-25 | 2021-07-27 | 福建农林大学 | Endophytic fungus Y6 for enhancing oxidation resistance of casuarina equisetifolia in high-salt environment |
-
2020
- 2020-04-30 CN CN202010365498.7A patent/CN111500596B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015003171A3 (en) * | 2013-07-03 | 2015-03-12 | Roka Bioscience, Inc. | Compositions, kits, and related methods for detecting and/or monitoring shiga toxin producing escherichia coli |
| CN109503703A (en) * | 2019-01-18 | 2019-03-22 | 中国科学院华南植物园 | Salt tolerance and drought resistance gene IpNY-B1 and its coding albumen and application |
Non-Patent Citations (3)
| Title |
|---|
| Casuarin a research and applications in China;Chonglu Zhong等;《Symbiosis》;20091210;第107-114页 * |
| hypothetical protein FH972_007535 [Carpinus fangiana];Yang,X.等;《GeneBank Database》;20191028;Accession NO:KAE8021664.1 * |
| 抗旱基因HDCS1的植物表达载体构建;郭卫东 等;《西北植物学报》;19990615;第371-375页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111500596A (en) | 2020-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109182292B (en) | Strawberry glutathione transferase FaGST gene and expression protein and application thereof | |
| CN109825510A (en) | A kind of Ming River lily LrWRKY2 gene and application | |
| CN107012147B (en) | Drought and/or high-salt induction promoter SlWRKY8P from tomato and application thereof | |
| CN111233989A (en) | Application of rice heavy metal transport protein OsHMA6 in reducing copper toxicity | |
| CN111500595B (en) | Ephedra sinica gene CeDREB1 and application thereof | |
| CN106047895B (en) | Artemisia apiacea bZIP transcription factor coding sequence, cloning method and application | |
| CN111500596B (en) | Ephedra sinica gene CeSC20 and application thereof | |
| CN110041417A (en) | A kind of hexose transport albumen and its encoding gene and application | |
| CN112795580B (en) | Pitaya gene HuAAE3 and application thereof in regulation and control of high temperature stress resistance of plants | |
| CN110734917B (en) | Lycoris longituba LlDFRc gene, protein expressed by same and application of gene | |
| CN114438102A (en) | Strawberry ethylene response FaERF13 gene and application thereof in changing strawberry fruit mature period | |
| CN109438563B (en) | Tobacco KUP7 protein and coding gene and application thereof | |
| CN113201558A (en) | Soybean GmHDA12 gene and protein and application thereof | |
| CN113234753A (en) | Cultivation, identification and application of maize microfilament depolymerizing factor ADF7 transgenic plant | |
| CN106967663B (en) | Recombinant strain for preventing and treating crop diseases | |
| CN109706170A (en) | The expression vector establishment method of arabidopsis FIPV promoter fusion gus gene | |
| CN106086038B (en) | Artemisia apiacea WRKY transcription factor coding sequence, cloning method and application | |
| CN114875043B (en) | Betula alba BpPIF4 gene participating in adventitious root development and application thereof | |
| CN115466318B (en) | Pichia glabra secretory protein PgAsp1 and application thereof | |
| CN113416732B (en) | Dendrobium officinale salt inducible promoter proDoMYB75 and application thereof | |
| CN115160420B (en) | Pichia glabra SCP (SCP) secretion protein and application thereof | |
| CN115160418B (en) | Pichia glabra Peptidase secretion protein and application thereof | |
| CN114540354B (en) | Expression vector containing hot pickled mustard tuber IFL1 promoter fusion GUS gene and application thereof | |
| CN113278639B (en) | Tobacco NUDIX hydrolase gene and application thereof | |
| CN107815454A (en) | A kind of Tobacco Flowering period regulation gene NtMADS1 and its cloning process and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |