CN114277179A

CN114277179A - SCAR marker closely linked with included angle of tomato leaves and application thereof

Info

Publication number: CN114277179A
Application number: CN202210005702.3A
Authority: CN
Inventors: 杨欢欢; 姜景彬; 张一尧; 许向阳; 李景富; 赵婷婷; 张贺; 王傲雪; 陈秀玲
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2022-01-04
Filing date: 2022-01-04
Publication date: 2022-04-05
Also published as: CN115976256A

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to an SCAR marker closely linked with the included angle of tomato leaves and application thereof. The invention identifies and obtains an SCAR marker which is closely linked with the included angle of the tomato leaves, and the sequence of the SCAR marker is shown as SEQ ID No.1 and/or SEQ ID No. 2. The mark can rapidly identify the tomato plant type condition of the leaf included angle in the tomato seedling stage, does not need to wait until the plant type is stable in the later growth stage of the tomato, and can greatly accelerate the breeding process of compact germplasm resources with small tomato included angle and plant type. Can be used for the molecular marker-assisted selective breeding of the tomato plant type, greatly shortens the tomato breeding process and provides practical basis for the improvement of the tomato plant type.

Description

SCAR marker closely linked with included angle of tomato leaves and application thereof

Technical Field

The invention belongs to the technical field of molecular markers, and particularly relates to an SCAR marker closely linked with the included angle of tomato leaves and application thereof.

Background

In the 60 s of the 20 th century, Donald (1968) proposed the concept of ideal plant type, namely the plant type with the minimum field competition, and can improve the utilization rate of light energy to the maximum extent, thereby achieving the purpose of increasing the yield. The leaf angle refers to the angle between the petiole and the stem, and is the main element of the plant type. The leaf angle mainly influences the plant width on the plant type, and the smaller the leaf angle is, the smaller the plant width is, so that the photosynthetic utilization efficiency and the planting density of the plant can be improved, and the purpose of improving the yield of the tomatoes in unit area is achieved. At present, Liu Xing Yu (2020) has accurately positioned two tomato leaf included angle main effect QTLs (LA1-1 and LA1-2) positioned on a tomato 10 # chromosome, and lays the foundation for deeply researching the genetic mechanism formed by the tomato leaf included angle in China, but the research on plant type breeding in China still focuses on field crops such as corn, wheat and the like. The research on tomato plant types, particularly leaf angles, mainly focuses on the field management and transgenic breeding fields. The traditional breeding method is difficult to screen the tomato plant type and low in efficiency, and an early identification method for the tomato plant type leaf angle character by combining a molecular marker technology is not reported.

Molecular marker assisted breeding refers to screening and determining whether an individual contains a target gene or not by combining a molecular marker technology. The method is characterized in that an individual DNA sequence is used for selection, so that the influence of factors such as environment on the growth process of plants is avoided, and the bred seeds have higher genetic stability. The method for screening gene characters can improve the breeding efficiency and accelerate the breeding process. The SCAR marker is a molecular marker obtained by molecular marker transformation such as RAPD, RFLP, SSR and the like, and has become a preferred marker for molecular marker-assisted breeding due to the characteristics of no need of enzyme digestion, simplicity, high efficiency, good repeatability and the like. The SCAR marker for early identification of the leaf angle of the tomato plant has important practical application value.

Disclosure of Invention

The invention aims to provide a new selection for early screening of tomato plant types.

The invention adopts the technical scheme that the sequence of the SCAR marker which is closely linked with the included angle of tomato leaves is shown as SEQ ID No.1 and/or SEQ ID No. 2.

The invention also provides an amplification primer pair of the SCAR marker, and the sequences of the amplification primer pair are shown as SEQ ID No.3 and SEQ ID No. 4.

The invention also provides application of the SCAR marker or the primer pair in tomato breeding.

The invention also provides application of the SCAR marker or the primer pair in identifying the included angle of the tomato leaves.

The invention has the beneficial effects that: the invention identifies and obtains an SCAR marker which is closely linked with the included angle of the tomato leaves. The mark can rapidly identify the tomato plant type condition of the leaf included angle in the tomato seedling stage, does not need to wait until the plant type is stable in the later growth stage of the tomato, and can greatly accelerate the breeding process of compact germplasm resources with small tomato included angle and plant type. In addition, the SCAR marker primer does not need enzyme digestion, only needs PCR one-step detection, has the advantages of low detection cost, high accuracy and the like, can be better used for the auxiliary selective breeding of the tomato internode plant type molecular marker, and can accurately identify the included angle of the tomato leaves by extracting DNA of any available organs or tissues in the tomato leaves, stems, roots and other plants and then using a PCR method, wherein the technical accuracy provided by the invention can reach 99%. Can be used for the molecular marker-assisted selective breeding of the tomato plant type, greatly shortens the tomato breeding process and provides practical basis for the improvement of the tomato plant type.

Drawings

FIG. 1 tomato variety P₁(Inclusion minor mutants) and P₂Comparison of phenotypic variation (wild type with large included angle); a: comparing the tomato plant types; b: comparing included angles; tomato mutant P1 and wild type variety P₂Statistical analysis of included angles, indicates that the differences were very significant.

FIG. 2, SCAR10 marks the amplification cases at large and small angles. Lanes 1-6, 8, 9, 11, 12, 14 represent high included angle tomato material,

lanes

7, 10, 13, 15, 16 represent low included angle tomato material (from left to right), lane 18 is P₁(minor Included mutant), lane 17 is P₂(wild type with large included angle); the rightmost lane is Marker 2000.

Detailed Description

Example 1 obtaining of the SCAR10 marker

Using field mutants P₁(Inclusion minor mutants) and wild type P₂(the included angle is large) for analysis. As shown in FIG. 1, the material tomato mutant P₁The included angle is small, the plant type is compact, the light transmission is good, and the blades are not easy to shield; tomato wild type variety P₂Large included angle opening, poor light transmission and shielding among blades.

Using tomato field mutant P₁(Inclusion minor mutants) and wild type P₂(with large included angle) as material to obtain F1, F₁Selfing to obtain F₂And (4) a group. Binding of F Using parental Re-sequencing₂A group separation group Analysis (BSA) method is used for obtaining a candidate interval for controlling the size of the included angle. The specific operation is as follows: selection of parent P₁、P₂Each strain F₂Carrying out DNA extraction on 25 plants in each extreme mixing pool; and constructing and sequencing a library, and finishing the BGISEQ platform whole genome re-sequencing by the Shenzhen Hua large company.

Association analysis for father, mother and F by BSA₂And (3) extracting the genomic DNA of the extreme mixed pool, sequencing and assembling data. The reference genome in the data assembly was tomato SL3.0 (website https:// solgenomics. net/jbrown _ solgenomics/&loc＝SL3.0ch11％3A10128546..10128799&tracks＝ITAG3.0％20gene％20models％2CDNA&highlight), and screening to obtain a preliminary candidate interval, and finding that the intron of the mutant (small leaf angle) gene in the target region has the insertion of the 107bp segment. Based on the mutation, primers are designed before and after the mutation for amplification, and finally, a stably linked molecular marker SCAR10 is obtained. Through sequencing, the DNA sequence (SEQ ID No.1) of the specific strip of the leaf angle small tomato plant is as follows:

tattcattgattctgatcgttgtgactattataatcctaaattgattaaatcttggcaaagggaattgatattttgttcacatgtgaggtgttgtagaggttactggactactaaagaatatgggatttcttttacttgtctaaaaacaaaagcttatgtgttttctcgtagtgcttggatttatatcttgatttctcagatgatggattgaaattcatactctgatatggtaatctttttgataaccaagatagccacatcagaggctgaattttaatccatcatcagactctgatatggttatctttagaatgcctgccatttttaatcaagagatctttagtttataactgttttggtttggtcaaaatgcacaaccagggcccagagaacttacaggtgctgtggatcttattagccacttcaaattgttgcctcatcaagagttcttctgcaagaggtcacttccattgtctatttcagatacccattatcttcacaatg

the DNA sequence (SEQ ID No.2) of the specific strip of the big leaf-included tomato plant is as follows:

tattcatttgatctgatcttgtgactattataatcctaaatttattaaatcttgacaaagggaattgatattttgttcacatgtgaggtgttgtagaggttactggactactaaagaatatgggatttcttttgataacaaagatagccacatcagagtcttaattttaatccatcatcagactctgatatggttatctttagaatgcctgccatttttaatcaagaaatctttagtttataactgttttggtttggtcaaaatgcacaaccagggcccagagaacttacaggtgctgtggatcttattagtcacttcaaattgttgcctcatcaagagttcttctgcaagaggtcacttccattgtctatttcagatacccattatcttcacaatg

based on the differences in the sequences, amplification primers are involved. The upstream primer SCAR10-F1(SEQ ID No.3) acctggatggtgttagctgtc and the downstream primer SCAR10-R1(SEQ ID No.4) tgtcacccaccacattgtgaa.

EXAMPLE 2 application of molecular markers

The tomato material in table 1 was used for seedling stage identification. Tomato leaf blade genomic DNA was extracted by CTAB method (Cetyltrime Thylammonium Bromide).

The reaction system for PCR amplification is a 20-mu L system: 1 mu L and 2 mu L of template DNA of the upstream primer SCAR10-F1 and the downstream primer SCAR10-R1 respectively,8μL ddH₂O，8μL 2×Es Taq MasterMix。

the reaction procedure for PCR amplification was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing at 55 ℃ for 30 s; extension at 72 ℃ for 30 s; circulating for 35 times; extending for 10min at 72 ℃; after the reaction, the amplification product was stored in a refrigerator at 4 ℃. Detecting the marker band pattern by 0.1-0.2% agarose electrophoresis.

The results of the partial detection are shown in FIG. 2. As shown in fig. 2: a tomato material with a small leaf angle can amplify a specific strip of 504bp, and a tomato material with a large leaf angle can amplify a specific strip of 397 bp. And observing after the material is further cultured, wherein the coincidence rate of molecular identification and field phenotype identification is 99%. Therefore, the marker SCAR10 can accurately identify the included angle of the tomato leaves in the seedling stage, can be used for auxiliary selective breeding of tomato plant type molecular markers, can greatly shorten the breeding process of tomatoes, and has certain production practice significance.

TABLE 1 molecular marker identification and statistical field phenotype

Sequence listing

<110> northeast university of agriculture

<120> SCAR marker closely linked with included angle of tomato leaves and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 505

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tattcattga ttctgatcgt tgtgactatt ataatcctaa attgattaaa tcttggcaaa 60

gggaattgat attttgttca catgtgaggt gttgtagagg ttactggact actaaagaat 120

atgggatttc ttttacttgt ctaaaaacaa aagcttatgt gttttctcgt agtgcttgga 180

tttatatctt gatttctcag atgatggatt gaaattcata ctctgatatg gtaatctttt 240

tgataaccaa gatagccaca tcagaggctg aattttaatc catcatcaga ctctgatatg 300

gttatcttta gaatgcctgc catttttaat caagagatct ttagtttata actgttttgg 360

tttggtcaaa atgcacaacc agggcccaga gaacttacag gtgctgtgga tcttattagc 420

cacttcaaat tgttgcctca tcaagagttc ttctgcaaga ggtcacttcc attgtctatt 480

tcagataccc attatcttca caatg 505

<210> 2

<211> 397

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tattcatttg atctgatctt gtgactatta taatcctaaa tttattaaat cttgacaaag 60

ggaattgata ttttgttcac atgtgaggtg ttgtagaggt tactggacta ctaaagaata 120

tgggatttct tttgataaca aagatagcca catcagagtc ttaattttaa tccatcatca 180

gactctgata tggttatctt tagaatgcct gccattttta atcaagaaat ctttagttta 240

taactgtttt ggtttggtca aaatgcacaa ccagggccca gagaacttac aggtgctgtg 300

gatcttatta gtcacttcaa attgttgcct catcaagagt tcttctgcaa gaggtcactt 360

ccattgtcta tttcagatac ccattatctt cacaatg 397

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acctggatgg tgttagctgt c 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtcacccac cacattgtga a 21

Claims

1. The SCAR marker closely linked with the included angle of tomato leaves is characterized in that the sequence is shown as SEQ ID No.1 and/or SEQ ID No. 2.

2. Primer pair for amplifying SCAR markers according to claim 1, characterized in that the sequences are shown as SEQ ID No.3 and SEQ ID No. 4.

3. Use of a SCAR marker as defined in claim 1 or a primer pair as defined in claim 2 in tomato breeding.

4. Use of the SCAR marker of claim 1 or the primer pair of claim 2 for identifying the size of the included leaf angle in tomato.