CN110592255B - Indel molecular marker closely linked with pepper cluster inflorescence gene, primer and application - Google Patents

Abstract

The invention discloses an Indel molecular marker closely linked with a pepper cluster inflorescence gene, a primer and application. The F2 population was constructed using 2 highly homozygous inbred lines. Obtaining a chromosome region closely linked with pepper cluster inflorescence by using a BSR and linkage positioning method, and developing an insertion/deletion locus (InDel) marker in a candidate region for verification. Finally, InDel closely linked with the vicinity of the candidate gene is obtained, a molecular marker In-9258 is designed according to the InDel, and the marker is used for carrying out genotype identification on 100 randomly sampled single plants of the F2 population, so that the coincidence rate reaches 100%. The research result can be used for hot pepper inflorescence type identification and molecular assisted breeding, and provides a basis for controlling the map-based cloning of hot pepper cluster inflorescence genes and analyzing a molecular mechanism formed by the cluster inflorescences.

Description

Indel molecular marker closely linked with pepper cluster inflorescence gene, primer and application

Technical Field

The invention belongs to the field of pepper breeding and molecular biology, and particularly relates to an Indel molecular marker closely related to pepper fasciculate inflorescence and a primer, and also relates to application of the Indel molecular marker and the primer in pepper inflorescence prediction and molecular assisted breeding.

Background

Capsicum (Capsicum annuum L.) is a vegetable crop of Capsicum of the Solanaceae family, native to Central and south America. Because of its rich nutritive value and strong adaptability, pepper is widely planted worldwide as an important vegetable crop and is highly popular with consumers. According to the statistical result of FAO 2014, the worldwide yield of the peppers exceeds 4900 ten thousand tons, according to the statistics of a large vegetable system of China Ministry of agriculture, the pepper cultivation area of China is continuously increased, the pepper industry makes great progress, and in recent years, the annual sowing area of the peppers of China is 150-200 ten thousand hm²At present, the sowing area accounts for 8 to 10 percent of the total sowing area of vegetables in China. In the breeding process, the clustering character is taken as the special character of the pepper when the mechanically harvested variety and the ornamental pepper variety are bred, and the special character is highly emphasized by breeders, so that the special character has extremely important significance in production and application.

The plant morphological structure is an extremely important agronomic trait, which not only allows different species to be distinguished, but also significantly improves yield and quality of plants with excellent plant structure. At present, research on plant types has made certain progress and breakthrough in crops such as rice, corn and the like. According to the existing classical genetic research data, the rice cluster spike is an incomplete dominant mutant controlled by a single gene Cl. The TEOSINTE BRANCHED1(TB1) gene was able to select and suppress the number of branches and increase ear size during selection and acclimation of maize. Late flowering and determination of the genes in tomato and the SELF-PRUNING (SP) gene regulate its vegetative and reproductive growth. Mutations in the SP gene in tomato promote the transformation of the unlimited to limited growth type and mutations can completely alter plant architecture. Tomato SP is an orthologue of the goldfish (CEN) and Arabidopsis thaliana TERMINAL FLOWER1(TFL1) genes, which encode inhibitors of flowering in the CETS protein family, while mutations in TFL1 and the CEN gene modulate the inflorescence of Arabidopsis thaliana, while TFL1 was found in goldfish to modulate meristem function and further modulate flowering. Overexpression of rice TFL1/CEN family genes Oscen1 and Oscen2 and OsGRF1 in Arabidopsis results in an increase in internode number, a decrease in length, and then a change in plant type structure. A large number of genes are involved in determining inflorescence type, the characteristics of the intermediate meristems and regulating floral organ morphology, such as LEAFY (LFY), APETALA1(AP1, CAULIFLOWER, AP3 and PISTILLATA).

Although the important value of plant type structure to crop production is well known, the genetic basic research of growth habit variation is weak, the research on pepper plant type is relatively less at present, and the regulation mechanism of the plant type morphological structure is still not effectively solved so far. The pepper inflorescence structure is an important part, the plant structure can be changed, and the yield and ornamental value are effectively improved. On the other hand, the pepper with bunched fruits is more suitable for mechanical harvesting, is beneficial to cultivating the variety harvested mechanically, and solves the problems of insufficient labor, high harvesting cost and the like.

The marker-assisted selection (MAS) technique is currently widely used in plants for molecular marker-assisted breeding. The method can quickly and efficiently identify individuals containing target genes, effectively save breeding time, and can identify the phenotypic characters of plants in the seedling stage. The clustered peppers can obviously improve the yield, are beneficial to mechanized harvesting, are more and more emphasized by breeders, and are one of important breeding targets for cultivating novel pepper varieties with high yield and mechanized harvesting. By utilizing the molecular marker technology, the plants with the clustering character can be quickly identified in the process of creating materials according to the developed marker, and the workload of sowing and transplanting is reduced. Meanwhile, the method lays a foundation for cloning the gene for controlling pepper clustering and further analyzing the formation mechanism of the clustering character.

Disclosure of Invention

The invention aims to provide a novel Indel molecular marker closely linked with a pepper cluster inflorescence gene. Specifically, the sequence of a 23bp insertion/deletion starting from the position 9258832 stained with No. 6 capsicum is as follows: TTGGTAGGATTTTGAACCATTGC, see SEQ ID No. 1.

The molecular marker of the invention is based on the insertion/deletion of the clustered inflorescence gene which is closely linked, and a primer is designed and developed according to the sequence of the upstream and downstream of the insertion/deletion. Can be used for identifying the phenotype of the single cluster inflorescence of the hot pepper. The discovery of the molecular marker solves the problems of long breeding period, low selection efficiency and the like in the conventional pepper cluster inflorescence breeding method, and improves the genetic improvement pace of pepper varieties.

The second object of the present invention is to provide the primer for Indel molecular marker closely linked to the gene of pepper cluster inflorescence, which is designed based on the upstream and downstream of the 23bp insertion/deletion fragment.

Further, the primer is preferably:

the forward primer sequence In-9258-F is 5'-TCAGTATTACACTCTACCAAACGTG-3', see SEQ ID No.2,

the reverse primer sequence In-9258-R is: 5'-ATTCTCATGTATTGCTAATACCACC-3', see SEQ ID No. 3.

The third purpose of the invention is to provide the application of the Indel molecular marker and the primer in predicting pepper cluster inflorescence and single inflorescence types and molecular assisted breeding.

The method specifically comprises the following steps:

(1) extracting DNA of a single pepper plant as a template;

(2) carrying out PCR amplification by using primers designed according to the upstream and downstream of the molecular marker;

(3) detecting the PCR product by agarose gel electrophoresis, and reading the band type by a gel imaging system;

(4) according to the band type obtained in the step (3), when only a single 221bp specific band appears, predicting the single plant as a cluster inflorescence type; when a single 198bp specific band appears or has the specific bands of 221bp and 198bp at the same time, the single plant is predicted to be a single plant of a single inflorescence type.

Further, the PCR reaction system: the total volume is 20 mu L, and the specific components are as follows: PCR was performed in a 20. mu.L reaction system consisting of 1. mu.L of 30 ng/. mu.L genomic DNA, 18. mu.L LPCR-T3-Mix and 10. mu.mol forward and reverse primers, 0.5. mu.L each.

Further, the PCR amplification procedure is as follows: after 3 minutes of pre-denaturation at 98 ℃; denaturation at 98 deg.C for 15 seconds, annealing at 55-60 deg.C for 10 seconds, extension at 72 deg.C for 30 seconds, and 30 cycles; final extension was then carried out at 72 ℃ for 3 minutes; the reaction was terminated.

Through early identification and auxiliary selection of pepper cluster growth related molecular markers, the efficiency and accuracy of pepper cluster variety breeding can be remarkably improved, and the planting scale of field materials and the workload of later identification during variety breeding are greatly reduced.

The fourth purpose of the invention is to provide a method for obtaining the Indel molecular marker which is closely linked with the pepper cluster inflorescence gene.

The molecular marker of the invention is obtained by the following method:

(1) hybridizing a pepper high-generation inbred line of the unigenetic inflorescence with a pepper high-generation inbred line of the tufted inflorescence as a male parent and a pepper high-generation inbred line of the tufted inflorescence with a female parent to construct an F2 population;

(2) planting four-generation population (two parents, F1 and F2) in a glass greenhouse, taking fresh tender leaves in a 2.0ml centrifuge tube at the seedling stage, and preserving in liquid nitrogen for later use;

(3) f2 counting the phenotype of the single plant inflorescence during the full-bloom period of the colony, selecting 30 single plants of the single-plant inflorescence and the clustered inflorescence, taking buds to extract RNA, equivalently and uniformly mixing to construct a single-plant inflorescence mixed pool and a clustered inflorescence mixed pool for RNA-seq, and simultaneously taking parent DNA to construct a DNA library for whole genome re-sequencing;

(4) two parental DNAs are extracted by a CTAB method, and a TruSeq DNA LT Sample Prep Kit (Illumina) is used for respectively establishing libraries and sequencing on an Illumina Hiseq4000 platform. Extracting 60 individual flower bud RNAs of the selected mixed pool by using a Trizol method, and mixing the flower bud RNAs in equal quantity. Two cDNA libraries, a single flower pool and a clustered flower pool, were constructed and sequenced at both ends with a size of 150bp in HiSeq4000 (Illumina, San Diego, Calif., USA), and the insert size was 300 bp. The obtained RNA-seq data was used to analyze the chromosomal region where the cluster gene is located. And obtaining the value of the delta (SNP-index) through the SNP-index difference value of the single-generation pool and the cluster pool, and finally selecting the interval with the delta (SNP-index) larger than 0.5 as a candidate area. And analyzing InDel in the target section by combining the re-sequencing data of the two parents.

(5) According to the obtained InDel difference, Primer Premier 5.0 is used for designing Primer development marks, 12 pairs of polymorphic InDel marks are developed In a candidate segment, the series marks are used for carrying out gene analysis on recessive cluster inflorescence single plants In an F2 population, recombinant single plants are identified, a mark In-9258 highly linked with a target gene of a gene for controlling the cluster character In a target segment is found, and the forward Primer sequence is as follows: 5'-TCAGTATTACACTCTACCAAACGTG-3': the reverse primer sequence is 5'-ATTCTCATGTATTGCTAATACCACC-3'.

Compared with the prior art, the invention has the following advantages:

the invention provides a molecular marker In-9258 closely related to pepper cluster inflorescence and application thereof In pepper cluster inflorescence variety breeding. The method effectively overcomes the defects of long identification period, low selection efficiency and the like in the conventional breeding method, can obviously improve the efficiency and accuracy of the seed selection of the pepper cluster variety through the early identification and the auxiliary selection of the pepper cluster related molecular marker, and greatly reduces the planting scale and the later identification workload of field materials.

Drawings

FIG. 1 shows the phenotype of the individual and clustered flowers of Capsicum annuum;

FIG. 2 shows Δ (SNP-index) analysis of single floral pools and tufted floral pools, arrows indicating candidate QTLs;

FIG. 3 is a schematic diagram of marker development and linkage localization within candidate segments;

FIG. 4 is a phenotypic identification of F2 population individuals for inflorescences using the In-9258 marker. As shown in the figure, the identification results of part of F2 individuals are that 33 individuals only have 221bp bands and are predicted to be a fasciculate inflorescence phenotype, the rest 10F 2 individuals contain 198bp bands and are predicted to be a single inflorescence phenotype, and the genotype identification result is 100% consistent with the phenotype identification result.

Detailed Description

The examples of embodiments of the invention do not constitute any limitation of the invention. In the following experimental procedures, all manipulations were carried out according to the method provided in molecular cloning, A laboratory Manual (third edition) (Huang Peyer et al, Beijing: scientific Press, 2002), unless otherwise specified.

Example 1:

a pepper cluster molecular marker InDel-9258 is obtained by the following method:

1. population construction

The construction of an F2 population is completed by hybridizing a capsicum LS20 unigenic inflorescence inbred line as a female parent and an XJ10 capsicum fasciculation inbred line as a male parent to obtain F1 and selfing F1 to obtain F2 (figure 1).

2. Inflorescence phenotype identification

(1) And (3) sowing the parents LS20 and XJ10, F1 and F2 in a plug tray, transplanting in a glass greenhouse after the seedlings are grown, and performing conventional cultivation management.

(2) And (3) performing phenotype identification on the F2 population in the full-bloom stage, and simultaneously selecting 30F 2 single plants of single-generation and clustered inflorescences to construct two mixed pools.

3. Cluster inflorescence QTL analysis

And respectively extracting single-plant bud RNA in a selected mixed pool, equivalently mixing and constructing two cDNA libraries, sequencing on an Illumina Hiseq4000 platform, and analyzing the candidate interval of the clustered inflorescence gene by using the obtained data by using a BSR method. The value of Δ (SNP-index) was obtained from the difference of SNP-index between the cluster mix pool and the single mix pool (FIG. 2).

4. Molecular marker development

Two parental DNAs are extracted by a CTAB method, and are respectively subjected to library construction by using TruSeq DNA LT Sample Prep Kit (Illumina), and are sequenced on an Illumina Hiseq4000 platform. And analyzing to obtain the InDel of the candidate target section by taking the two parental re-sequencing data as reference according to the candidate interval obtained by analyzing the mixed pool RNA-seq data. Then, based on the obtained InDel difference, a Primer is designed by using Primer Premier 5.0 to develop a marker, a total of 12 pairs of polymorphic InDel markers are developed In a candidate segment (figure 3), the recessive cluster inflorescence single strains In the F2 population are subjected to gene analysis by using the series of markers to identify recombinant single strains, and a marker In-9258 (figure 4) highly linked with the gene for controlling the cluster character In a target segment is found, and the corresponding pepper reference genome physical map has a 23bp insertion/deletion beginning at 9258832 of chromosome 6, and the sequence is as follows: TTGGTAGGATTTTGAACCATTGC are provided. The primer sequences designed according to the upstream and downstream of the sequence are as follows:

The forward primer is as follows: 5'-TCAGTATTACACTCTACCAAACGTG-3' the flow of the air in the air conditioner,

the reverse primer is: 5'-ATTCTCATGTATTGCTAATACCACC-3' are provided.

5. Application of clustered molecular marker in pepper clustered inflorescence breeding

The molecular marker of the obtained clustered inflorescence is used for identifying 100 individuals randomly selected from an F2 population, and the steps are as follows:

(1) taking the DNA of a single pepper F2 strain as a template;

(2) performing PCR amplification by adopting a molecular marker In-9258, wherein the primer sequence is as follows:

the forward primer is as follows: 5'-TCAGTATTACACTCTACCAAACGTG-3'

The reverse primer is: 5'-ATTCTCATGTATTGCTAATACCACC-3', respectively;

(3) and (3) PCR reaction system: the total volume is 20 mu L, and the specific components are as follows: PCR was performed in a 20. mu.L reaction system consisting of 1. mu.L of genomic DNA (30 ng/. mu.L), 18. mu.L of PCR-T3-mix (TSINGKE) and 0.5. mu.L each of forward and reverse primers (10. mu. mol);

(4) the PCR reaction was carried out on a model S1000 PCR instrument manufactured by Bio-Rad, USA. The amplification procedure was: after 3 minutes of pre-denaturation at 98 ℃; denaturation at 98 deg.C for 10 s, annealing temperature of 55-60 deg.C for 10 s, extension temperature of 72 deg.C for 30 s, and 30 cycles; final extension was then carried out at 72 ℃ for 3 minutes; the reaction was terminated. Detecting the PCR product by 2.5% agarose gel electrophoresis, staining by ethidium bromide and observing in a gel imaging system, and recording the result;

(5) When only 221bp specific bands appear, predicting as a single plant of a cluster inflorescence type; only a specific strip of 198bp appears or has specific strips of 221bp and 198bp at the same time, and is predicted to be a single plant of a single inflorescence type. The phenotype and genotype coincidence rate of randomly sampled individuals in the F2 population was 100% (Table 1).

The identification result shows that materials only with 221bp specific band types are reserved in the separated materials through molecular marker identification screening, materials with 198bp band types are eliminated, materials of pepper cluster inflorescences can be effectively selected, the selection efficiency is improved, the workload of field material planting and the workload of screening identification are reduced, and the breeding process is accelerated.

TABLE 1F 2 population Individual identification results

Note: 1: indicating that only a band of 198bp size appeared; 2, shows that only 221bp band appears; 3: indicating that bands of 198bp and 221bp appeared simultaneously.

Sequence listing

<110> Hunan agriculture university

HUNAN VEGETABLE Research Institute

<120> Indel molecular marker closely linked with pepper cluster inflorescence gene, primer and application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Pepper (Capsicum annuum L.)

<400> 1

ttggtaggat tttgaaccat tgc 23

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcagtattac actctaccaa acgtg 25

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

attctcatgt attgctaata ccacc 25

Claims (2)

1. The application of Indel molecular marker in predicting pepper cluster inflorescence and single inflorescence types and molecular assisted breeding; the Indel molecular marker is a 23bp insertion/deletion beginning from pepper No. 6 staining 9258832, and the sequence is as follows: TTGGTAGGATTTTGAACCATTGC are provided.

2. Use according to claim 1, characterized in that:

(1) extracting DNA of a single pepper plant as a template;

(2) adding the following primers for PCR amplification;

the forward primer In-9258-F: 5'-TCAGTATTACACTCTACCAAACGTG-3',

reverse primer In-9258-R: 5'-ATTCTCATGTATTGCTAATACCACC-3';

(3) detecting the PCR product by agarose gel electrophoresis, and reading the band type by a gel imaging system;

(4) according to the band type obtained in the step (3), when only a single 221bp specific band appears, predicting the single plant as a cluster inflorescence type; when a single 198bp specific band appears or has the specific bands of 221bp and 198bp at the same time, the single plant is predicted to be a single plant of a single inflorescence type.

Images