CN113186323B - KASP molecular marker related to falling speed of strawberry petals and application thereof - Google Patents
KASP molecular marker related to falling speed of strawberry petals and application thereof Download PDFInfo
- Publication number
- CN113186323B CN113186323B CN202011513219.3A CN202011513219A CN113186323B CN 113186323 B CN113186323 B CN 113186323B CN 202011513219 A CN202011513219 A CN 202011513219A CN 113186323 B CN113186323 B CN 113186323B
- Authority
- CN
- China
- Prior art keywords
- strawberry
- molecular marker
- petals
- falling speed
- petal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 235000016623 Fragaria vesca Nutrition 0.000 title claims abstract description 48
- 235000011363 Fragaria x ananassa Nutrition 0.000 title claims abstract description 48
- 239000003147 molecular marker Substances 0.000 title claims abstract description 22
- 240000009088 Fragaria x ananassa Species 0.000 title 1
- 241000220223 Fragaria Species 0.000 claims abstract description 54
- 238000009395 breeding Methods 0.000 claims abstract description 9
- 230000001488 breeding effect Effects 0.000 claims abstract description 9
- 210000000349 chromosome Anatomy 0.000 claims abstract description 7
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 230000006578 abscission Effects 0.000 claims 1
- 238000004519 manufacturing process Methods 0.000 abstract description 4
- 108090000623 proteins and genes Proteins 0.000 description 15
- 238000000034 method Methods 0.000 description 10
- 230000002068 genetic effect Effects 0.000 description 8
- 235000021012 strawberries Nutrition 0.000 description 7
- 239000000463 material Substances 0.000 description 5
- 238000001514 detection method Methods 0.000 description 4
- 235000013399 edible fruits Nutrition 0.000 description 4
- 238000000926 separation method Methods 0.000 description 4
- 241000196324 Embryophyta Species 0.000 description 3
- 238000003559 RNA-seq method Methods 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 241000123650 Botrytis cinerea Species 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 235000009508 confectionery Nutrition 0.000 description 2
- 230000001276 controlling effect Effects 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- 230000009545 invasion Effects 0.000 description 1
- 101150044508 key gene Proteins 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000000050 nutritive effect Effects 0.000 description 1
- 239000000575 pesticide Substances 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 239000001054 red pigment Substances 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a KASP molecular marker related to the falling speed of strawberry petals and application thereof, wherein the molecular marker is positioned on chromosome 2-2 of strawberry, base A is mutated to G at 776356bp, the strawberry with genotype GG is expressed as the falling speed of the petals, the correlation between the genotype and phenotype is verified in F1 group and resource group, and the result shows that the molecular marker can be used for early molecular auxiliary selection of the falling speed of the strawberry petals, and has important theoretical and practical guiding significance for accelerating the green production of the strawberry by breeding varieties with the falling speed of the petals.
Description
Technical Field
The invention belongs to the technical fields of molecular biology and genetic breeding, and particularly relates to a molecular marker related to the falling speed of strawberry petals and application thereof.
Background
Strawberry is an important horticultural cash crop which is widely planted worldwide, has high nutritive value and short production period. China is the first large strawberry producing country and consumer country in the world, the planting area of China strawberries in 2018 is 11 ten thousand hectares, and the yield reaches 296 ten thousand tons (FAO, 2018). Gray mold is one of the most serious diseases causing the yield loss of strawberries, and can occur in both the growing period and the storage period of strawberries, so that the annual yield loss of strawberries is at least 10% -30%, and the serious yield loss is as high as more than 50%. The botrytis cinerea can infect almost all overground parts of stems, leaves, flowers, fruits and the like of strawberries, wherein the aged petals are an important path for the invasion of the botrytis cinerea. Earlier studies have found that removal of senescent petals from strawberry fruits can reduce the incidence of gray mold of the fruits. The field test shows that the flower petal falling rate of the 7 th day of the strawberry bud is obviously inversely related to the fruit gray mold incidence rate, and the flower petal falling speeds of different strawberry varieties are different, so that the incidence rate of the strawberry gray mold can be effectively reduced by breeding the strawberry varieties with rapid flower petal falling, the pesticide use amount and the production cost are reduced, the green safe production of the strawberries is effectively realized, and the economic income is increased.
The molecular marker assisted selection is a method capable of realizing rapid breeding of varieties with specific characters, and relies on molecular markers closely linked with target genes. At present, the research on the falling speed of strawberry petals is very few, so that the aim of molecular auxiliary breeding for realizing petal falling is to excavate and regulate genetic loci, key genes and related molecular markers for the falling speed of strawberry petals. According to the invention, bulked Segregant RNA sequencing (BSR) positioning is carried out on the strawberry petal-shedding separation group, key genes are screened out from the positioning, KASP primers are designed and developed according to the key gene sequences, and the auxiliary selection of the strawberry petal-shedding speed can be carried out by verifying the primers.
Disclosure of Invention
In view of the defects of the prior art, the invention aims to locate the genetic locus of the strawberry petal falling speed, identify candidate genes in the genetic locus, develop KASP molecular markers based on candidate gene SNP information, verify the correlation between genotypes and phenotypes in the population, and help to screen varieties of the strawberry petal falling speed and accelerate the breeding process.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
and a KASP molecular marker related to the falling speed of the strawberry petals, wherein the molecular marker is positioned on chromosome 2-2 on the genome of the strawberry octaloid, the base A is mutated into G at 776356bp, and the strawberry with genotype GG is expressed as the falling speed of the petals.
The sequence of the specific primer for amplifying the KASP molecular marker is shown as SEQ ID NO. 2-4.
The application of the KASP molecular marker in identification of the falling speed of strawberry petals or molecular breeding comprises the following steps:
(1) Extracting genome DNA of the strawberry to be detected;
(2) Taking the genome DNA of the strawberry to be detected as a template, and carrying out PCR amplification reaction by using the primer;
(3) After the PCR reaction is finished, collecting fluorescent signals generated by each reaction hole, judging the genotype of the molecular marker according to the type of the fluorescent signals, and if the genotype of the KASP molecular marker is GG, the strawberry is characterized by rapid petal shedding, and if the detected genotype is GA, the strawberry is characterized by slow petal shedding.
Compared with the prior art, the invention has the beneficial effects that:
(1) The invention provides a method for developing KASP marks according to genetic loci for positioning the shedding of strawberry petals, screening key genes in the genetic loci and utilizing SNP information of the key genes, which can convert the genetic loci and the key genes into molecular marker sequences for molecular breeding, thereby laying an important foundation and necessary premise for realizing molecular assisted breeding and selecting varieties with petal shedding speed.
(2) By using the KASP marked primer developed by the invention, the petal-shedding separation population is detected, among 13 samples, 6 samples with rapid petal shedding are totally GG in genotype, 7 samples with slow petal shedding are totally GG in genotype, 6 samples are GA,1 sample is GG, and the coincidence rate of the mark and the phenotype is 92.3%.
(3) The KASP labeled primer developed by the invention is used for detecting resource materials, and the petal falling speed is 14 which accords with the genotype, and the ratio is 82.4%.
Drawings
Fig. 1 shows the BSR positioning result in embodiment 1 of the present invention. The upper graph and the lower graph are respectively the Euclidean distance and the positioning result calculated by the SNP-Index calculation method, the threshold line indicated by the dotted line in the graph, the red arrow indicates the genetic locus which is positioned in both methods and is positioned on chromosome 2-2 and used for controlling the falling speed of strawberry petals, and the key candidate gene maker-Fvb2-2-augustus-gene-7.55 is positioned at the locus.
Detailed Description
The invention will now be described in further detail with reference to the following examples in conjunction with the accompanying drawings. The following examples are merely illustrative of the present invention and should not be construed as limiting the invention. The examples are not to be construed as limiting the specific techniques or conditions described in the literature in this field or as per the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
Example 1
The embodiment provides a method for obtaining a strawberry petal-shedding gene related KASP molecular marker, which specifically comprises the following steps:
(1) The method is characterized in that the red pigment is used as a female parent in the construction of the petal-shedding separation group, the petal-shedding rate of the flower petal-shedding separation group is more than 80% in 14 days, the male parent is sweet Charles, the petal-shedding rate in 28 days is lower than 80%, and the speed of petal shedding is identified in the flowering period after each single plant of the group is planted;
(2) According to the identification result, individual plants with petals falling fast and slow are respectively selected, and positioning is carried out by using a Bulked Segregant RNA sequencing (BSR) method, so that loci for regulating and controlling the petal falling fast and slow of the strawberries are obtained;
(3) Selecting candidate genes from the sites positioned in the step (2), designing KASP primer sequences according to candidate gene sequences and SNP information, and detecting the relativity of the KASP primer sequences with petal falling-off speed in the F1 group and other strawberry resources;
(4) According to the result in the step (1), 15 petals are selected to fall off quickly and slowly to form a mixed pool, bulked Segregant RNA sequencing (BSR) analysis is carried out, biological informatics analysis is carried out on BSR data by Euclidean distance and SNP-Index methods respectively, and sites which can be positioned by the two methods are identified, wherein the sites comprise genetic sites positioned on chromosome 2-2, as shown in figure 1;
(5) Screening candidate genes maker-Fvb2-2-augustus-gene-7.55 located in chromosome 2 from 365 genes located in the 0-2.01Mb interval of chromosome 2-2 according to the analysis result in (3) in combination with literature; the gene has 24 SNP, a SNP variation from A (sweet Charles and quick shedding) to G (mixed pool with red color and quick shedding) is arranged at 776356bp, and a sequence (SEQ ID NO. 1) of 100bp at the upstream and downstream of the SNP locus is extracted, so that a KASP primer is designed; forward primer F1 of Fvb 2-2_776356: 5'-ACTATACCTGGTGAATAATGCCATCT-3' (SEQ ID NO. 2); forward primer F2:5'-CTATACCTGGTGAATAATGCCATCC-3' (SEQ ID NO. 3); reverse primer R1:5'-AGCTTTGCAGAAAACGATAGCATTGCAA-3' (SEQ ID NO. 4), the 5' ends of the forward primers F1 and F2 being linked to fluorescent tag sequences FAM (GAAGGTGACCAAGTTCATGCT) and HEX (GAAGGTCGGAGTCAACGGATT), respectively;
(6) Genotype of petal shedding speed and petal shedding speed in F1 isolated population was detected by using the KASP primer, and PCR system was (1. Mu.l for example): 10ng of DNA template, 0.5. Mu.L of 2X KASP master mixture and 0.014. Mu.L of mixed primer. The PCR program used was the TouchDown PCR program: pre-denaturation at 94℃for 15min, followed by 10 Touch Down cycles (denaturation at 94℃for 20s, initial annealing temperature at 61℃for 60s for each cycle reduced by 0.6 ℃) followed by 26 cycles of denaturation at 94℃for 20s, annealing at 55℃for 60s.
The enzyme-labeled detection PCR results show that: among 13 samples, 6 samples with rapid petal shedding, genotype of GG, 7 samples with slow petal shedding, wherein 6 samples are GA,1 sample is GG, and the coincidence rate of the mark and the phenotype is 92.3%, and the specific results are shown in Table 1.
TABLE 1 petal shedding for F1 population and detection results of KASP primer
Example 2
The KASP primer obtained in example 1 was subjected to extensive verification for identifying the rate of falling off of strawberry petals, and the specific steps were as follows:
(1) Selecting 17 parts of single plants of different groups or strawberry resource materials, and counting the falling speed of petals in flowering seasons;
(2) The genomic DNA of the strawberry material was extracted, and PCR amplification was performed using the KASP-labeled primer developed by the present invention, and the PCR amplification and detection methods were the same as those in example 1, and the results are shown in Table 2, and the phenotype results of 17 strawberry resource materials, in which the petal falling-off rate was 14, and the ratio was 82.4%.
TABLE 2 petal Release of strawberry resource Material and detection results of KASP primer
The foregoing is merely exemplary of the application and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the application and are intended to be comprehended within the scope of the application.
Sequence listing
<110> institute of economic crop at academy of agricultural sciences in Hubei province
<120> KASP molecular marker related to strawberry petal falling speed and application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 201
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (101)
<223> r=a or G
<400> 1
ataggtgctt ttgatcactt tgaagatctt tcagggcact ctttcaccgc aactgagttt 60
gaagaattac cagctttgca gaaaacgata gcattgcaac rgatggcatt attcaccagg 120
tatagtgggt acatttgttt ggtaccttgt atgtcttcat ataagtttag gtatataaca 180
agtggtttat ctaacttaag c 201
<210> 2
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
actatacctg gtgaataatg ccatct 26
<210> 3
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ctatacctgg tgaataatgc catcc 25
<210> 4
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
agctttgcag aaaacgatag cattgcaa 28
Claims (4)
1. The KASP molecular marker related to the falling speed of the strawberry petals is characterized in that the molecular marker is positioned on chromosome 2-2 on the genome of the strawberry octaloid, the base A is mutated into G at 776356bp, the strawberry with the genotype GG is expressed as the falling speed of the petals, and the specific primer sequence for amplifying the KASP molecular marker is shown as SEQ ID NO. 2-4.
2. The application of the specific primer of the molecular marker in the identification of the characteristics of the falling speed of strawberry petals.
3. Use of the molecular marker specific primer of claim 1 in molecular breeding of strawberry petal abscission.
4. The use according to claim 3, characterized by the following steps:
(1) Extracting genome DNA of the strawberry to be detected;
(2) Taking the genome DNA of the strawberry to be detected as a template, and carrying out PCR amplification reaction by using the primer;
(3) Detecting PCR products, if the genotype of the KASP molecular marker is GG, the strawberry is characterized by rapid petal shedding, and if the genotype is GA, the strawberry is characterized by slow petal shedding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011513219.3A CN113186323B (en) | 2020-12-17 | 2020-12-17 | KASP molecular marker related to falling speed of strawberry petals and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011513219.3A CN113186323B (en) | 2020-12-17 | 2020-12-17 | KASP molecular marker related to falling speed of strawberry petals and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113186323A CN113186323A (en) | 2021-07-30 |
| CN113186323B true CN113186323B (en) | 2024-02-09 |
Family
ID=76972942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011513219.3A Active CN113186323B (en) | 2020-12-17 | 2020-12-17 | KASP molecular marker related to falling speed of strawberry petals and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113186323B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116875728B (en) * | 2023-07-20 | 2024-03-08 | 沈阳农业大学 | KASP molecular marker group for identifying five-leaf strawberries and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108546773A (en) * | 2018-05-28 | 2018-09-18 | 沈阳农业大学 | The primer of SSR molecular marker for identifying safflower fraise character and application |
| CN108693308A (en) * | 2018-04-12 | 2018-10-23 | 湖北省农业科学院经济作物研究所 | A kind of method of Fast Evaluation strawberry cultivars petal falling speed |
| CN111944921A (en) * | 2020-08-26 | 2020-11-17 | 中国农业科学院油料作物研究所 | Application of brassica napus BnaA08.PDS3 gene in breeding of color traits of brassica napus petals |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100064392A1 (en) * | 2008-06-10 | 2010-03-11 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring improved agricultural and/or ornamental characteristics to plants by modulating abscission |
-
2020
- 2020-12-17 CN CN202011513219.3A patent/CN113186323B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108693308A (en) * | 2018-04-12 | 2018-10-23 | 湖北省农业科学院经济作物研究所 | A kind of method of Fast Evaluation strawberry cultivars petal falling speed |
| CN108546773A (en) * | 2018-05-28 | 2018-09-18 | 沈阳农业大学 | The primer of SSR molecular marker for identifying safflower fraise character and application |
| CN111944921A (en) * | 2020-08-26 | 2020-11-17 | 中国农业科学院油料作物研究所 | Application of brassica napus BnaA08.PDS3 gene in breeding of color traits of brassica napus petals |
Non-Patent Citations (2)
| Title |
|---|
| ‘越心’草莓组培突变体着色差异的分子机理初探;杨肖芳 等;《园艺学报》;第47卷(第10期);摘要，第1999-2008页 * |
| A roadmap for research in octoploid strawberry;Vance M. Whitaker 等;《Horticulture Research》;第7卷(第33期);摘要，第1-17页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113186323A (en) | 2021-07-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109251995B (en) | CAPS molecular marker for identifying watermelon peel background color and application thereof | |
| CN110305978B (en) | SNP (Single nucleotide polymorphism) site closely associated with orientation of pepper fruit, and universal molecular marker, acquisition method and application thereof | |
| CN112725503B (en) | Molecular marker closely linked with hypocotyl color related gene of American pumpkin and application | |
| CN113637789B (en) | Wheat stripe rust resistance gene YrTD121 linked KASP molecular marker, primer, kit and application | |
| CN113186323B (en) | KASP molecular marker related to falling speed of strawberry petals and application thereof | |
| CN112410462B (en) | SNP molecular marker closely linked with pumpkin semi-dwarf traits and application thereof | |
| CN110484648B (en) | Indel molecular marker for identifying single cluster inflorescence of capsicum, primer and application | |
| CN112011640B (en) | KASP molecular marker, primer and application for identifying pH of watermelon fruit | |
| CN111926104B (en) | SSR molecular marker for identifying authenticity of sugarcane and festuca arundinacea filial generation and method thereof | |
| CN113005221A (en) | Molecular marker SNP-392 tightly linked with muskmelon pedicle-resistance gene CmAL3 and application thereof | |
| CN108103237A (en) | The InDel molecular labelings and its detection primer that are isolated with rice bacterial leaf spot disease-resistant gene xa34 (t) and application | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN114164294B (en) | SNP locus related to green keeping property of Chinese cabbage and application thereof | |
| CN116516054A (en) | SNP molecular marker related to cabbage type rape dwarf trait and application thereof | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN116555466A (en) | Method for identifying betula platyphylla and Fujian betula interspecific hybridization F1 hybrid by using SSR molecular markers | |
| CN110643728B (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| CN112481411A (en) | Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D | |
| CN111549172A (en) | Watermelon leaf posterior green gene linkage site and CAPS marker | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
| CN112831593B (en) | SNP molecular marker primer for variety identification of red peach trees in early summer and identification and application method thereof | |
| CN116121438B (en) | Molecular marker primer group and kit for identifying mulberry new variety 'Yuesang 162' for silkworm raising leaves and application of molecular marker primer group and kit | |
| CN111004858B (en) | Molecular marker primer of soybean single pod number major QTL (quantitative trait locus) locus and application thereof | |
| CN113981130B (en) | Method for screening rice growth period |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |