CN112481411A - Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D - Google Patents

Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D Download PDF

Info

Publication number
CN112481411A
CN112481411A CN202011547600.1A CN202011547600A CN112481411A CN 112481411 A CN112481411 A CN 112481411A CN 202011547600 A CN202011547600 A CN 202011547600A CN 112481411 A CN112481411 A CN 112481411A
Authority
CN
China
Prior art keywords
ipa1
rice
primer
identifying
genotype
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202011547600.1A
Other languages
Chinese (zh)
Inventor
张�林
邹怡婷
刘巧泉
卞中
谢东
周涵
范晓磊
李钱峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN202011547600.1A priority Critical patent/CN112481411A/en
Publication of CN112481411A publication Critical patent/CN112481411A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses primers for identifying thick-stalk and large-spike positions ipa1-2D and ipa1-1D of rice, and belongs to the technical field of rice variety identification. Aiming at two SNPs of an ipa1-2D locus, the invention designs a three-primer combination design for respectively identifying the two SNPs, wherein the primer sequences are primers shown as SEQ ID NO. 1-13, the primer combinations can finish genotype identification in one round of PCR, the time, labor and reagent cost are reduced, the primer synthesis cost is saved compared with four primers, and three sets of ipa1-2D identification modules can be obtained by different combinations of seven primers, so that the identification requirements of different types of groups are met. The primers have great advantages in the aspect of mass population identification, and have good application prospects in the molecular design breeding of super hybrid rice of rice in the future.

Description

Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D
Technical Field
The invention belongs to the technical field of rice variety identification, and particularly relates to primers and a method for identifying rough stalk and large spike positions ipa1-2D and ipa1-1D of rice.
Background
In recent years, China cultivates a plurality of ultrahigh-yield hybrid rice varieties, including Yongyou 12, Jiayou Zhongke No.1 and the like, the yield of the varieties per mu is as high as 1000 kg, which is an important guarantee for the production safety of food in China, the cultivation process adopts a breeding strategy of an ideal plant type, and the cultivation method is characterized in that the cultivated varieties have strong stems and high-grade branches, and can meet two breeding requirements of lodging resistance and high yield. Our previous studies show that ipa1-2D is the main effective site for determining the plant type characteristics of the high-yield varieties, about 50% of phenotypic variation of stem thickness and ear stem number can be explained, and the breeding of similar super-high-yield rice varieties can be accelerated by efficiently screening ipa1-2D by using molecular markers in breeding. The key sequence variation of ipa1-2D is a ternary sequence repeat, which contains three SNPs, and we previously designed specific amplification primers for the ternary repeat and converted the three SNPs into enzyme-cleaved dCAPS-based markers. In the actual breeding selection and genotyping process, the markers are found to have defects: the ternary repeated specific primer is a dominant marker, so that heterozygous genotypes and ipa1-2D homozygous genotypes cannot be distinguished; the enzyme digestion marker consumes a large amount of endonuclease when identifying a large number of separated populations, so that the identification cost is greatly increased, and the enzyme digestion marker is only suitable for identifying a small number of varieties and populations. Therefore, a novel marker system which can simultaneously distinguish heterozygous genotypes from homozygous genotypes and is low in identification cost needs to be designed, optimal primer design is carried out on two SNP loci by adopting a competitive allele amplification specificity PCR method, a series of compatible primers are obtained, and efficient identification of ipa1-2D loci can be realized through different combinations of the compatible primers. ipa1-1D is another excellent allele found in plum family et al, affecting the trait of thick stalk big ear, and the existence of a SNP site in a coding region causes that the SNP site cannot be recognized by miR156, and the SNP is the core variation generated by ipa1-1D phenotype. A series of primers are also designed aiming at the site, and can form a kit with an ipa1-2D primer series for rapid molecular identification of different research or breeding purposes.
Disclosure of Invention
The purpose of the invention is as follows: the invention aims to provide a primer for identifying thick-stalk and big-ear positions ipa1-2D and ipa1-1D of rice.
The technical problem to be solved by the invention is to provide a method for identifying the rough stalk and large ear positions ipa1-2D and ipa1-1D of rice.
The technical scheme is as follows: in order to solve the technical problems, the invention adopts the following technical scheme:
a primer for identifying rice rough stalk big ear sites ipa1-2D and ipa1-1D comprises a primer for identifying a rice pa1-2D genotype and a primer for identifying a rice pa1-1D genotype;
the primer for identifying the rice pa1-2D genotype is one of the following three primer combinations:
three primer combinations 1 for identifying ipa1-2D sites:
2DSNP1-C：GCCTATCCACATACCAGGATTTGTC，
2DSNP2-T：GGGATCAGGGTTACTACACT，
2DCom_R：ATGTGGCAGGGTAGAGTAGTA；
three primer combinations 2 for identifying ipa1-2D sites:
2DSNP1-T：GCCTATCCACATACCAGGATTTGTT，
2DSNP2-C：GGGATCAGGGTTACTACACC，
2DCom_R：ATGTGGCAGGGTAGAGTAGTA；
identifying a four-primer combination of ipa1-2D sites:
2DSNP2-C：GGGATCAGGGTTACTACACC，
2DCom_R：ATGTGGCAGGGTAGAGTAGTA，
2DCom_F：CCTTGCCGCTGCTCCTCCATC，
2DSNP2-A：CGTGGGAACCGTGCTTACCGCCTGA；
most preferably: identifying a three-primer combination 1 of the ipa1-2D locus;
the primer for identifying the rice pa1-1D genotype is one of the following two primer combinations;
four primer combination 1 for identifying ipa1-1D locus:
1DSNP-G：TGGGTTGACAGAAGAGAAAG；
1DSNP-A：CACCGACTCGAGCTGTGATA；
1DCom-F：AAGTGGGCATGATGGCTAGGA；
1DCom-R：AGGGTTCCAAGCAGCGTAAGG；
four primer combination 2 for identifying ipa1-1D locus:
1DSNP-T：TGGGTTGACAGAAGAGAAAT；
1DSNP-C：CACCGACTCGAGCTGTGATC；
1DCom-F：AAGTGGGCATGATGGCTAGGA；
1DCom-R：AGGGTTCCAAGCAGCGTAAGG。
most preferably: four primer combination 2 for identifying ipa1-1D site.
A method for identifying rice rough stalk big ear positions ipa1-2D and ipa1-1D comprises the following steps:
(1) extracting the genome of the rice to be detected;
(2) performing PCR amplification by using the genome extracted in the step (1) as a template and the primer for identifying the rice pa1-2D genotype and the primer for identifying the rice pa1-1D genotype in claim 1 respectively;
(3) and (3) carrying out agarose gel electrophoresis on the amplification product obtained by the PCR in the step (2), and observing an electrophoresis band.
In the step (2), the PCR amplification system is as follows:
mu.l of DNA template, 2. mu.l of PCR buffer, 0.5. mu. L, Taq of each primer, 0.3. mu.l of polymerase, and finally 20. mu.l of each primer was prepared with water.
In the step (2), the PCR reaction conditions are as follows: denaturation at 94 ℃ for 3 min, followed by 35 cycles of "denaturation at 94 ℃ for 20 sec-40-55 ℃ annealing for 30 sec-72 ℃ extension for 20 sec", and finally extension at 72 ℃ for 5 min.
Further: when the three-primer combination 1 for identifying the ipa1-2D locus is used for amplification, the annealing temperature is 52-57 ℃, and the preferred annealing temperature is 55 ℃;
when the three-primer combination 2 for identifying the ipa1-2D locus is used for amplification, the annealing temperature is 48-57 ℃, and 55 ℃ is preferred;
when the four-primer combination for identifying the ipa1-2D locus is used for amplification, the annealing temperature is 48-56 ℃, and 50 ℃ is preferred;
when the four-primer combination 1 for identifying the ipa1-1D locus is used for amplification, the annealing temperature is 50.6-51.9 ℃, and the preferred temperature is 51 ℃;
when the four primer combination 2 for identifying the ipa1-1D site is used for amplification, the annealing temperature is 48-50.6 ℃, and the annealing temperature is preferably 50 ℃.
The judgment method for identification by using the primer comprises the following steps:
when the three primer combination 1 for identifying the ipa1-2D locus is used for carrying out PCR amplification, and the size of an electrophoresis strip is 231bp, the rice is an ipa1-2D genotype; when the size of the electrophoresis strip is 265bp, the rice is IPA1 genotype; when the two bands of 231bp and 265bp are both present, the rice is heterozygous genotype;
when the three-primer combination 2 for identifying the IPA1-2D locus is used for PCR amplification, and the size of an electrophoresis strip is 231bp, the rice is of an IPA1 genotype; when the size of the electrophoresis strip is 265bp, the rice is of ipa1-2D genotype; when the two bands of 231bp and 265bp are both present, the rice is heterozygous genotype;
when the iPa1-2D four primer combination is identified for PCR amplification, and an electrophoresis strip comprises 322bp and 134bp, the rice is an iPa1-2D genotype; when the electrophoresis band comprises 322bp and 265bp, the rice is IPA1 genotype; when the electrophoresis bands comprise 322bp, 265bp and 134bp, the rice is in a heterozygous genotype;
when the iPA1-1D four primer combination 1 is identified for PCR amplification, and an electrophoresis strip comprises 508bp and 266bp, the rice is the IPA1 genotype; when the electrophoresis band comprises 508bp and 282bp, the rice is of ipa1-1D genotype; when the electrophoresis bands comprise 508bp, 282bp and 266bp, the rice is in a heterozygous genotype;
when the iPa1-1D four primer combination 2 is identified for PCR amplification, and an electrophoresis strip comprises 508bp and 266bp, the rice is an iPa1-1D genotype; when the electrophoresis band comprises 508bp and 282bp, the rice is of IPA1 genotype; when the electrophoresis bands comprise 508bp, 282bp and 266bp, the rice is in a heterozygous genotype.
Has the advantages that:
compared with the prior art, the invention has the beneficial effects that:
1. the three-primer genotyping strategy adopted by the invention can realize simultaneous amplification in one round of PCR and distinguish two allelic types through agarose gel electrophoresis, the existing KASP technology can realize the determination of the genotype only by carrying out two rounds of PCR amplification and respectively carrying out gel electrophoresis, and the method can effectively save the reagent, labor and time cost;
2. the invention designs a plurality of primer combination modes aiming at ipa1-2D and ipa1-1D loci, can meet the identification requirements of different breeding groups, has higher amplification efficiency of the series primer combination compared with the prior dCAPS marker based on enzyme digestion, saves the enzyme digestion identification cost and time, and can realize the identification and screening requirements of a large number of breeding single plants.
Drawings
FIG. 1 shows the design of ipa1-2D three and four primers.
FIG. 2 shows design of ipa1-1D four primers.
FIG. 3 shows Ipa1-2D three-primer temperature gradient amplification YYP1 and NIP gel electrophoresis.
FIG. 4 shows Ipa1-2D four primer temperature gradient amplification YYP1 and NIP gel electrophoresis.
FIG. 5 shows a Ipa1-1D four-primer temperature gradient amplified SNJ and NIP gel electrophoresis.
FIG. 6.ipa1-2D three and four primer pairs identification of 12 isolates and their comparison to dCAPS markers. Arrows indicate heterozygous individuals.
FIG. 7. effect of identifying 12 isolates with ipa1-1D four primers. Arrows indicate heterozygous individuals.
FIG. 8.F2Frequency distribution characteristics of three segregation traits in the population. The abscissa axis represents the corresponding property value.
Detailed Description
The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.
Example 1: primer design
Three SNPs are arranged on a ternary repetitive sequence of pa1-2D, and by comparing 3000 rice genome SNP data information, the combination of two SNPs (SNP 1C/T and SNP 2C/T) is shown to represent the difference between IPA1-2D and wild-type IPA1, the TT base combination of the two SNPs is IPA1-2D type, the CC base combination is most of japonica rice IPA1 type, and the TC base combination is most of indica rice IPA1 type, so that the identification of the three combination types can realize the effective differentiation of most varieties and breeding combination progeny in rice. Based on cost reduction considerations, we decided to design a method that requires only PCR amplification to efficiently identify the SNPs. Conventional competitive PCR amplification primers include three, two of which are specific amplification primers and the remaining sequences are identical except for differences at the SNP, and the third of which is a universal primer. For a specific SNP, the universal primer and two competitive primers are combined respectively to perform two independent PCR amplifications of the same DNA template, then gel electrophoresis is performed respectively, the genotype of the corresponding DNA sample is judged by observing the existence of PCR amplified bands, so that the time and labor cost are increased, and the consumption of the DNA sample, PCR reaction reagents and electrophoresis reagents is doubled.
Based on the positional features of the two SNPs of ipa1-2D and the TT and CC combination comparison, we used different strategies for primer design, i.e., one competitive primer binds to the sequence at SNP1, the other competitive primer binds to the sequence at SNP2, and we designed a universal primer downstream of the two SNPs (shown schematically in FIG. 1 by the three-primer combination). The design method of the competitive Primer is to directly select SNP and the sequence on the left side of the SNP (sequence in a black frame in figure 1), the universal Primer is to copy the competitive Primer and the downstream 300bp sequence thereof into Primer Premier5.0 software, the upstream Primer range is set as the position of the competitive Primer, and the optimal reverse universal Primer is found from the downstream 300bp range according to the software scoring result. Two competitive primers are designed at SNP1 and SNP2, the tail ends of the primers correspond to C bases or T bases, wherein an ipa1-2D three-primer 1 combination is formed by the SNP1-C primer and the SNP2-T primer and a universal primer, and an ipa1-2D three-primer 2 combination is formed by the SNP1-T primer and the SNP2-C primer and the universal primer, so that the respective amplification of two genotypes of the two SNPs can be realized respectively. We also replaced the third base type to the left of SNP in the primer sequence (SNP 1T to G, SNP 2G to A) simultaneously for increasing the amplification specificity of the primer to the specific SNP base type. Because the combined areas of the two competitive primers are different, the sizes of fragments obtained by the combined amplification of the two competitive primers and the universal primer are different, wherein the amplification size of the SNP1 specific primer is 265bp, and the amplification size of the SNP2 specific primer is 231bp, and the two SNP types can be distinguished by performing gel electrophoresis, so that the three primers can be amplified in the same PCR. This design can be used to distinguish combinations of ipa1-2D and japonica rice type combinations (TT/CC), but not indica rice type combinations (TT/TC).
SNP2 is different between ipa1-2D and indica rice types, and a single SNP cannot realize the purpose of one-round PCR gel electrophoresis differentiation through the three-primer method, so that a four-primer design strategy is adopted. The principle is that a forward primer and a reverse primer for specifically amplifying two base types of SNP are respectively designed at the left side and the right side of the SNP, then a universal primer matched with the two primers is designed, and if the amplification sizes of two groups of primer bands are different, the two groups of primer bands can be distinguished by a gel electrophoresis method. Since the two universal primer combinations can also amplify a band, it is possible to compete for the amplification of the specific primers, and the effectiveness of the method depends on the sequence characteristics of the primers. Based on the above Primer design strategy, we retained the SNP2-C competitive amplification Primer (common Primer 1) and the universal Primer (common Primer 2) in the three-Primer 2 combination, introduced a competitive Primer for reverse recognition SNP2-A, and performed G to T substitution on the third base to improve the competitive amplification specificity, and then screened the optimal universal Primer for its pairing by the Primer Premier5.0 software, whose band amplification size is different from the amplification sizes of the common primers 1 and 2, the SNP2-C Primer combination amplification size is 134bp, the SNP2-A Primer combination amplification size is 231bp, and the two universal Primer amplification sizes are 322bp, which can be distinguished by gel electrophoresis. The ipa1-1D site only contains one SNP and is a base substitution from G to T, so that a four-primer strategy is adopted for primer design. Selecting ｃA section of sequence on the left side and the right side of the SNP as ｃA specific amplification Primer, respectively identifying the G base type and the T base type of the SNP, identifying T (1DSNP-A) by ｃA reverse Primer if G (1DSNP-G) is identified by ｃA forward Primer, identifying G (1DSNP-C) by ｃA reverse Primer if T (1DSNP-T) is identified by the forward Primer, and designing general pairing primers of the forward Primer and the reverse Primer by using Primer Premier5.0 software to form two sets of four-Primer combinations of four primers 1 and four-Primer 2, wherein the sizes of bands amplified by the specific Primer and the general Primer are 266bp, 282bp and 508bp respectively. To this end, we obtained 7 primer sequences recognizing ipa1-2D, resulting in three primer combinations, and 6 primer sequences recognizing ipa1-1D, resulting in two primer combinations (table 1).
TABLE 1 different combination primer sequences of ipa1-2D and ipa1-1D
Figure BDA0002856138030000061
Note: primers with the same combination name constitute a set of PCR amplification primers.
Subsequently, we performed PCR amplification verification on the above five primer combinations. YYP1 refers to a wide-stalk big-ear variety containing ipa1-2D, a short-tiller japonica (SNJ) refers to a wide-stalk big-ear variety containing ipa1-1D, Nippon grass (NIP) refers to a japonica rice variety not containing the two sites, and the varieties are subjected to seedling development to extract DNA. The DNA extraction method is a TPS small-amount extraction method and comprises the following specific steps: 1. the leaves are vibrated and crushed by a ball mill, 500ul TPS buffer solution is added, and the mixture is placed for 45 minutes at 65 ℃; 2. centrifuging at 12000 speed for 10 min, sucking 300ul of supernatant into a new centrifuge tube, adding isopropanol with the same volume, and standing at room temperature for 45 min; 3. centrifuging at 12000 speed for 10 min to obtain DNA precipitate, pouring out supernatant, and adding 500ul 75% ethanol; 4. 7500 centrifuging for 5 min, removing supernatant, draining, standing at room temperature for 30 min, and adding 100ul double distilled water to obtain DNA solution. The obtained DNA is used for PCR amplification of different primer combinations, the PCR reaction system is 20ul, the PCR reaction system comprises 2ul of DNA template, 2ul of PCR buffer (Beijing Ding Guo biology), 0.5ul of each primer (three primers or four primers), 0.3ul of Taq polymerase (Beijing Ding Guo biology), and the DNA is finally supplemented with water to 20 ul. We have searched for the optimal annealing temperatures of different primer combinations, set up 12 temperature gradients of 48-60 degrees by using a PCR instrument, the corresponding temperatures are 48.0, 48.5, 49.4, 50.6, 51.9, 53.3, 54.7, 56.1, 57.4, 58.5, 59.4 and 59.9 respectively, and amplify different rice material DNAs at the annealing temperatures respectively, wherein three groups of primers of the ipa1-2D series only amplify YYP1 and Nippon, and two groups of primers of the ipa1-1D series only amplify few tillers and Nippon. The PCR reaction conditions are as follows: denaturation at 94 ℃ for 3 min, followed by 35 cycles of "denaturation at 94 ℃ for 20 sec-gradient temperature annealing for 30 sec-72 ℃ extension for 20 sec", and final extension at 72 ℃ for 5 min to complete the reaction. After the reaction is finished, 10ul of each sample is sucked to perform continuous spotting according to the temperature gradient sequence, then agarose gel electrophoresis with the concentration of 3% is performed, and pictures are taken after 20 minutes of electrophoresis to compare the PCR banding patterns of different varieties.
The results show that the combination of the three primers 1 and 2 can amplify a brighter band, and the bands amplified by YYP1(Y) and NIP (N) are obviously different, so that the combination can be used for distinguishing two genotypes (figure 3). The optimal annealing temperature range of the three primers 1 is 52-57 ℃, and the optimal annealing temperature range of the three primers 2 is 48-57, so that 55 ℃ is finally selected as the universal annealing temperature of the two groups of three primers; the four-primer combination can amplify three bands, the uppermost band is the band amplified by two universal primers, the brightness of the band is brighter as the annealing temperature is increased, while the band for specifically amplifying the IPA1 genotype gradually becomes darker and almost disappears when the temperature is 58 ℃, which indicates that the increase of the temperature is not favorable for the amplification of the IPA1 specific primer, and the IPA1-2D specific amplification primer is hardly influenced by the temperature (FIG. 4). The sizes of two pairs of specific amplification primer bands are obviously different, two genotypes can be obviously distinguished, and finally 50 ℃ is selected as the common annealing temperature of the four primers. The target bands can be amplified by two groups of four primers of the ipa1-1D sites, the bands amplified by the universal primers are less affected by temperature and are bright, the bands amplified by the specific primers can amplify expected band differences at lower temperature, wherein the four primer 1 combination can generate bands for clearly distinguishing SNJ (S) and NIP (N) only in the temperature range of 50.6-51.9, hybrid bands can be amplified in the S type below the temperature range, N types cannot be amplified above the temperature range, the four primer 2 combination can amplify bands for distinguishing two genotypes in the range of 48-50.6, the band differences become unobvious above the temperature range, the amplification efficiency of the specific bands of the four primer combination is higher than that of the four primer 1 combination as a whole, so the four primer 2 combination is selected as the optimal primer combination for identifying the ipa1-1D sites, the usual annealing temperature is set at 50 degrees.
We further analyzed the identification effect of the primer combination in the segregation population, Jiayou Zhongke No. 4 and Jiayou Zhongke No. 6 are the thick-stalk big-ear hybrid rice varieties respectively containing ipa1-2D and ipa1-1D sites, we continuously selfed the two hybrid rice varieties in the early stage, and each generation is subjected to ipa1-2D and ipa1-1D hybrid site screening to obtain F9Generation of residual heterozygous isolates, with two isolates per site, we planted 4 residual heterozygous isolates in the field, 2 rows of 10 plants per line, for a total of 20 plants per line. And (3) extracting DNA from the plant leaves in the seedling stage by adopting a TPS small-amount extraction method, wherein the extraction method is the same as the above. SNP1dCAPS and SNP2dCAPS are dCAPS primers designed before to identify ipa1-2D site SNP1 and SNP2 respectively, and after PCR is finished, the two genotypes can be distinguished only by carrying out enzyme digestion on NspV and HpaII respectively, and the primers are used as controls for verifying the effects of three primers and four primers. We first performed PCR amplification on 6 individuals randomly in each strain, corresponding to numbers 1-1 to 1-6, 2-1 to 2-6(ipa1-2D series primer amplification), 3-1 to 3-6, 4-1 to 4-6(ipa1-1D series primer amplification). The results showed that both sets of three primers for IPA1-2D were able to amplify bands in 12 random samples and to distinguish between homozygous and heterozygous genotypes, including three IPA1 homozygous genotypes, 4 IPA1-2D homozygous genotypes and 5 heterozygous genotypes (fig. 6). The primer-to-primer comparison shows that the three primers 1 have the best effect of distinguishing different genotypes, the heterozygous genotype bands are distinguished obviously, while the heterozygous genotype amplified by the three primers 2 shows weaker but still distinguishable bands, the identification effect is similar to that of the SNP1dCAPS designed before, and the SNP2dCAPS cannot distinguish the heterozygous genotypes (FIG. 6). Therefore, the amplification effect of the two groups of three primers is obviously better than that of the previous dCAPS marker, and enzyme digestion is not neededAnd (5) operating. The four primers were also effective in discriminating heterozygous type, with the amplification product showing three bands, whereas IPA1-2D homozygous corresponds to the top and bottom two bands, and IPA1 homozygous corresponds to the middle bright band (fig. 6). It is noted that the sensitivity of the primer is higher, the middle band of the 2-1 sample is weaker, which is consistent with the identification effect of the three primers 2 on the sample, and it is presumed that a small amount of DNA sample of other genotypes may be mixed in the template DNA. Using the IPA1-1D four primer 2 combination, we identified 3-1 to 3-6, 4-1 to 4-6 individuals and found that although the two specific amplification bands were less different, three genotypes isolated from IPA1-1D, including 4 IPA1 homozygous genotypes, 5 IPA1-1D homozygous genotypes and 3 heterozygous genotypes, could be effectively distinguished (FIG. 7).
In order to determine whether the genotype identified by the primers is related to the thick stem big ear phenotype, all single plants of a series 1 and a series 3 are subjected to genotype identification in the mature period, the stem thickness and the first-grade ear stem phenotype are simultaneously investigated, the stem thickness measurement method comprises the steps of selecting a main stem of each single plant, poking a third internode, respectively measuring the long diameter and the short diameter of the middle part of the internode by using a vernier caliper, taking the average value of the long diameter and the short diameter as the third internode thickness data, and directly counting all the first-grade ear stems on a cob. 19 1 series of individuals (one individual is already withered in the mature period) are identified by utilizing an IPA1-2D three-primer 1 combination, wherein the individuals comprise 7 IPA1 genotypes, 5 IPA1-2D genotypes and 7 heterozygous genotypes, and the stem thickness and the number of first-grade branches of the ear corresponding to the IPA1 genotypes are small, the stem thickness range is 4.7-5.9, and the number of the first-grade branches range is 13-17; the numerical value corresponding to ipa1-2D is the maximum, the stem thickness range is 8.2-9.6, and the number range of the first-level branches is 31-47; the heterozygote trait was found to be intermediate with stem thickness ranging from 7 to 9.5 and first-degree branch number ranging from 19 to 28 (Table 2). The combination of the IPA1-1D four primers 2 is utilized to identify 20 3 series of single plants, wherein the single plants comprise 4 IPA1 genotypes, 8 IPA1-1D genotypes and 8 heterozygous genotypes, and the comparison of the three genotypes shows that the difference between the stem thickness and the first-grade branch number of the spike is not obvious, the difference between the three genotypes of IPA1-2D is not obvious, the stem thickness range corresponding to the IPA1 genotype is between 5.7 and 7.1, and the first-grade branch number range is between 14 and 18; the stem thickness range corresponding to the ipa1-1D genotype is between 8.5 and 9.9, and the number range of the first-level branches is between 18 and 22; the stem thickness range corresponding to the heterozygous genotype is between 6.9 and 8.3, and the number of the first-grade branches is between 16 and 20 (Table 3); overall, the promoting effect of ipa1-1D on the stem thickness is larger than the promoting effect on the first-grade branch number of the spike. So far, we prove that different primer combinations designed by the invention can effectively distinguish heterozygous genotypes and homozygous genotypes of ipa1-2D and ipa1-1D, and can be effectively used for tracking stem thickness and first-grade branch number phenotypes of ears determined by two loci.
TABLE 2.1 series isolate ipa1-2D genotype identification and its correlation to stem thickness and ear primary shoot phenotype.
Figure BDA0002856138030000081
Figure BDA0002856138030000091
Table 3.3 series isolate line ipa1-1D genotype identification and its correlation to stem thickness and ear first branch phenotype.
Figure BDA0002856138030000092
Figure BDA0002856138030000101
The rice breeding needs to perform phenotype screening on a large number of single plants, and molecular markers can identify breeding segregation populations at the beginning of seedling stage, so that the method further develops the identification of one F2And (3) carrying out a large number of individual genotype identifications of the population and analyzing the phenotype linkage relationship of the individual genotypes. The group is derived from another F of thick-rod big-ear material containing ipa1-2D and hybridized with Nipponbare1Plant, we will F1F on the plant2The seeds are harvested and sown in a seedling bed, and after one month, the seedlings are transplanted, and the seedlings are planted in 36 rows in total, wherein 10 plants are planted in each row. Taking single plant after transplanting rice for two weeksIn order to facilitate the evaluation of maturity phenotype, we sampled only the middle 8 individuals in the middle 24 rows, and obtained 192 individual leaf samples in total, and extracted DNA by TPS miniprep method, as above. Then, the DNA samples are subjected to PCR amplification and gel electrophoresis of ipa1-2D three-primer 2 combination, and finally, the genotypes of 189 single plants are obtained, wherein two single plants have no amplified bands, which may cause DNA extraction failure, the genotype of one single plant band cannot be accurately judged, and other DNA samples may be mixed. Wherein 41 individuals are IPA1 genotypes, 48 individuals are IPA1-2D genotypes, and 100 individuals are heterozygous genotypes, which meet the genotype separation ratio of 1:2:1, and the primer combination is proved to be capable of accurately and effectively distinguishing IPA1-2D locus separation in a genetic segregation population. In the mature period, the number of the stems of 189 single plants is subjected to phenotypic measurement of the stem thickness and the first-level branches of the spike, and the number of the second-level branches of the spike is born on the first-level branches of the spike and is influenced by the number of the first-level branches to a certain extent. The results show that the three traits all show continuous trait distribution in the population, the distribution characteristics show a normal distribution mode (figure 8), and the traits are proved to belong to quantitative traits, and the screening difficulty is high close to naked eyes in the breeding process. Grouping three traits according to three genotypes of IPA1-2D, respectively calculating an average value and a standard deviation, wherein the average value of the stem thickness trait IPA1 genotype is 4.99, the standard deviation is 0.76, the average value of the heterozygous genotype is 5.96, the standard deviation is 0.86, the average value of the IPA1-2D genotype is 6.91, and the standard deviation is 0.96, and based on the results of statistical analysis of the large sample, the stem thickness of the IPA1-2D can be stably increased by about 2mm compared with that of the IPA1 genotype; the average value of the first-grade branch character IPA1 genotype is 15.9, the standard deviation is 2.8, the average value of the heterozygous genotype is 20.5, the standard deviation is 4.2, the average value of the IPA1-2D genotype is 24.4, the standard deviation is 5.6, and compared with the IPA1 genotype, the IPA1-2D can stably increase the first-grade branches of the spike by about 8.5, so that the effect is huge; the average value of the second-grade branch character IPA1 genotype is 38.6, the standard deviation is 14.8, the average value of the heterozygous genotype is 47.8, the standard deviation is 18.2, and the iPa1-2D genotypeThe average value is 47.4, the standard deviation is 22.2, and compared with IPA1-2D, the IPA1 genotype can stably increase the number of scion secondary branches by about 8.8, and no obvious difference exists between heterozygotes. It is worth noting that the character value corresponding to ipa1-2D and the character value corresponding to heterozygous type have a coincidence phenomenon, which shows that the homozygous single plant at ipa1-2D locus can not be accurately selected only by visual observation, and the marker combination designed in the invention can effectively distinguish two genotypes, thereby solving the problem.
TABLE 4.F2Segregation ratios of three genotypes of a population and correlation of the segregation ratios with three traits.
Figure BDA0002856138030000102
Figure BDA0002856138030000111
So far, we prove that several groups of primers can efficiently identify the core SNP of ipa1-2D and ipa1-1D, compared with the previously designed dCAPS markers, the primer markers have better distinguishing effect, can accurately distinguish three genotypes in a separation population, do not need enzyme digestion identification, and can greatly reduce analysis cost when large-population genotype identification is carried out. Aiming at two SNPs at ipa1-2D sites, a three-primer combination design for respectively identifying the two SNPs is skillfully designed, the primer combination can finish genotype identification in one round of PCR, the time, labor and reagent cost are reduced, the primer synthesis cost is saved compared with four primers, and three sets of ipa1-2D identification modules can be obtained by different combinations of seven primers, so that the identification requirements of different types of groups are met. The primers have great advantages in the aspect of mass population identification, and have good application prospects in the molecular design breeding of super hybrid rice of rice in the future.
Sequence listing
<110> Yangzhou university
<120> primers and method for identifying rice rough stalk and large ear sites ipa1-2D and ipa1-1D
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcctatccac ataccaggat ttgtc 25
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gggatcaggg ttactacact 20
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gcctatccac ataccaggat ttgtt 25
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gggatcaggg ttactacacc 20
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atgtggcagg gtagagtagt a 21
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ccttgccgct gctcctccat c 21
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cgtgggaacc gtgcttaccg cctga 25
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tgggttgaca gaagagaaag 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
caccgactcg agctgtgata 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tgggttgaca gaagagaaat 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
caccgactcg agctgtgatc 20
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aagtgggcat gatggctagg a 21
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
agggttccaa gcagcgtaag g 21

Claims (7)

1. A primer for identifying rice rough stalk big ear sites ipa1-2D and ipa1-1D is characterized by comprising a primer for identifying a rice pa1-2D genotype and a primer for identifying a rice pa1-1D genotype;
the primer for identifying the rice pa1-2D genotype is one of the following three primer combinations:
three primer combinations 1 for identifying ipa1-2D sites:
2DSNP1-C：GCCTATCCACATACCAGGATTTGTC，
2DSNP2-T：GGGATCAGGGTTACTACACT，
2DCom_R：ATGTGGCAGGGTAGAGTAGTA；
three primer combinations 2 for identifying ipa1-2D sites:
2DSNP1-T：GCCTATCCACATACCAGGATTTGTT，
2DSNP2-C：GGGATCAGGGTTACTACACC，
2DCom_R：ATGTGGCAGGGTAGAGTAGTA；
identifying a four-primer combination of ipa1-2D sites:
2DSNP2-C：GGGATCAGGGTTACTACACC，
2DCom_R：ATGTGGCAGGGTAGAGTAGTA，
2DCom_F：CCTTGCCGCTGCTCCTCCATC，
2DSNP2-A：CGTGGGAACCGTGCTTACCGCCTGA；
the primer for identifying the rice pa1-1D genotype is one of the following two primer combinations;
four primer combination 1 for identifying ipa1-1D locus:
1DSNP-G：TGGGTTGACAGAAGAGAAAG；
1DSNP-A：CACCGACTCGAGCTGTGATA；
1DCom-F：AAGTGGGCATGATGGCTAGGA；
1DCom-R：AGGGTTCCAAGCAGCGTAAGG；
four primer combination 2 for identifying ipa1-1D locus:
1DSNP-T：TGGGTTGACAGAAGAGAAAT；
1DSNP-C：CACCGACTCGAGCTGTGATC；
1DCom-F：AAGTGGGCATGATGGCTAGGA；
1DCom-R：AGGGTTCCAAGCAGCGTAAGG。
2. a method for identifying rough stalk and big ear positions ipa1-2D and ipa1-1D of rice is characterized by comprising the following steps:
(1) extracting the genome of the rice to be detected;
(2) performing PCR amplification by using the genome extracted in the step (1) as a template and the primer for identifying the rice pa1-2D genotype and the primer for identifying the rice pa1-1D genotype in claim 1 respectively;
(3) and (3) carrying out agarose gel electrophoresis on the amplification product obtained by the PCR in the step (2), and observing an electrophoresis band.
3. The method for identifying rice rough stalk big ear sites ipa1-2D and ipa1-1D as claimed in claim 2, wherein in step (2), the PCR amplification system is as follows:
mu.l of DNA template, 2. mu.l of PCR buffer, 0.5. mu. L, Taq of each primer, 0.3. mu.l of polymerase, and finally 20. mu.l of each primer was prepared with water.
4. The method for identifying rice rough stalk big ear sites ipa1-2D and ipa1-1D as claimed in claim 2, wherein in step (2), the PCR reaction conditions are: denaturation at 94 ℃ for 3 min, followed by 35 cycles of "denaturation at 94 ℃ for 20 sec-40-55 ℃ annealing for 30 sec-72 ℃ extension for 20 sec", and finally extension at 72 ℃ for 5 min.
5. The method for identifying the rice rough stalk big ear sites ipa1-2D and ipa1-1D as claimed in claim 4, wherein the annealing temperature is 52-57 ℃ when the three primer combination 1 for identifying the ipa1-2D site is used for amplification;
when the three-primer combination 2 for identifying the ipa1-2D locus is used for amplification, the annealing temperature is 48-57 ℃;
when the four primer combination for identifying the ipa1-2D locus is used for amplification, the annealing temperature is 48-56 ℃;
when the four-primer combination 1 for identifying the ipa1-1D locus is used for amplification, the annealing temperature is 50.6-51.9 ℃;
when the four-primer combination 2 for identifying the ipa1-1D locus is used for amplification, the annealing temperature is 48-50.6 ℃.
6. The method of identifying rice rough stalk big ear sites ipa1-2D and ipa1-1D as claimed in claim 2,
when the three primer combination 1 for identifying the ipa1-2D locus is used for carrying out PCR amplification, and the size of an electrophoresis strip is 231bp, the rice is an ipa1-2D genotype; when the size of the electrophoresis strip is 265bp, the rice is IPA1 genotype; when the two bands of 231bp and 265bp are both present, the rice is heterozygous genotype;
when the three-primer combination 2 for identifying the IPA1-2D locus is used for PCR amplification, and the size of an electrophoresis strip is 231bp, the rice is of an IPA1 genotype; when the size of the electrophoresis strip is 265bp, the rice is of ipa1-2D genotype; when the two bands of 231bp and 265bp are both present, the rice is heterozygous genotype;
when the iPa1-2D four primer combination is identified for PCR amplification, and an electrophoresis strip comprises 322bp and 134bp, the rice is an iPa1-2D genotype; when the electrophoresis band comprises 322bp and 265bp, the rice is IPA1 genotype; when the electrophoresis bands comprise 322bp, 265bp and 134bp, the rice is in a heterozygous genotype.
7. The method of identifying rice rough stalk big ear sites ipa1-2D and ipa1-1D as claimed in claim 2,
when the iPA1-1D four primer combination 1 is identified for PCR amplification, and an electrophoresis strip comprises 508bp and 266bp, the rice is the IPA1 genotype; when the electrophoresis band comprises 508bp and 282bp, the rice is of ipa1-1D genotype; when the electrophoresis bands comprise 508bp, 282bp and 266bp, the rice is in a heterozygous genotype;
when the iPa1-1D four primer combination 2 is identified for PCR amplification, and an electrophoresis strip comprises 508bp and 266bp, the rice is an iPa1-1D genotype; when the electrophoresis band comprises 508bp and 282bp, the rice is of IPA1 genotype; when the electrophoresis bands comprise 508bp, 282bp and 266bp, the rice is in a heterozygous genotype.
CN202011547600.1A 2020-12-24 2020-12-24 Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D Pending CN112481411A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011547600.1A CN112481411A (en) 2020-12-24 2020-12-24 Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011547600.1A CN112481411A (en) 2020-12-24 2020-12-24 Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D

Publications (1)

Publication Number Publication Date
CN112481411A true CN112481411A (en) 2021-03-12

Family

ID=74914367

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011547600.1A Pending CN112481411A (en) 2020-12-24 2020-12-24 Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D

Country Status (1)

Country Link
CN (1) CN112481411A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114058732A (en) * 2021-12-07 2022-02-18 扬州大学 Primer combination for efficiently identifying different alleles of grain weight gene GW5, identification method and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106676179A (en) * 2017-01-19 2017-05-17 海南波莲水稻基因科技有限公司 Molecular marker for paddy recessive genic male sterility gene cyp704b2 and application thereof
CN110387431A (en) * 2019-08-29 2019-10-29 毕节市农业科学研究所 A kind of molecular labeling and the method using its identification low temperature resistant gene bZIP73 of rice

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106676179A (en) * 2017-01-19 2017-05-17 海南波莲水稻基因科技有限公司 Molecular marker for paddy recessive genic male sterility gene cyp704b2 and application thereof
CN110387431A (en) * 2019-08-29 2019-10-29 毕节市农业科学研究所 A kind of molecular labeling and the method using its identification low temperature resistant gene bZIP73 of rice

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LIN ZHANG等: "A natural tandem array alleviates epigenetic repression of IPA1 and leads to superior yielding rice", 《NAT COMMUN》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114058732A (en) * 2021-12-07 2022-02-18 扬州大学 Primer combination for efficiently identifying different alleles of grain weight gene GW5, identification method and application

Similar Documents

Publication Publication Date Title
CN105695478B (en) Gene for regulating plant type and yield of plant and application thereof
CN106480228B (en) The SNP marker and its application of rice low cadmium-accumulation gene OsHMA3
US10337072B2 (en) Copy number detection and methods
CN108486276A (en) Capsicum maturity SNP marker and its application
CN110894542A (en) Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer
CN110512024B (en) SNP molecular marker related to low acidity or acidity state of peach fruit and application thereof
CN114480709B (en) Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof
CN112481411A (en) Primers and method for identifying rice rough-stalk large-spike positions ipa1-2D and ipa1-1D
CN106480062B (en) Recombinant nucleic acid fragment RecCR012080 and detection method thereof
CN114717354B (en) Molecular marker combination, primer set, kit, identification method and application for identifying asparagus super-male plants
CN113278723B (en) Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application
CN107287278B (en) Recombinant nucleic acid fragment RecCR010169 and detection method thereof
CN107287280B (en) Recombinant nucleic acid fragment RecCR010165 and detection method thereof
CN115786564A (en) Rice Pi-ta and Ptr dominant functional molecular marker and application thereof
CN106480057B (en) Recombinant nucleic acid fragment RecCR012083 and detection method thereof
CA2804853A1 (en) Soybean gene cluster regions associated with aphid resistance and methods of use
CN106609273B (en) Recombinant nucleic acid fragment RecCR020127 and detection method thereof
CN106609276B (en) Recombinant nucleic acid fragment RecCR020260 and detection method thereof
CN106480047B (en) Recombinant nucleic acid fragment RecCR020325 and detection method thereof
CN106480054B (en) Recombinant nucleic acid fragment RecCR020322 and detection method thereof
CN109929838A (en) Rice genome recombinant nucleic acid segment RecCR012612 and its detection method
CN116904638B (en) Kasp markers linked to early females of quinoa and uses thereof
CN112593006B (en) Wheat green-extending character main effect QTL locus, KASP primer closely linked with same and application of KASP primer
CN102296124A (en) Method for quickly differentiating Chinese date varieties by using random amplified polymorphic DNA (RAPD)
CN107988213B (en) Rice genome recombinant nucleic acid fragment RecCR020428 and detection method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20210312