CN113981130B - Method for screening rice growth period - Google Patents

Method for screening rice growth period Download PDF

Info

Publication number
CN113981130B
CN113981130B CN202111443502.8A CN202111443502A CN113981130B CN 113981130 B CN113981130 B CN 113981130B CN 202111443502 A CN202111443502 A CN 202111443502A CN 113981130 B CN113981130 B CN 113981130B
Authority
CN
China
Prior art keywords
yyp
dhxhd1
nip
yyp1hd1
rice
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111443502.8A
Other languages
Chinese (zh)
Other versions
CN113981130A (en
Inventor
张�林
曹东平
刘巧泉
邹怡婷
卞中
周涵
谢东
庄文姝
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN202111443502.8A priority Critical patent/CN113981130B/en
Publication of CN113981130A publication Critical patent/CN113981130A/en
Application granted granted Critical
Publication of CN113981130B publication Critical patent/CN113981130B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a method for screening rice growth period, which comprises the following steps: preparing an amplification template, preparing an amplification system, performing PCR, performing agarose gel electrophoresis, and performing photographing and comparison. According to the invention, different allelic variants of two Hd1 are found through genetic segregation population, compared with a wild type, the two mutant alleles can be obviously advanced in the fertility period, and for the two variant types, two groups of four primer markers are respectively designed, so that the two variants can be rapidly identified by utilizing a PCR (polymerase chain reaction) combined gel electrophoresis method, and the primers can be effectively used for tracking the rice fertility period characteristics.

Description

Method for screening rice growth period
Technical Field
The invention relates to the technical field of rice cultivation, in particular to a method for screening rice growth period.
Background
Rice is an important grain crop in China, and high yield is an important guarantee for grain production safety. The rice planting environments in different areas have different demands on the growth period, the insufficient utilization of light and temperature can be caused by the too short growth period, the yield exertion is limited, and the growth period is too long, so that the growth period of the follow-up crop rotation can compete, and the yield exertion of the crops in the next season is not facilitated. Therefore, plants with growth periods meeting the local growth requirements need to be screened in the rice breeding process of different areas. However, observation of the growth period is a continuous process, and a lot of time and labor are consumed in the investigation of a large breeding population, and screening with molecular markers associated with the growth period can effectively solve the problem. A plurality of growth-period regulating genes including Hd1, hd3a, ghd7, ghd8, ghd7.1, hd6, ehd1, DTH3, RFT and the like are cloned in rice at present, different variations of the genes exist in a large number of rice varieties, although linkage markers of the genes are designed for tracking target variations in breeding, the linkage markers are limited to specific hybrid parent combinations, effective identification of any breeding population cannot be realized, and the linkage markers cannot effectively identify the target gene variations of natural varieties due to chromosome exchange, so that a marker system capable of directly identifying the key growth-period gene variations needs to be developed.
Disclosure of Invention
This section is intended to outline some aspects of embodiments of the application and to briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section as well as in the description of the application and in the title of the application, which may not be used to limit the scope of the application.
The present invention has been made in view of the above-mentioned problems and/or problems associated with the existing methods for screening rice for growth.
Therefore, one of the purposes of the invention is to overcome the defects of the existing rice screening method and provide a method for screening rice growth period.
In order to solve the technical problems, according to one aspect of the present invention, the following technical solutions are provided: a method of screening rice for growth period comprising the steps of:
preparing an amplification template: preparing an amplification template YYP1, NIP, DHX or DNA of any rice variety;
Preparing an amplification system: DNA template, 2X TAQ MASTER Mix 10ul, each primer 0.5ul, DD water were prepared.
And (2) PCR: performing PCR operation, and performing denaturation, annealing and derivatization steps;
agarose gel electrophoresis: agarose gel electrophoresis is carried out on the PCR product;
And (3) shooting and comparing: photographs were taken of agarose gel electrophoresis results, and gel images were compared.
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: in the preparation of the amplification system, the DNA templates were YYP, NIP and DHX.
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: in the preparation of the amplification system, the amplification system was 20ul.
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: preparing an amplification system, wherein the primer comprises one or more of the following primers:
YYP1Hd1-1：TGCCTCTGCATACGCCTTTC
YYP1Hd1-2：GACAATACGTTATGAAACAAGG
YYP1Hd1-3：TGACCATTTGCCGATTCCAT
YYP1Hd1-4：AGCTACCGTCAGATAGAGCTGC
YYP1Hd1-5：GACAATACGTTATGAAACAAGGC
YYP1Hd1-6：CATTTGCCGATTCCATCTCA
YYP1Hd1-7：TATTGCTACTCAGTAAGTCCCC
DHXHd1-1：TACCCGCCTCCATTGATGACAG
DHXHd1-2：GCCGATTCCATCTCAGATATCGTT
DHXHd1-3：GTATTGTCTTCTCAAACTTCCT
DHXHd1-4：TTTGCGACAGTAAAAAAGAT
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: when differentiating NIP from YYP type 1 variants, the primers used were YYP Hd1-1, YYP Hd1-5, YYP Hd1-6 and YYP1Hd1-7, and the smaller band (128 bp) appeared in the amplified product as early heading plants/variety.
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: when differentiating NIP from YYP type 1 variants, the primers used were YYP Hd1-1, YYP Hd1-2, YYP Hd1-6, YYP1Hd1-7, and the early heading plants/varieties appeared as smaller bands (128 bp) in the amplified products.
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: when distinguishing between DHX and NIP type variants, the primers used were DHXHd1-1, DHXHd1-2, DHXHd1-3, DHXHd1-4, and the early heading plants/varieties appeared as small bands (175 bp) in the amplified products.
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: the PCR cycle was performed at 94℃for 3min, 30s annealing, 20s extension at 72℃for 35 cycles, and finally at 72℃for 5 min.
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: when YYP Hd1-1, YYP Hd1-2, YYP Hd1-6, YYP Hd1-7 were used as primers, the annealing temperature was 57.5.ltoreq.and 61.4.ltoreq.
As a preferred embodiment of the method for screening rice in a growing period of the present invention, there is provided a method wherein: when the primers used are DHXHd1-1, DHXHd1-2, DHXHd1-3 and DHXHd-4, the annealing temperature is not less than 48 ℃ and not more than 58 ℃.
The invention provides a method for screening rice in a growing period, which discovers different equivalent variations of two Hd1 through genetic segregation groups, can obviously prolong the growing period compared with a wild type, and respectively designs two groups of four primer marks aiming at the two variation types, thereby realizing rapid identification of the two variations by utilizing a PCR (polymerase chain reaction) combined gel electrophoresis method and proving that the used primers can be effectively used for tracking the rice growing period characters.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the description of the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art. Wherein:
FIG. 1 is a schematic diagram showing the analysis of the regulatory effect of Hd1 on the growth period,
Wherein a is a comparison of the parental growth periods of three populations used to construct; b is YYP/DHX and YYP/NIP F2 population individual heading date distribution characteristics; c is YYP/NIP F2 colony heading stage trait QTL positioning result, and an arrow indicates the Hd1 gene position;
FIG. 2 is a diagram showing alignment of key variation regions of Hd1 between YYP and NIP, the upper region being NIP, the lower region being YYP1,
FIG. 3 is an alignment of the Hd1 key mutation interval sequences of DHX and NIP, the upper sequence being NIP, the lower sequence being DHX,
FIG. 4 shows the temperature gradient exploration of YYP Hd1-1/2/3/4 four-primer amplification different templates,
In the figure, Y is YYP1, N is NIP, D is DHX, and different numbers on the lower side of the picture are different annealing temperatures used;
FIG. 5 shows the temperature gradient exploration of three YYP H1 four-primer combinations for amplifying different templates,
In the figure, Y is YYP1, N is NIP, and different numbers on the lower side of the picture are different annealing temperatures used;
FIG. 6 shows the temperature gradient exploration of DHXHd.about.1/2/3/4 four-primer amplification of different templates,
In the figure, N is NIP, D is DHX, and different numbers at the lower side of the picture are different annealing temperatures used;
FIG. 7 is a schematic diagram showing the effect of YYP Hd1-1/2/6/7 amplification and separation groups, 1-24 single plants,
In the figure, H, N and Y respectively represent heterozygous type, NIP wild type and YYP1 four-base deletion type Hd1 identification results;
FIG. 8 is a schematic diagram showing DHXHd-1/2/3/4 amplification and separation colony effect,
In the figure, 1-24 are 24 single plants, H, N and D respectively represent heterozygous, NIP wild type and DHX two-base deletion type Hd1 identification results.
Detailed Description
In order that the above-recited objects, features and advantages of the present invention will become more apparent, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways other than those described herein, and persons skilled in the art will readily appreciate that the present invention is not limited to the specific embodiments disclosed below.
Further, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic can be included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments. The following examples are put forth so as to enable those skilled in the art to practice.
Example 1
The sampling site is a rice planting base in the Yangzhou university literature road school area, and the selected rice varieties are three types: YYP1, japanese condition (NIP) and floral rice (DHX), taking leaf samples directly from three kinds of plants in the field at seedling stage, extracting DNA by adopting a TPS small amount extraction method, wherein the TPS small amount extraction method comprises the following specific steps: 1. after quick-freezing the leaf liquid nitrogen, oscillating and crushing the leaf by a ball mill, oscillating for 60 seconds, adding 500ul TPS buffer solution with the composition of 100mM Tris-HCL (pH 8.0), 10mM EDTA (pH 8.0), 1M KCL and standing at 65 ℃ for 45 minutes after fully crushing the leaf liquid nitrogen and the oscillating frequency of 55; 2. centrifuging at 12000 speed for 10min, sucking 300ul supernatant into a new centrifuge tube, adding isopropanol with equal volume, and standing at room temperature for 45 min; 3. centrifuging at 12000 speed for 10min to obtain DNA precipitate, pouring out supernatant, and adding 500ul 75% ethanol; 4. centrifugation was carried out at 7500 rpm for 5 minutes, the supernatant was removed and the residual liquid was dried, and after standing at room temperature for 30 minutes, 100ul of double distilled water was added to obtain a DNA solution. A pair of primers was then designed using PRIMER PRIMIER 5.0.0 software, forward primer sequence CATAGGACCCGCCAAAGTG and reverse primer sequence CATGATGGAACGAAAATAGGAAT, to amplify a 2700bp sequence containing Hd1 genomic DNA. We used high fidelity enzymes (Phanta Max Super-FIDELITY DNA Polymerase, nanjinouzan) to amplify the DNA of YYP and NIP respectively as templates to obtain the target size bands, which were then sequenced by the company. Comparison of the two sets of sequences obtained revealed that YYP1 had a AAGA four base deletion relative to the NIP (fig. 2), located in the middle of the second exon of the Hd1 gene, resulting in loss of encoded protein function, whereas Hd1 in the NIP was a functional wild type capable of inhibiting flowering under long-day conditions, consistent with the effect of fragments from NIP in the segregating population to delay flowering. I also sequenced the Hd1 gene of the DHX variety and found that the variety contained another type of Hd1 deletion, TT dibasic deletion (FIG. 3), at the front of the second exon, also resulted in loss of protein function, so that both Hd1 in YYP/DHX populations were loss-of-function, which explains why the population had a smaller range of growth phase variation. Therefore, we successfully resolved the key gene Hd1 and its three variant types, namely wild type (NIP), four base deletion (YYP 1), dibasic Deletion (DHX), which can lead to changes in fertility.
Example 2
According to different mutation types, four primers are designed, and the specific sequences are as follows:
YYP1Hd1-1：TGCCTCTGCATACGCCTTTC
YYP1Hd1-2：GACAATACGTTATGAAACAAGG
YYP1Hd1-3：TGACCATTTGCCGATTCCAT
YYP1Hd1-4：AGCTACCGTCAGATAGAGCTGC
Although sequencing methods can effectively distinguish three types of variation, identification costs are high for a large number of varieties or segregating populations, and are time-consuming and laborious, so there is a need to develop a method that can identify three types of variation at a high throughput and low cost. The molecular marker based on PCR amplified strip difference is a method with high flux, the marker type aiming at sequence deletion is commonly InDel marker, but two key variants in the invention are microdeletions smaller than 10bp, can not be distinguished by agarose gel, but can not be distinguished by adopting PAGE gel, but the manufacturing process of the PAGE gel is very troublesome, and can not realize simplified operation. Another strategy is to use Caps or dCaps markers, i.e., to find or introduce mutation-induced differential restriction endonuclease sites, but this aspect increases the cost of identification and increases the procedures that are cumbersome. The existing research shows that a four-primer strategy can realize the identification of single nucleotide substitution type variation, namely, two primers are used for specifically identifying different variation types, and the two primers are respectively combined with the two specific primers to amplify the difference of the bands, so that the different mutation types can be finally distinguished.
Wherein primers 1 and 2 are specific primers recognizing wild type and four base deletions, respectively, wherein primer 1 in combination with primer 3 will specifically amplify a 268bp band from NIP, primer 2 in combination with primer 4 will specifically amplify a 128bp band from YYP1, while primers 3 and 4 will not specifically amplify a 362bp band from any type of template. Subsequently, we verified the amplification effect of the four primers, and amplified templates were YYP, NIP and DHX. A20 ul amplification system was used, containing 2ul of DNA template, 10ul of 2X TAQ MASTER Mix (Nanjinozan), 0.5ul of each primer, and finally made up to 20ul with water. The PCR reaction conditions were: denaturation at 94℃for 3 min followed by 35 cycles of "denaturation at 94℃for 20 sec-gradient temperature annealing for 30 sec-extension at 72℃for 20 sec" and extension at 72℃for 5 min. The annealing temperature was set to 8 temperature gradients of 48, 49, 50.7, 53.4, 56.5, 59.1, 60.9, 62℃respectively, and 10ul of amplified product was aspirated for 3% concentration agarose gel electrophoresis after PCR was completed, and photographed by an ultraviolet gel imaging system after EB staining. As shown in FIG. 4, the four-primer combination can amplify nonspecific 362bp bands at eight temperature gradients, and nonspecifically amplify 128bp bands in three templates at a temperature lower than 51 ℃, but the YYP1 bands are slightly brighter than NIP and DHX templates, and specifically amplify 128bp bands in YYP templates at a temperature range of 54.5-61.5 ℃; however, the 268bp band for the NIP template could not be amplified out in eight temperatures, failing to achieve the expected resolution.
Example 3
The sequence of the four groups of primers, namely the amplification combination, is adjusted, a C base is added to the sequence template of the primer 2 and named YYP Hd1-5 for increasing the binding specificity of the primers, and then two new non-specific primers 6 and 7 combined with the specific primers are designed, wherein the specific sequences are as follows:
YYP1Hd1-5：GACAATACGTTATGAAACAAGGC
YYP1Hd1-6：CATTTGCCGATTCCATCTCA
YYP1Hd1-7：TATTGCTACTCAGTAAGTCCCC
We performed three more four primer combinations for primers 1-7, namely 1/5/3/4, 1/5/6/7 and 1/2/6/7
The combination, wherein the 1/5/3/4 combination of the band amplification type and size is similar to the original 1/2/3/4 combination, the latter two combinations will amplify 263bp NIP specific band, 212bp YYP1 specific band and 440bp consensus band, respectively. The annealing temperature gradient exploration is carried out on the three groups of four primers, the PCR reaction system is the same as that of the amplification template YYP and NIP, and 12 temperature gradients are set, namely 48, 48.8, 50, 51.6, 53.5, 55.5, 57.5, 59.5, 61.4, 62.9, 64.1 and 65 ℃. As shown in FIG. 5, FIG. 5 shows that YYP Hd1-1/5/3/4 primer combination can specifically recognize the common 362bp band and YYP specific 128bp band, but can not amplify 268bp specific band from NIP, and the effect of the primer combination is similar to that of YYP Hd1-1/2/3/4 primer combination; the YYP Hd1-1/5/6/7 primer combination can specifically amplify 212bp bands of YYP1 and 263bp bands of NIP at the temperature of less than 61.5 ℃ to realize effective differentiation of different mutation types, and the differentiation effect is best in the temperature range of 55.5-61.5, but the specific amplified bands of the primer combination for YYP1 mutation have stronger brightness than the specific bands of NIP; the YYP Hd1-1/2/6/7 primer combination cannot distinguish YYP type from NIP type under the temperature condition of less than 55 degrees, but can effectively distinguish YYP type and NIP type within the temperature range of 57.5 to 61.4, wherein YYP type corresponds to 212bp specific band and 440bp common band, NIP type corresponds to 263bp specific band and 440bp common band, and the temperature condition of 59.5 degrees can balance the amplification ratio of the specific band and the common band well, thus being a preferable amplification temperature. To this end, we successfully achieved the use of four primers to distinguish between two Hd1 variant types of YYP and NIP.
Example 4
According to the same principle, we further designed four primers that distinguish between DHX and NIP type variants, the sequences were as follows:
DHXHd1-1：TACCCGCCTCCATTGATGACAG
DHXHd1-2：GCCGATTCCATCTCAGATATCGTT
DHXHd1-3：GTATTGTCTTCTCAAACTTCCT
DHXHd1-4：TTTGCGACAGTAAAAAAGAT
Wherein primer 1 specifically recognizes the two-base mutation of DHX, primer 2 specifically recognizes the wild-type sequence of NIP, and in addition, the last three bases at the ends of primer 1 and 2 also introduce base substitution to further increase the amplification specificity of the respective primers; wherein the combination of primer 1 and primer 3 will specifically amplify 175bp band in DHX template, primers 2 and 4 will specifically amplify 226bp band in NIP template, and primers 3 and 4 will amplify 358bp nonspecific band. We performed annealing temperature gradient search for the four primer combinations described above (eight annealing temperatures 48, 49, 50.7, 53.4, 56.5, 59.1, 60.9, 62 ℃ C.) with templates NIP and DHX, and PCR reaction conditions were the same. The result shows that in the temperature range of 48-58 ℃, the four primer combinations can effectively distinguish DHX and NIP bands, the obtained image is shown in figure 6, 175bp bands in DHX and 226bp bands in NIP are specifically amplified, but non-specific 358bp bands cannot be amplified, and the result shows that the amplification efficiency of the non-specific primer combinations is far lower than that of the specific primer combinations, and the result is unexpected, but the specificity of four primer identification is increased, and the effect is better. Thus, we have also successfully obtained four primers useful for discriminating Hd1 two base deletion type variations.
Example 5
We explored the effect of the use of four primers. From the recombinant inbred lines obtained by YYP continuous selfing with NIP, we found the strain isolated from Hd1, we continued to plant the harvested seed of one of the heterozygous individual plants into an isolated population in the field, sampled the population at the seedling stage, 96 plants were taken out, and DNA was extracted by TPS miniextraction (methods as above). Carrying out YYP Hd1-1/2/6/7 four-primer combination PCR amplification on the obtained 96 plant sample DNA, wherein the annealing temperature is 60 ℃, and the rest PCR reaction conditions and reaction systems are the same. After amplification, the PCR products were subjected to agarose gel electrophoresis at 3% concentration, and the results are shown in FIG. 7. FIG. 7 shows that the PCR bands of 96 individual plants are clearly separated, corresponding to three genotypes, and although the nonspecific 440bp band is brighter, the specific band can still be clearly distinguished, i.e., the band containing 212 and 263bp is heterozygous (H), the band containing 212bp only is YYP type (Y), and the band containing 263bp only is NIP type (N). By using the four primers, we finally identify 21 NIP type, 27 YYP type and 48 heterozygous type from 96 single plants, judge the maturity of the 96 plants in the maturity period, collect the snapping seeds on the same day, judge the maturity by the color of the snapping seed shells, divide the snapping seeds into three types of yellow, cyan yellow and cyan, wherein one of the 21 NIP type does not survive, 14 of the remaining 20 strains are of cyan type, 5 strains are of cyan yellow type, and 1 strain is of yellow type, thus indicating that most of the plants are immature; two of the 27 strains YYP types 1 are not survived, 18 strains are of yellow type and 7 strains are of cyan yellow type in the remaining 25 strains, which indicates that most of the plants are mature; three of the 48 heterozygotes are not survived, and 16 plants are of yellow type, 27 plants are of cyan yellow type and 2 plants are of cyan type in the remaining 45 plants, which means that most of the plants are in a semi-mature state. From this, the primer combination was found to be accurate in judging the phenotype of the growth period, and a large number of screening was performed in the seedling stage, and if the NIP type band was found, it was assumed that the plant was late-maturing, and if the YYP type band was found, it was assumed that the plant was early-maturing.
Further, we tested the recognition effect of DHXHd four primers. We constructed F2 segregating populations by hybridization of DHX and NIP, planted in Yangzhou field, sampled and extracted DNA at seedling stage, and subjected to DHXHd four primer identification for 192 individuals. The annealing temperature is 55 ℃, and the rest PCR reaction conditions and reaction systems are the same. After amplification, the PCR products were subjected to agarose gel electrophoresis at a concentration of 3%, and the results are shown in FIG. 8. FIG. 8 shows that the PCR bands of 192 individual plants are obviously separated, corresponding to three genotypes, and mainly show the difference of specific bands, and the non-specific band amplification is very weak, which is consistent with the temperature gradient experimental result. Meanwhile, the hybrid type contains 175bp and 226bp, the DHX type contains only 175bp bands, and the NIP type contains only 226bp bands. Finally, from 192 single plants, 32 plants containing DHX two-base deletion, 48 plants containing NIP wild type and 112 plants heterozygous were identified. After the plants in the population begin to heading, the situation of heading of the plants is investigated every day, heading date is recorded until heading is completed for all identified plants, three plants are not survived, and finally 189 single plants are obtained. Subsequently, we compare the contributions of DHX, NIP and heterozygous genotypes to the heading stage traits, find that the average value of the heading stage of the plants containing DHX type variation is 73 days, the standard deviation is 3.2 days, the average value of the heading stage of the plants containing NIP type variation is 88 days, the standard deviation is 3.5 days, the average value of the heading stage of heterozygous plants is 82 days, the standard deviation is 4.7 days, and this result again proves that the four-primer mark can be used for predicting the fertility stage in the seedling stage, so that the cost for manually investigating the fertility stage is reduced. The marker combination adopted by the invention can finish rapid identification of thousands of single plants within two days, has extremely high flux and has popularization and use values.
It should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present invention may be modified or substituted without departing from the spirit and scope of the technical solution of the present invention, which is intended to be covered in the scope of the claims of the present invention.

Claims (5)

1. A method for screening rice growth period, which is characterized in that: the method comprises the following steps:
preparing an amplification template: rice DNA;
preparing an amplification system: preparing a DNA template, 2X TAQ MASTER Mix 10ul, 0.5ul of each primer and DD water;
and (2) PCR: performing PCR operation, and performing denaturation, annealing and derivatization steps;
agarose gel electrophoresis: agarose gel electrophoresis is carried out on the PCR product;
and (3) shooting and comparing: photographing the agarose gel electrophoresis result, and comparing the gel pictures;
in the preparation amplification system, the primer comprises one or more of the following primers:
YYP1Hd1-1：TGCCTCTGCATACGCCTTTC
YYP1Hd1-2：GACAATACGTTATGAAACAAGG
YYP1Hd1-3：TGACCATTTGCCGATTCCAT
YYP1Hd1-4：AGCTACCGTCAGATAGAGCTGC
YYP1Hd1-5：GACAATACGTTATGAAACAAGGC
YYP1Hd1-6：CATTTGCCGATTCCATCTCA
YYP1Hd1-7：TATTGCTACTCAGTAAGTCCCC
DHXHd1-1：TACCCGCCTCCATTGATGACAG
DHXHd1-2：GCCGATTCCATCTCAGATATCGTT
DHXHd1-3：GTATTGTCTTCTCAAACTTCCT
DHXHd1-4：TTTGCGACAGTAAAAAAGAT
the rice is YYP, nip and flower fragrance DHX rice;
When differentiating NIP from YYP type 1 variants, the primers used were YYP Hd1-1, YYP Hd1-5, YYP Hd1-6 and YYP1Hd1-7;
when differentiating NIP from YYP type 1 variants, the primers used were YYP Hd1-1, YYP Hd1-2, YYP Hd1-6, YYP1Hd1-7;
when distinguishing between DHX and NIP type variants, the primers used were DHXHd1-1, DHXHd1-2, DHXHd1-3, DHXHd1-4.
2. The method for screening rice for growth period according to claim 1, wherein: in the preparation of the amplification system, the amplification system is 20 ul.
3. The method for screening rice for growth period according to claim 1, wherein: the PCR cycle is denaturation at 94 ℃ for 3min, annealing for 30s, extension at 72 ℃ for 20s, the cycle times are 35, and finally the PCR is completed at 72 ℃ for 5 min.
4. The method for screening rice for growth period according to claim 1, wherein: when YYP Hd1-1, YYP Hd1-2, YYP Hd1-6, YYP Hd1-7 were used as primers, the annealing temperature was 57.5℃or less and 61.4℃or less.
5. The method for screening rice for growth period according to claim 1, wherein: the used primers are DHXHd1-1, DHXHd1-2, DHXHd1-3 and DHXHd1-4, and the annealing temperature is more than or equal to 48 ℃ and less than or equal to 58 ℃.
CN202111443502.8A 2021-11-30 2021-11-30 Method for screening rice growth period Active CN113981130B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111443502.8A CN113981130B (en) 2021-11-30 2021-11-30 Method for screening rice growth period

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111443502.8A CN113981130B (en) 2021-11-30 2021-11-30 Method for screening rice growth period

Publications (2)

Publication Number Publication Date
CN113981130A CN113981130A (en) 2022-01-28
CN113981130B true CN113981130B (en) 2024-04-26

Family

ID=79732727

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111443502.8A Active CN113981130B (en) 2021-11-30 2021-11-30 Method for screening rice growth period

Country Status (1)

Country Link
CN (1) CN113981130B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104531693A (en) * 2014-12-31 2015-04-22 广西壮族自治区农业科学院水稻研究所 Specificity functional marker for rice sterility gene pms3 and application of specificity functional marker
CN105734056A (en) * 2016-03-31 2016-07-06 中国水稻研究所 Molecular markers of major QTL for rice heading period and application of molecular marker
CN113684290A (en) * 2020-05-19 2021-11-23 中国农业科学院作物科学研究所 Application of long-day-length gene variation inhibitor in cultivation of cultivated rice

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104531693A (en) * 2014-12-31 2015-04-22 广西壮族自治区农业科学院水稻研究所 Specificity functional marker for rice sterility gene pms3 and application of specificity functional marker
CN105734056A (en) * 2016-03-31 2016-07-06 中国水稻研究所 Molecular markers of major QTL for rice heading period and application of molecular marker
CN113684290A (en) * 2020-05-19 2021-11-23 中国农业科学院作物科学研究所 Application of long-day-length gene variation inhibitor in cultivation of cultivated rice

Also Published As

Publication number Publication date
CN113981130A (en) 2022-01-28

Similar Documents

Publication Publication Date Title
CN109825621B (en) Wheat spikelet number QTL (quantitative trait locus) linked SNP (single nucleotide polymorphism) molecular marker and application thereof
CN110295251B (en) SNP molecular marker linked with wheat effective tillering number QTL and application thereof
CN112725503B (en) Molecular marker closely linked with hypocotyl color related gene of American pumpkin and application
CN110747288A (en) Rice large grain gene function marker and application
CN111893209A (en) Detection marker for insertion deletion site related to thousand grain weight of wheat and application of detection marker
CN109609687B (en) KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof
CN108476970B (en) Molecular marker assisted method for quickly reducing included angle of corn leaves to improve Beijing agriculture 728 plant type
CN113881801A (en) Molecular marker composition with tightly linked dark green stem characters of American pumpkin and application thereof
CN113549616A (en) CAPS molecular marker for identifying oncidium hybridum variety, screening method and application
Yu et al. Simultaneously mapping loci related to two plant architecture traits by phenotypic recombination BSA/BSR in peanut (Arachis hypogaea L.)
CN113981130B (en) Method for screening rice growth period
CN116516054A (en) SNP molecular marker related to cabbage type rape dwarf trait and application thereof
CN114717354B (en) Molecular marker combination, primer set, kit, identification method and application for identifying asparagus super-male plants
CN110616277A (en) Rice grain length gene function marker and application thereof
CN110468229A (en) Rice wide spectrum high resistance to hoja blanca gene Xa45's (t) isolates molecular labeling Hxjy-1
CN114164294B (en) SNP locus related to green keeping property of Chinese cabbage and application thereof
AU2021102921A4 (en) Molecular marker for rapidly detecting high-yield gene of elytrigia elongata and application
CN106399495B (en) SNP marker closely linked with soybean short stalk character and application thereof
CN110643728B (en) Method for improving breeding efficiency of poplar crossbreeding
CN108588261A (en) A kind of identification is located at InDel primers and its application of the late bolting QTL on radish R02 chromosomes
CN111826457B (en) Molecular marker SNP#2 for identifying powdery mildew resistance phenotype of mung beans, and primers and application thereof
CN114350839A (en) Hd1-Indel molecular marker of rice photosensitive gene and application thereof
CN111826456B (en) Molecular marker SNP #1 for identifying powdery mildew resistance phenotype of mung bean, and primer and application thereof
CN111826454B (en) Molecular marker VrMLO _ Indel2 for identifying powdery mildew resistance phenotype of mung beans as well as primer and application thereof
CN111826455B (en) Molecular marker VrMLO _ Indel1 for identifying powdery mildew resistance phenotype of mung beans as well as primer and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant