CN114214261B - Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof - Google Patents

Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof Download PDF

Info

Publication number
CN114214261B
CN114214261B CN202111589724.0A CN202111589724A CN114214261B CN 114214261 B CN114214261 B CN 114214261B CN 202111589724 A CN202111589724 A CN 202111589724A CN 114214261 B CN114214261 B CN 114214261B
Authority
CN
China
Prior art keywords
ests
escherichia coli
fluoro
chroman
carboxylic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111589724.0A
Other languages
Chinese (zh)
Other versions
CN114214261A (en
Inventor
高蓓
魏东芝
王风清
江敏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Original Assignee
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology filed Critical East China University of Science and Technology
Priority to CN202111589724.0A priority Critical patent/CN114214261B/en
Publication of CN114214261A publication Critical patent/CN114214261A/en
Application granted granted Critical
Publication of CN114214261B publication Critical patent/CN114214261B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
    • C12P41/003—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by ester formation, lactone formation or the inverse reactions
    • C12P41/005—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by ester formation, lactone formation or the inverse reactions by esterification of carboxylic acid groups in the enantiomers or the inverse reaction

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses an escherichia coli genetic engineering bacterium for expressing esterase EstS, which is prepared by cloning a target fragment with an EstS gene sequence shown as SEQ ID NO.3 into an expression vector and then transforming the target fragment into competent cells of escherichia coli BL21 (DE 3). The invention discloses application of escherichia coli genetic engineering bacteria expressing esterase EstS. The invention also discloses a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by microbial enzymatic resolution, which takes the escherichia coli genetic engineering bacteria expressing esterase EstS as a catalyst and takes raceme 6-fluoro-chroman-2-carboxylic acid methyl ester as a substrate for reaction, and the method provides excellent stereoselectivity. Meanwhile, the invention realizes the preparation of (S) -6-fluoro-chroman-2-carboxylic acid by utilizing esterase EstS resolution for the first time.

Description

Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof
Technical Field
The invention belongs to the technical field of pharmaceutical biochemistry, and in particular relates to escherichia coli genetic engineering bacteria expressing esterase EstS and a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by splitting the escherichia coli genetic engineering bacteria.
Background
6-fluoro-chroman-2-carboxylic acids are important pharmaceutical intermediates. The chemical name is 6-fluoro-3, 4-dihydro-2H-1-benzopyran-2-carboxylic acid, and the chemical formula is C 10 H 9 O 3 F has a molecular weight of 196.18 and a structural formula:
the presence of the chroman building block of 6-fluoro-chroman can be found in many molecular structures with biological activity. For example, this structure is widely included in vitamin E and many antihypertensive agents that antagonize the beta receptor. Optically pure 6-fluoro-chroman-2-carboxylic acid is used for the synthesis of novel antihypertensive drugs (S, R) -nebivolol. The (S, R, R, R) -nebivolol is a third-generation heart highly-selective beta 1 receptor blocker with vasodilation effect, is mainly used for treating primary hypertension, can effectively control the hypertension and maintain the left ventricle function, and has the advantages of low dosage, less side effect, good tolerance and the like.
The 6-fluoro-chroman-2-carboxylic acid is a key intermediate for the preparation of nebivolol, and its resolution efficiency determines the final result of the synthetic process for the preparation of nebivolol. However, there are few reports about the method for resolving the (R) -, (S) -optical isomer of 6-fluoro-chroman-2-carboxylic acid. Heretofore, chemical methods, biological resolution methods, and the like have been several common methods for resolving organic acids. The resolution of racemic 6-fluoro-3, 4-dihydro-2H-1-benzopyran-2-carboxylic acid using dehydroabietylamine has been reported in the literature and the overall resolution yield has been experimentally demonstrated to be about 32%. The chemical resolution method has the advantages of longer process, expensive dehydroabietylamine chiral resolution reagent and low efficiency. EP2646426 reports the resolution of racemic ethyl 6-fluoro-chroman-2-carboxylate by means of esterases derived from the fungus Ophiosoma novo-ulmi, which yields (R) -6-fluoro-chroman-2-carboxylic acid by isolation and purification with an ee value of 90.72% and a conversion of 50.28%. The method is simple and convenient to operate and mild in condition. But the stereoselectivity is not high.
At present, the method on the market mainly utilizes lipase or esterase to split and prepare (R) -6-fluoro-chroman-2-carboxylic acid, and no report on the preparation of (S) -6-fluoro-chroman-2-carboxylic acid by utilizing lipase or esterase in a splitting way exists in the literature, so that other lipases/esterases with high activity and high stereoselectivity are needed to be found. Based on this, the present invention developed a process for the resolution preparation of (S) -6-fluoro-chroman-2-carboxylic acid by S-esterase.
Disclosure of Invention
The invention uses raceme 6-fluoro-chroman-2-carboxylic acid methyl ester as a substrate, uses isolated esterase EstS or freeze-dried bacterial cells (fdcEstS) of recombinant escherichia coli for efficiently expressing EstS as a catalyst, selectively catalyzes hydrolysis reaction of (S) -6-fluoro-chroman-2-carboxylic acid methyl ester, thereby preparing optically pure (S) -6-fluoro-chroman-2-carboxylic acid, and has high conversion rate and strong three-dimensional rotation. It is therefore a first object of the present invention to provide a genetically engineered E.coli strain expressing the esterase EstS. The second object of the invention is to provide an application of the escherichia coli genetically engineered bacterium for expressing esterase EstS. The third object of the invention is to provide a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by microbial enzymatic resolution.
In order to achieve the above purpose, the invention adopts the following technical scheme:
as a first aspect of the invention, an E.coli genetically engineered bacterium expressing esterase EstS is prepared by cloning a target fragment having an EstS gene sequence as shown in SEQ ID NO.3 into an expression vector to obtain a recombinant plasmid, and then transforming the recombinant plasmid into competent cells of E.coli BL21 (DE 3).
According to the invention, the expression vector is a pET-28a (+) expression vector.
As a second aspect of the present invention, a method for preparing a genetically engineered bacterium of E.coli expressing esterase EstS, comprising the steps of:
step one, extracting genome DNA of bacillus thermochains Geobacillus thermocatenulatus strain BGSC A1;
designing an upstream primer and a downstream primer by using an EstS sequence of the bacillus thermochainanensis, wherein the upstream primer sequence is shown as SEQ ID NO.1, and the downstream primer sequence is shown as SEQ ID NO. 2;
step three, performing PCR amplification by taking the genome DNA of the Geobacillus thermochainanensis Geobacillus thermocatenulatus strain BGSC A1 in the step one as a template to obtain a target DNA fragment, wherein the sequence of the target DNA fragment is shown as SEQ ID NO. 3;
cloning the target DNA fragment to a pET-28a (+) expression vector to obtain a recombinant plasmid;
and fifthly, transforming the recombinant plasmid into competent cells of escherichia coli BL21 (DE 3) to obtain a recombinant strain.
As a third aspect of the present invention, a recombinant plasmid containing the esterase EstS gene is prepared by cloning a desired fragment having the sequence of the EstS gene shown in SEQ ID NO.3 into an expression vector.
According to the invention, the expression vector is a pET-28a (+) expression vector.
As a fourth aspect of the present invention, a method for preparing a recombinant plasmid containing an esterase EstS gene, comprising the steps of:
step one, extracting genome DNA of bacillus thermochains Geobacillus thermocatenulatus strain BGSC A1;
designing an upstream primer and a downstream primer by using an EstS sequence of the bacillus thermochainanensis, wherein the upstream primer sequence is shown as SEQ ID NO.1, and the downstream primer sequence is shown as SEQ ID NO. 2;
step three, performing PCR amplification by taking the genome DNA of the Geobacillus thermochainanensis Geobacillus thermocatenulatus strain BGSC A1 in the step one as a template to obtain a target DNA fragment, wherein the sequence of the target DNA fragment is shown as SEQ ID NO. 3;
cloning the target DNA fragment to a pET-28a (+) expression vector to obtain a recombinant plasmid.
And fifthly, transforming the recombinant plasmid into competent cells of escherichia coli BL21 (DE 3) to obtain a recombinant strain.
As a fifth aspect of the present invention, an esterase EstS gene having the sequence of the EstS gene shown in SEQ ID NO. 3.
As a sixth aspect of the present invention, a method for producing an esterase EstS gene, comprising the steps of:
step one, extracting genome DNA of bacillus thermochains Geobacillus thermocatenulatus strain BGSC A1;
designing an upstream primer and a downstream primer by using an EstS sequence of the bacillus thermochainanensis, wherein the upstream primer sequence is shown as SEQ ID NO.1, and the downstream primer sequence is shown as SEQ ID NO. 2;
and thirdly, performing PCR amplification by taking the genome DNA of the Geobacillus thermochainanensis Geobacillus thermocatenulatus strain BGSC 93A1 in the first step as a template to obtain a target DNA fragment, wherein the sequence of the target DNA fragment is shown as SEQ ID NO. 3.
As a seventh aspect of the invention, an E.coli genetically engineered bacterium expressing esterase EstS as described above is used in a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution.
Further, an E.coli genetically engineered bacterium expressing esterase EstS as described above is used as a catalyst in a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution.
As an eighth aspect of the present invention, a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by microbial enzymatic resolution, which comprises using the above-mentioned Escherichia coli genetically engineered bacterium expressing esterase EstS as a catalyst, using racemic 6-fluoro-chroman-2-carboxylic acid methyl ester as a substrate, adding an organic solvent into a buffer solution having a pH of 6.0-8.5, reacting at 20-60 ℃ for 1-12 hours, and then separating and purifying.
Preferably, the pH is 7.0.
According to the invention, the organic solvent is one of isopropanol, butanol, toluene, n-hexane, n-heptane or isooctane.
Preferably, the organic solvent is toluene.
According to the invention, the volume percentage of toluene is 10-50%.
Preferably, the volume percentage of toluene is 20-30%.
According to the invention, the concentration of the escherichia coli genetically engineered bacterium expressing esterase EstS is 10g/L, and the concentration of the racemic 6-fluoro-chroman-2-carboxylic acid methyl ester is 100-30OmM.
Preferably, the concentration of the racemic 6-fluoro-chroman-2-carboxylic acid methyl ester is 200mM.
According to the invention, after the reaction is finished, escherichia coli genetic engineering bacteria expressing esterase EstS are removed by adopting a filtering method, after the pH is adjusted to 11-12 by adding 5M sodium hydroxide solution, an organic phase and a water phase are separated, then hydrochloric acid solution is added into the water phase to adjust the pH to 1-2, ethyl acetate is used for extraction for 3 times, and solvent is removed by rotary evaporation, so that (S) -6-fluoro-chroman-2-carboxylic acid white solid is obtained.
The escherichia coli genetic engineering bacterium for expressing esterase EstS has the beneficial effects that: 1. can be used as a catalyst in a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution, so that the method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution can provide higher stereoselectivity; 2. the preparation of (S) -6-fluoro-chroman-2-carboxylic acid by utilizing esterase EstS resolution is realized for the first time, and the method has good application prospect.
The method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by microbial enzyme method resolution has the beneficial effects that: the conversion rate is more than 46%, the ee value is 95-96%, and the method has the characteristics of high reaction efficiency, high stereoselectivity, relatively simple process and the like.
Drawings
FIG. 1 shows the effect of organic solvent ratio on the reaction.
FIG. 2 is a graph showing the effect of temperature on the reaction.
FIG. 3 is a graph showing the effect of pH on the reaction.
FIG. 4 is a liquid phase diagram of (S) -6-fluoro-chroman-2-carboxylic acid.
Detailed Description
The invention will be further illustrated with reference to specific examples. It should be understood that the following examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally performed under conventional conditions, or conditions supplied by the manufacturer.
Example 1 construction of E.coli genetically engineered bacteria and efficient expression of esterase EstS
1. The Geobacillus thermochainanensis Geobacillus thermocatenulatus strain BGSC A1 was resuscitated using a medium (Peptone 5g,Meat extract 3g, distilled water 1L), cultured aerobically in a shaking table at a constant temperature of 60℃for 12 hours, and the bacterial concentration was measured using an ultraviolet spectrophotometer.
2. Bacterial DNA extraction was performed using a bacterial genomic DNA rapid extraction kit (general Biotech, shanghai, china) to obtain Geobacillus thermocatenulatus genomic DNA.
3. Primers were designed based on the esterase EstS gene sequence of strain Geobacillus thermocatenulatus, and the upstream and downstream primers were designed as follows:
an upstream primer: 5' CGCGGATCCATGGTCATTGTTGAAACAGA 3', SEQ ID NO.1, wherein the underlined part is a BamHI recognition site;
a downstream primer: 5' CGCAAGCTTTTACACATGCTCGCGAAACC 3', SEQ ID NO.2, wherein the underlined part is a HindIII recognition site;
4. then, using genome DNA of Geobacillus thermochains Geobacillus thermocatenulatus as a template, and performing gene amplification by Polymerase Chain Reaction (PCR) to obtain a PCR product containing esterase EstS full-length gene, wherein the nucleotide sequence is shown as SEQ ID NO.3, and the amino acid sequence is shown as SEQ ID NO. 4. Wherein, the PCR amplification system is Primer STAR Max 25 mu L; 1.5. Mu.L each of the forward primer and the reverse primer; 22 mu L of water; template 0.5. Mu.L.
Nucleotide sequence:
ATGGTCATTGTTGAAACAGAACGGCTGGCTGATGTGCCGGTGCTTCATGTTGTCAAGCCGGAAAAGCGGGACGCACGGCTGCCGCTCATTTTCTTTATTCACGGCTTTACAAGCGCGAAAGAGCATAATTTGCATTTCGGCTACTTGCTTGCCGAGGCAGGCTATCGCGTTGTGCTTCCCGACGCGCTGTTTCACGGCGAGCGGGACGAAGGTTTGAGCGAGCGGAAATTGCAGCTGTCGTTTTGGGACATTGTCGTGCGCACGATCACCGAAATCGAGGAGATGAAAAACGACCTTGTCAGCCGCGGGCTGGCTGACCAAGAACGGATTGGGCTCGCTGGGACATCGATGGGCGGCATCGTCACATTCGGCGCGCTCGCCGTCTATCCGTGGGTGAAGGCGGCGGTGGCGCTTATGGGCTGCCCGAACTACAGCGCCTTTTTTGACGCGATGATGGAAGAAGCGAAGCGGCGTCAGATCGACATCCCGATGCCGCCGACGCTGTTGGCGCTTGAAAGAGAAAAGCTCGCTCGCTACGATTTATCCAAGCAGCCGGAAACACTCGCCGGGCGGCCGTTGTTCATCTGGCACGGGAAAGCCGACCAAGTCGTCCCGTATAGTTATACATATGAATTTTACCAGCAAATTAAGCCGCTTTATGAAGGAAACGAAGACCGGCTGCAATTCATCGCCGACCCGCACGCCGGCCATAAAGTGACGCGCGAGGCGTTTTTGGAAACGGTGCGCTGGTTTCGCGAGCATGTGTAA，SEQ ID NO.3。
amino acid sequence:
MVIVETERLADVPVLHVVKPEKRDARLPLIFFIHGFTSAKEHNLHFGYLLAEAGYRVVLPDALFHGERDEGLSERKLQLSFWDIVVRTITEIEEMKNDLVSRGLADQERIGLAGTSMGGIVTFGALAVYPWVKAAVALMGCPNYSAFFDAMMEEAKRRQIDIPMPPTLLALEREKLARYDLSKQPETLAGRPLFIWHGKADQVVPYSYTYEFYQQIKPLYEGNEDRLQFIADPHAGHKVTREAFLETVRWFREHV，SEQ ID NO.4。
5. the pET-28a (+) empty plasmid, and the gene with BamHI and HindIII cleavage sites obtained in step 4 (sequence shown in SEQ ID NO. 3) were double digested with BamHI and HindIII, respectively. The large fragment is recovered, the large fragment is connected by T4DNA ligase, the escherichia coli BL21 is transformed by a heat shock method, LB solid medium containing 50 mug/mL kanamycin is used for screening, positive clone is selected by a PCR method, positive clone plasmid is extracted by a kit, and correct clone plasmid is obtained by gene sequencing identification, so that esterase EstS gene engineering strain lycEstS is constructed.
6. The positive recombinant strain (esterase EstS gene engineering strain lycEstS of step 5) was inoculated in 5mL LB medium containing 50. Mu.g/mL kanamycin for overnight culture at 37℃and then inoculated in 50mL fresh LB medium containing 50. Mu.g/mL kanamycin for continuous propagation at 1% transfer, when OD600 reached 0.6-0.8, IPTG was added to a final concentration of 0.1mM. After induction for 16-18 hours at 20 ℃, centrifugally collecting thalli, and then putting the thalli into a freeze dryer for freezing for 12 hours to prepare freeze-dried bacterial powder for storage in a refrigerator for standby.
Example 2 separation and purification of (S) -6-fluoro-chroman-2-carboxylic acid and liquid phase detection method
The hydrolysis kinetics resolution of (+ -) -6-fluoro-chroman-2-carboxylic acid methyl ester was performed with the lyophilized powder (lycEstS) prepared in example 1 in 0.1M phosphate buffer, but no good activity and selectivity was observed. Thus, the reaction is carried out in a biphasic system comprising different organic solvents (organic solvent and phosphate buffer).
After the reaction is finished, removing thalli by adopting a filtering method, adding 5M sodium hydroxide solution to adjust the pH to 11-12, separating an organic phase and a water phase, adding hydrochloric acid solution to adjust the pH to 1-2 in the water phase, extracting for 3 times by using ethyl acetate, and evaporating to remove a solvent by rotary evaporation to obtain (S) -6-fluoro-chroman-2-carboxylic acid white solid. High performance liquid chromatography (chiral column: chirasil-AD-H) analysis was performed to determine substrate conversion and ee value of the product. The specific analysis conditions are as follows: the column temperature was 25℃and the mobile phase was n-hexane to isopropanol (90:10), flow rate was 1.0mL/mL, detection wavelength was 254nm.
EXAMPLE 3 investigation of conditions for the preparation of (S) -6-fluoro-chroman-2-carboxylic acid with lyophilized E.coli cells (lycEstS) as catalyst
The reaction system comprises: thallus, (±) -6-fluoro-chroman-2-carboxylic acid methyl ester, organic solvent, reaction temperature, reaction time, reaction pH, substrate concentration, buffer, (±) -6-fluoro-chroman-2-carboxylic acid methyl ester, i.e. substrate.
The recombinant E.coli cells (esterase EstS genetic engineering strain in step 5) in the above example 1 are taken as enzyme sources, and factors such as selection of organic solvent, addition ratio of the organic solvent, reaction temperature, reaction pH, substrate concentration and the like are examined to improve the space-time yield of the target product (S) -6-fluoro-chroman-2-carboxylic acid.
1. Investigating the influence of the selected organic solvent on the reaction
In a reaction system of 10mL, the concentration of the thallus is 10g/L; (±) -6-fluoro-chroman-2-carboxylic acid methyl ester was used in an amount of 100mM; the ratio of organic solvent to PB Buffer (pH 7.4) was 1:4; the reaction temperature is 30 ℃; the reaction time was 6h. The organic solvent selected includes isopropanol, butanol, toluene, n-hexane, n-heptane, and isooctane. The results are shown in Table 1.
TABLE 1 influence of organic solvents on the reaction
Organic solvents log P Conversion (%) ee(％)
Isopropyl alcohol 0.38 65.3 21.3
Butanol (Butanol) 0.88 10.2 2.7
Toluene (toluene) 2.5 46.6 99.0
N-hexane 3.5 38.4 81.4
N-heptane 4.0 71.7 27.5
Isooctane 4.5 87.8 24.6
The results show that: in the selected organic solvent, the toluene conversion rate and the ee value are good.
2. The effect of toluene and PB Buffer (pH 7.4) on the reaction was examined.
In a reaction system of 10mL, the concentration of the thallus is 10g/L; (±) -6-fluoro-chroman-2-carboxylic acid methyl ester was used in an amount of 100mM; the reaction temperature is 30 ℃; the reaction pH was 7.4; the reaction time was 6h. The proportion of toluene selected to the total volume was 10%, 20%, 30%, 40%,50% (v/v). The results are shown in FIG. 1.
The results in FIG. 1 show that the ee values were good for toluene at 20% and 30% volume ratios.
3. The effect of temperature on the reaction was examined.
In a reaction system of 10mL, the concentration of the thallus is 10g/L; (±) -6-fluoro-chroman-2-carboxylic acid methyl ester was used in an amount of 100mM; the ratio of toluene to PB Buffer (pH 7.4) was 1:3; the reaction time was 6h. The reaction temperature is selected to be 20-60 ℃. The results are shown in FIG. 2.
The results in FIG. 2 show that both the ee and the conversion are good at reaction temperatures of 30℃and 40 ℃.
4. The effect of pH on the reaction was examined.
In a reaction system of 10mL, the concentration of the thallus is 10g/L; (±) -6-fluoro-chroman-2-carboxylic acid methyl ester was used in an amount of 100mM; the ratio of toluene to Buffer was 1:3; the reaction time was 6h. The reaction pH selected was 6, 6.5, 7, 7.5, 8, 8.5. The results are shown in FIG. 3.
The results in FIG. 3 show that both the ee and conversion are good when the reaction pH is 7.0.
5. The effect of substrate concentration on the reaction was examined. In a 10mL reaction system, the ratio of toluene to Buffer is 1:3; the reaction temperature is 30 ℃; the reaction pH was 7.0. The substrate concentrations selected were 100, 200, 300, 400mM. The results are shown in Table 2.
TABLE 2 influence of substrate concentration on the reaction
Substrate concentration Reaction time Conversion (%) ee(％)
100mM 1.5h 48.9 99.2
200mM 4h 49.1 99.1
300mM 6h 45.7 98.8
400mM 8h 38.0 98.5
The results in Table 2 show that both the conversion and the ee value are good at substrate concentrations of 100mM, 200mM and 300 mM.
Example 4
Using colibacillus thallus (esterase EstS gene engineering strain in step 5) as enzyme source, and producing (S) -6-fluoro-chroman-2-carboxylic acid by splitting (+ -) -6-fluoro-chroman-2-carboxylic acid methyl ester by enzyme method
According to the optimal resolution conditions determined in example 3, 2g of cells (. + -.) -6-fluoro-chroman-2-carboxylic acid methyl ester 200mM, toluene to PB Buffer (pH 7.0) ratio of 1:3 was added to 0.2 liter of the reaction solution using the lyophilized E.coli cells of example 1 as a catalyst; the reaction temperature is 30 ℃, the conversion time is 6 hours, and the hydrolysis resolution of (+ -) -6-fluoro-chroman-2-carboxylic acid methyl ester is carried out. The liquid phase diagram of (S) -6-fluoro-chroman-2-carboxylic acid is shown in FIG. 4 by using the separation and purification method of (S) -6-fluoro-chroman-2-carboxylic acid of example 2 and the liquid phase detection method.
As a result, the content of (S) -6-fluoro-chroman-2-carboxylic acid was measured to be 89.3mM; the conversion was 46.9%; the ee value was 99.07%.
The foregoing is merely illustrative of embodiments of this invention and it will be appreciated by those skilled in the art that changes and modifications may be made without departing from the principles of the invention, which is also intended to be within the scope of the invention.
Sequence listing
<110> university of Industy of Huadong
<120> an E.coli genetically engineered bacterium expressing esterase EstS and application thereof
<130> 211157
<141> 2021-12-23
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cgcggatcca tggtcattgt tgaaacaga 29
<210> 2
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
cgcaagcttt tacacatgct cgcgaaacc 29
<210> 3
<211> 768
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atggtcattg ttgaaacaga acggctggct gatgtgccgg tgcttcatgt tgtcaagccg 60
gaaaagcggg acgcacggct gccgctcatt ttctttattc acggctttac aagcgcgaaa 120
gagcataatt tgcatttcgg ctacttgctt gccgaggcag gctatcgcgt tgtgcttccc 180
gacgcgctgt ttcacggcga gcgggacgaa ggtttgagcg agcggaaatt gcagctgtcg 240
ttttgggaca ttgtcgtgcg cacgatcacc gaaatcgagg agatgaaaaa cgaccttgtc 300
agccgcgggc tggctgacca agaacggatt gggctcgctg ggacatcgat gggcggcatc 360
gtcacattcg gcgcgctcgc cgtctatccg tgggtgaagg cggcggtggc gcttatgggc 420
tgcccgaact acagcgcctt ttttgacgcg atgatggaag aagcgaagcg gcgtcagatc 480
gacatcccga tgccgccgac gctgttggcg cttgaaagag aaaagctcgc tcgctacgat 540
ttatccaagc agccggaaac actcgccggg cggccgttgt tcatctggca cgggaaagcc 600
gaccaagtcg tcccgtatag ttatacatat gaattttacc agcaaattaa gccgctttat 660
gaaggaaacg aagaccggct gcaattcatc gccgacccgc acgccggcca taaagtgacg 720
cgcgaggcgt ttttggaaac ggtgcgctgg tttcgcgagc atgtgtaa 768
<210> 4
<211> 255
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
Met Val Ile Val Glu Thr Glu Arg Leu Ala Asp Val Pro Val Leu His
1 5 10 15
Val Val Lys Pro Glu Lys Arg Asp Ala Arg Leu Pro Leu Ile Phe Phe
20 25 30
Ile His Gly Phe Thr Ser Ala Lys Glu His Asn Leu His Phe Gly Tyr
35 40 45
Leu Leu Ala Glu Ala Gly Tyr Arg Val Val Leu Pro Asp Ala Leu Phe
50 55 60
His Gly Glu Arg Asp Glu Gly Leu Ser Glu Arg Lys Leu Gln Leu Ser
65 70 75 80
Phe Trp Asp Ile Val Val Arg Thr Ile Thr Glu Ile Glu Glu Met Lys
85 90 95
Asn Asp Leu Val Ser Arg Gly Leu Ala Asp Gln Glu Arg Ile Gly Leu
100 105 110
Ala Gly Thr Ser Met Gly Gly Ile Val Thr Phe Gly Ala Leu Ala Val
115 120 125
Tyr Pro Trp Val Lys Ala Ala Val Ala Leu Met Gly Cys Pro Asn Tyr
130 135 140
Ser Ala Phe Phe Asp Ala Met Met Glu Glu Ala Lys Arg Arg Gln Ile
145 150 155 160
Asp Ile Pro Met Pro Pro Thr Leu Leu Ala Leu Glu Arg Glu Lys Leu
165 170 175
Ala Arg Tyr Asp Leu Ser Lys Gln Pro Glu Thr Leu Ala Gly Arg Pro
180 185 190
Leu Phe Ile Trp His Gly Lys Ala Asp Gln Val Val Pro Tyr Ser Tyr
195 200 205
Thr Tyr Glu Phe Tyr Gln Gln Ile Lys Pro Leu Tyr Glu Gly Asn Glu
210 215 220
Asp Arg Leu Gln Phe Ile Ala Asp Pro His Ala Gly His Lys Val Thr
225 230 235 240
Arg Glu Ala Phe Leu Glu Thr Val Arg Trp Phe Arg Glu His Val
245 250 255

Claims (8)

1. The application of the escherichia coli genetic engineering bacteria expressing esterase EstS in the method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution is characterized in that the escherichia coli genetic engineering bacteria expressing esterase EstS is expressed as SEQ ID NO.3EstSCloning the gene sequence into an expression vector to obtain a recombinant plasmid, and then transforming the recombinant plasmid into competent cells of escherichia coli BL21 (DE 3) to prepare the recombinant plasmid.
2. The use according to claim 1, wherein the expression vector is a pET-28a (+) expression vector.
3. The application of the escherichia coli genetic engineering bacteria expressing esterase EstS as a catalyst in a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution is characterized in that the escherichia coli genetic engineering bacteria expressing esterase EstS are prepared by using a method shown as SEQ ID NO.3EstSCloning the gene sequence into an expression vector to obtain a recombinant plasmid, and then transforming the recombinant plasmid into competent cells of escherichia coli BL21 (DE 3) to prepare the recombinant plasmid.
4. The use according to claim 3, wherein the expression vector is a pET-28a (+) expression vector.
5. A method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by microbial enzyme method resolution is characterized in that escherichia coli genetic engineering bacteria expressing esterase EstS are used as catalysts, racemized 6-fluoro-chroman-2-carboxylic acid methyl ester is used as a substrate, organic solvent is added into buffer solution with pH of 6.0-8.5, reaction is carried out for 1-12 hours at the temperature of 20-60 ℃, and then separation and purification are carried out;
wherein the escherichia coli genetic engineering bacteria expressing esterase EstS are expressed as shown in SEQ ID NO.3EstSCloning the gene sequence into an expression vector to obtain a recombinant plasmid, and then transforming the recombinant plasmid into competent cells of escherichia coli BL21 (DE 3) to prepare the recombinant plasmid.
6. The method of claim 5, wherein the expression vector is a pET-28a (+) expression vector.
7. The method of claim 5, wherein the organic solvent is one of isopropanol, butanol, toluene, n-hexane, n-heptane, or isooctane.
8. The method according to claim 5, wherein the separation and purification are carried out by removing escherichia coli genetically engineered bacteria expressing esterase EstS by filtration, adding 5M sodium hydroxide solution to adjust pH to 11-12, separating organic phase and aqueous phase, adding hydrochloric acid solution to adjust pH to 1-2 in aqueous phase, extracting with ethyl acetate for 3 times, evaporating solvent by rotary evaporation, and obtaining (S) -6-fluoro-chroman-2-carboxylic acid white solid.
CN202111589724.0A 2021-12-23 2021-12-23 Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof Active CN114214261B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111589724.0A CN114214261B (en) 2021-12-23 2021-12-23 Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111589724.0A CN114214261B (en) 2021-12-23 2021-12-23 Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof

Publications (2)

Publication Number Publication Date
CN114214261A CN114214261A (en) 2022-03-22
CN114214261B true CN114214261B (en) 2024-04-09

Family

ID=80705319

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111589724.0A Active CN114214261B (en) 2021-12-23 2021-12-23 Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof

Country Status (1)

Country Link
CN (1) CN114214261B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110791488A (en) * 2019-12-05 2020-02-14 西南交通大学 Lipase for splitting chiral compound and preparation method and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110791488A (en) * 2019-12-05 2020-02-14 西南交通大学 Lipase for splitting chiral compound and preparation method and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Eunhye Jo等.Identification and characterization of a novel thermostable GDSL-type lipase from Geobacillus thermocatenulatus.J Microbiol Biotechnol..2021,第31卷(第3期),483-491. *
Lee,Y.-J.等.GenBank: AST00345.1.GenBank.2017,FEATURES,ORIGIN . *
Lee,Y.-J.等.GenBank: CP018058.1.GenBank.2017,FEATURES,ORIGIN . *
Min Jiang等.Sequential resolution of (S) and (R)-6- fl uoro- chroman-2-carboxylic acid by two esterases in turn. (S)-6-fluorochroman-2-carboxylic acid.2022,第24卷3235–3242. *

Also Published As

Publication number Publication date
CN114214261A (en) 2022-03-22

Similar Documents

Publication Publication Date Title
CN107858340B (en) High-catalytic-activity D-fructose-6-phosphate aldolase A mutant, recombinant expression vector, genetically engineered bacterium and application thereof
CN109055324B (en) Improved ketoreductase and application thereof
EP3591062A1 (en) Long-chain dibasic acid with low content of hydroxyl acid impurity and production method thereof
CN111454918B (en) Enol reductase mutant and application thereof in preparation of (R) -citronellal
CN111004787B (en) Streptomyces phospholipase D mutant, transformation method and application thereof
CN114214261B (en) Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof
CN110592035B (en) Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol
CN114149956B (en) Escherichia coli genetically engineered bacterium for expressing esterase EstR and application thereof
CN115433721B (en) Carbonyl reductase mutant and application thereof
CN113652408B (en) Carbonyl reductase mutant and application thereof in synthesis of (R) -4-chloro-3-hydroxybutyrate ethyl ester
WO2019123166A1 (en) Nucleotide sequences encoding 3-quinuclidinone reductase and glucose dehydrogenase and soluble expression thereof
CN114085820B (en) Ketopantolactone reductase from Candida viswanathii
CN113913399B (en) Ketopantolactone reductase from Candida maltosa Xu316
CN112176007B (en) Preparation method of amino alcohol chiral intermediate
CN114150036B (en) Continuous biphasic batch resolution process for preparing optically pure 6-fluoro-chroman-2-carboxylic acid
CN107287172B (en) Method for producing thymidine phosphorylase by using escherichia coli fermentation
CN109943618B (en) Application of recombinant lipase in resolution of (R, S) -alpha-ethyl-2-oxo-1-pyrrolidine methyl acetate
US9670493B2 (en) Low-phosphate repressible promoter
CN108060186B (en) Biological preparation method of p-nitrobenzyl alcohol malonic acid monoester
JP4744916B2 (en) Method for isolating and obtaining optically active alkyl alcohol derivative
CN113249348B (en) Carbonyl reductase, gene thereof, recombinant expression transformant containing the gene and use thereof
CN113025671B (en) Application of nitrile hydratase derived from sinorhizobium meliloti in preparation of amide pyrazine compounds
CN114875087B (en) Method for synthesizing 5-hydroxy beta-indolylalanine by taking beta-indolylalanine as substrate and application thereof
CN114107236B (en) Ketone reductase mutant
WO2000037666A1 (en) Process for producing (r)-2-hydroxy-1-phenoxypropane derivative

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant