CN110791488A - Lipase for splitting chiral compound and preparation method and application thereof - Google Patents
Lipase for splitting chiral compound and preparation method and application thereof Download PDFInfo
- Publication number
- CN110791488A CN110791488A CN201911231329.8A CN201911231329A CN110791488A CN 110791488 A CN110791488 A CN 110791488A CN 201911231329 A CN201911231329 A CN 201911231329A CN 110791488 A CN110791488 A CN 110791488A
- Authority
- CN
- China
- Prior art keywords
- lipase
- culture
- splitting
- recombinant
- culture medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
- C12N9/20—Triglyceride splitting, e.g. by means of lipase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
- C12P41/003—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by ester formation, lactone formation or the inverse reactions
- C12P41/005—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by ester formation, lactone formation or the inverse reactions by esterification of carboxylic acid groups in the enantiomers or the inverse reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01003—Triacylglycerol lipase (3.1.1.3)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a lipase for splitting chiral compounds and a preparation method and application thereof. When preparing lipase, firstly cloning the gene segment shown in SEQ.ID NO.1 into an expression vector, transforming competent cells, and then transferring the competent cells into an escherichia coli strain to obtain recombinant lipase gene engineering bacteria; then carrying out two-step culture on the recombinant lipase gene engineering bacteria to obtain the lipase for splitting the chiral compound. The lipase in the invention can overcome the problems of high cost, difficult continuous production, low reaction efficiency, long reaction time and the like caused by product inhibition in the process of splitting and synchronously recovering chiral substances by using the existing enzyme method, so that the splitting process of chiral compounds is simplified, the splitting time is short, the cost is reduced, and the method is economical and feasible.
Description
Technical Field
The invention belongs to the technical field of chiral compound resolution, and particularly relates to lipase for resolving a chiral compound and a preparation method thereof.
Background
The biocatalysis has the characteristics of mild reaction conditions, high efficiency, strong stereo and regioselectivity, environmental friendliness and the like, so the biocatalysis is widely applied to the research and development of new drugs. In addition, modification optimization of the biocatalyst by rational design and orientation, such as improvement of catalyst stability and substrate selectivity, will enable better application in production processes.
(R) -6-florochromane-2-carboxylate has wide application in organic synthesis and drug production (such as the synthesis of nebivolol), and the structural formula is as follows:
at present, the compound is mostly synthesized by a chemical method, but the compound synthesized by the chemical method is a racemate, and the required chiral compound can be obtained by resolution. The existing resolution technology is divided into chemical resolution and physical resolution, wherein the chemical resolution is difficult, a large amount of waste polluting the environment is generated, and the optical selectivity of the obtained compound is poor. Therefore, there is a need to develop a substance and a method for rapidly resolving chiral compounds.
Disclosure of Invention
Aiming at the prior art, the invention provides the lipase for splitting the chiral compound and the preparation method thereof, so as to realize the purposes of fast splitting the chiral compound, high optical selectivity, environmental friendliness and the like.
In order to achieve the purpose, the invention adopts the technical scheme that: provided is a lipase for resolving a chiral compound, which is prepared by the following steps:
s1: cloning a gene fragment shown as SEQ.ID NO.1 into an expression vector, converting competent cells, selecting a positive transformant to obtain a recombinant expression vector, and then transferring the recombinant expression vector into a escherichia coli BL21(DE3) strain to obtain recombinant lipase gene engineering bacteria;
ATGCCGTCCACGTCCGACTTTGAGCGTGTCATCGCCAAGGCGGTCGAGGACCGCGTCATCCCCGGCGTCGTGCTGCTGGCCGAGAATGCCTCGGGGTCGTTCCGCTACGAAAAGGTGCTCGGCTTCAGCTCCATCGAGCCGGGCAACGAGAAGAAACTCGAGCGCGACAGCGTCTTCATGTTCATGTCGATGACAAAGCTCATCACGGCCGTCACGGCGATGCAGGCTGTCGAGCGCGGCCTCTGGGACCTCGACGCCGACGTCGCGCCGCTGCTGCCCGAGCTCGCAGCCCTGCCGGTCCTCAAGGGCTTCGCGTCGGACGGTGTGCCCGAGCTGGTGCCGCGCGCGTCGCCCATCACTCTGCGCCAGCTGCTCTCGCACTCGTCGGGCGCGGCCTACGACTTCCTGTCGCCCGACCTGATGAACTACCACAAGTGGGTGCGCAAGCAGCCTCCGTCGGCCGGGCTCGCGCAGCCGCCCGCTATGACCATCGCGCCCCCCTCCGTCGAGGAGCGGTTCCGGTTCCCGCTCGTCTTCCAGCCTGGCCAGGGCTGGCAGTACGGCTCGGGCATCGACTGGGTCGGCCGGCTCGTCGAGCGCATCAATGCCAAGGCCCAGGGCAAGACGGAGCCCGAGGCCGGCACAAAGCTGCCGTCGGTGCCGCTCGAGGACGTTGTGATCCGCGACGTGCTCACGCCCTTGGGGCTGCCTGCTGGGTCCCTGACCTTTGTCCCTGAGCGCTACGCCGACGTGTTTGCACGGCTATGGCCGACGCTTCCTACGCGTGTTGGCAACAACGGCGCACTCGACAGCGGGCCCGTGGTCCACGGACCGTCGCTCTACAAGAAGGCGCCCGCCGCTCTGGGCGGCCAGGGCATGTATGGCGACATGTCCTCGTTCTTCCAGGTGGTGCTCTCTCTTTTCCGCGACGACGGCAAGCTGCTCAAGCCCGCGTCGGTCAAGCTGTTCTTTGAGCCGCAGCTGGCGTCCGAGGCAGCACACGCCGGCCTCATGCACAGCACGGAGAACTCGGGGTGGATTACTGGCGACGTCCCCGACACCAAGGAGTACGACTGGAGCGTCGGCGGTCTGCTGGTGACGGGGCATTCGCACCCGTTCCGGAAGAAGGGTGCAGCACTATGGGCCGGCGCCATCAACCTAACCTGGGTGAGTTTTTACGTTATATCCCCCTCTCTTGTGATGACGATGCCACCGATGCTAACAATACCAGATCATCGACAAGGAGGCCGATGTTTGTGCCGTGTTTGCATCCAACTACCAGCCGCCGGGCGACCAGCAGGGCAAGGCCTTGATGCGGCAGTGGGAGGAGTTTGTCTACCCGCAGGCAAAGACGGCGAAGCTATAA(SEQ.ID NO.1)；
s2: inoculating the recombinant lipase gene engineering bacteria into a first culture medium for culture to obtain a seed culture solution;
s3: inoculating the seed culture solution into a second culture medium for culturing, taking the culture solution and centrifuging, and collecting the supernatant to obtain the lipase for splitting the chiral compound.
On the basis of the technical scheme, the invention can be further improved as follows.
Further, the expression vector is pET-28 a.
Further, the competent cell was E.coli DH5 α.
Further, the method comprises the following steps: the culture temperature of the recombinant lipase gene engineering bacteria in S2 is 35-40 ℃, and the culture time is 15-20 h.
Further, the culture of the seed culture solution in the S3 comprises the following steps of inoculating the seed culture solution into a second culture medium, wherein the inoculation amount is 1-3% of the volume of the second culture medium, culturing at 35-40 ℃ until the OD600 value is 0.6-0.8, adding isopropyl- β -D-galactoside, continuously culturing at 25 ℃ for 20-24 h, centrifuging, and collecting the supernatant to obtain the lipase for resolving the chiral compound.
Further, isopropyl- β -D-galactoside was added to the solution at a final concentration of 0.25 mM.
Further, the first culture medium and the second culture medium are both LB liquid culture media, and the LB liquid culture media comprise the following components in percentage by mass:
The recombinant lipase is prepared in large quantities by constructing escherichia coli genetic engineering bacteria and then fermenting, and the preparation process is simple and convenient. After the recombinant lipase is obtained, the 6-fluoro chroman-2-carboxylic acid ethyl ester is resolved by the recombinant lipase to prepare (R) -6-fluoro chroman-2-carboxylic acid, and the specific operation is as follows:
(1) adding 6-fluoro chroman-2-carboxylic acid ethyl ester with the final concentration of 10-300 mmol/L, cosolvent with the mass percent concentration of 2-15% and recombinant lipase with the mass percent concentration of 0.01-1% into a phosphate buffer solution, and reacting for 16-24 hours at the temperature of 25-30 ℃;
(2) extracting the reacted mixture with extractant, taking aqueous phase and regulating pH value to 1, then decompressing and concentrating until crystal is separated out, and obtaining (R) -6-fluoro chroman-2-carboxylic acid.
The cosolvent used in the preparation process is dimethyl sulfoxide or methanol; the extractant used was dichloromethane.
The invention has the beneficial effects that:
the lipase for splitting the chiral compound overcomes the problems of high cost, difficult continuous production, low reaction efficiency caused by product inhibition, long reaction time and the like in the process of splitting and synchronously recovering the chiral substance by the conventional enzyme method, so that the splitting process of the chiral compound is simplified, the splitting time is short, the cost is reduced, and the lipase is economical and feasible.
When the (R) -6-fluoro chroman-2-carboxylic acid is prepared, the initial raw material is 6-fluoro chroman-2-carboxylic acid ethyl ester, and the price is low; the resolution reaction is a 'one-pot' type, namely, a substrate and an enzyme are added simultaneously and react to directly obtain a final product (R) -6-fluoro chroman-2-carboxylic acid without separation and purification. And after the reaction is finished, the product is easy to separate and purify, so that the whole resolution process has low cost and high conversion rate, and is more suitable for industrial production.
Drawings
FIG. 1 is a high performance liquid chromatogram of R-6-fluoro chroman-2-carboxylic acid of example III;
FIG. 2 is a high performance liquid chromatogram of S-6-fluoro chroman-2-carboxylic acid ester of example III.
Detailed Description
The following examples are provided to illustrate specific embodiments of the present invention.
The first embodiment is as follows: preparation of lipase for resolution of chiral compounds
The lipase used for resolving chiral compounds in this example was prepared by the following steps:
cloning a gene fragment shown as SEQ.ID NO.1 into an expression vector pET-28a, transforming escherichia coli DH5 α competent cells, selecting a positive transformant to obtain a recombinant expression vector, and then transforming the recombinant expression vector into an escherichia coli BL21(DE3) strain to obtain the recombinant lipase gene engineering strain capable of preparing the recombinant lipase by inducible expression.
Step two: inoculating the recombinant lipase gene engineering bacteria into an LB liquid culture medium containing kanamycin resistance, and culturing at 37 ℃ for 16h to obtain a seed culture solution; the LB liquid culture medium comprises the following components in percentage by mass:
Inoculating the seed culture solution into LB liquid culture medium containing kanamycin resistance, wherein the inoculation amount is 1% of the volume of the LB liquid culture medium containing kanamycin resistance, then placing the culture medium at 37 ℃ for culture until the OD600 value is about 0.7, then adding isopropyl- β -D-galactoside with the final concentration of 0.25mM, placing the culture medium at 25 ℃ for continuous culture for 24 hours, then centrifuging at 8000rmp and 4 ℃, collecting thalli, cleaning the collected thalli by adopting phosphate buffer solution with the pH value of 7.5 and the concentration of 100mmol/L, then re-suspending the thalli, ultrasonically crushing for 15min, centrifuging again, and collecting supernatant, namely the recombinant lipase.
Example two: preparation of lipase for resolution of chiral compounds
The lipase used for resolving chiral compounds in this example was prepared by the following steps:
cloning a gene fragment shown as SEQ.ID NO.1 into an expression vector pET-28a, transforming escherichia coli DH5 α competent cells, selecting a positive transformant to obtain a recombinant expression vector, and then transforming the recombinant expression vector into an escherichia coli BL21(DE3) strain to obtain the recombinant lipase gene engineering strain capable of preparing the recombinant lipase by inducible expression.
Step two: inoculating the recombinant lipase gene engineering bacteria into an LB liquid culture medium containing kanamycin resistance, and culturing at 35 ℃ for 20 hours to obtain a seed culture solution; the LB liquid culture medium comprises the following components in percentage by mass:
Inoculating the seed culture solution into an LB liquid culture medium containing kanamycin resistance, wherein the inoculation amount is 2% of the volume of the LB liquid culture medium containing kanamycin resistance, then placing the LB liquid culture medium at 35 ℃ for culture until the OD600 value is about 0.6, then adding isopropyl- β -D-galactoside with the final concentration of 0.25mM, placing the mixture at 25 ℃ for continuous culture for 20 hours, then centrifuging the mixture at 8000rmp and 4 ℃, collecting thalli, cleaning the collected thalli by adopting a phosphate buffer solution with the pH value of 7.5 and the concentration of 100mmol/L, then re-suspending the thalli, ultrasonically crushing the thalli for 15min, and centrifuging the thalli again to obtain a supernatant, namely the recombinant lipase.
Example three: preparation of (R) -6-fluoro chroman-2-carboxylic acid
Adding 6-fluoro chroman-2-carboxylic acid ethyl ester with the final concentration of 200mmol/L, dimethyl sulfoxide with the mass percentage concentration of 10% and recombinant lipase with the mass percentage concentration of 0.5% into a phosphate buffer solution with the pH value of about 10 to react; the reaction system is placed at the temperature of 28 ℃ for reaction for 20 hours; the reaction was monitored by HPLC; after the reaction is finished, extracting the mixture by using dichloromethane, and respectively collecting an oil phase and a water phase; then, acidifying the water phase by using 1N hydrochloric acid until the pH value is 1, concentrating the water phase under reduced pressure until crystals are separated out, and slowly heating until the crystals are completely separated out to obtain a compound, namely R-6-fluoro chroman-2-carboxylic acid; the organic phase was washed with brine and the dichloromethane removed by rotary evaporation to give the bis S-6-fluoro chroman-2-carboxylate. And (3) detecting the compound I and the compound II by adopting a high performance liquid phase respectively, wherein single peaks (ee is more than 99%) appear in spectrograms, and detection results are respectively shown in a figure 1 (R-6-fluoro chroman-2-carboxylic acid) and a figure 2 (S-6-fluoro chroman-2-carboxylic ester). The detection proves that the chiral purity of the R-6-fluoro chroman-2-carboxylic acid is 99.47 percent, and the content is 99.7 percent.
Example four: preparation of (R) -6-fluoro chroman-2-carboxylic acid
Adding 6-fluoro chroman-2-carboxylic acid ethyl ester with the final concentration of 50mmol/L, dimethyl sulfoxide with the mass percentage concentration of 2% and the recombinant lipase with the mass percentage concentration of 0.02% into a phosphate buffer solution with the pH value of about 10 to react; the reaction system is placed at 25 ℃ for reaction for 24 hours; the reaction was monitored by HPLC; after the reaction is finished, extracting the mixture by using dichloromethane, and respectively collecting an oil phase and a water phase; then, acidifying the water phase by using 1N hydrochloric acid until the pH value is 1, concentrating the water phase under reduced pressure until crystals are separated out, and slowly heating until the crystals are completely separated out to obtain a compound, namely R-6-fluoro chroman-2-carboxylic acid; the organic phase was washed with brine and the dichloromethane removed by rotary evaporation to give the bis S-6-fluoro chroman-2-carboxylate. And (3) detecting the compound I and the compound II by adopting a high-performance liquid phase respectively, wherein the chiral purity of the finished product R-6-fluoro chroman-2-carboxylic acid is 99.5 percent and the content is 99.0 percent.
While the present invention has been described in detail with reference to the embodiments, it should not be construed as limited to the scope of the patent. Various modifications and changes may be made by those skilled in the art without inventive step within the scope of the appended claims.
Sequence listing
<110> southwest university of transportation
<120> lipase for resolving chiral compound, preparation method and application thereof
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1366
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atgccgtcca cgtccgactt tgagcgtgtc atcgccaagg cggtcgagga ccgcgtcatc 60
cccggcgtcg tgctgctggc cgagaatgcc tcggggtcgt tccgctacga aaaggtgctc 120
ggcttcagct ccatcgagcc gggcaacgag aagaaactcg agcgcgacag cgtcttcatg 180
ttcatgtcga tgacaaagct catcacggcc gtcacggcga tgcaggctgt cgagcgcggc 240
ctctgggacc tcgacgccga cgtcgcgccg ctgctgcccg agctcgcagc cctgccggtc 300
ctcaagggct tcgcgtcgga cggtgtgccc gagctggtgc cgcgcgcgtc gcccatcact 360
ctgcgccagc tgctctcgca ctcgtcgggc gcggcctacg acttcctgtc gcccgacctg 420
atgaactacc acaagtgggt gcgcaagcag cctccgtcgg ccgggctcgc gcagccgccc 480
gctatgacca tcgcgccccc ctccgtcgag gagcggttcc ggttcccgct cgtcttccag 540
cctggccagg gctggcagta cggctcgggc atcgactggg tcggccggct cgtcgagcgc 600
atcaatgcca aggcccaggg caagacggag cccgaggccg gcacaaagct gccgtcggtg 660
ccgctcgagg acgttgtgat ccgcgacgtg ctcacgccct tggggctgcc tgctgggtcc 720
ctgacctttg tccctgagcg ctacgccgac gtgtttgcac ggctatggcc gacgcttcct 780
acgcgtgttg gcaacaacgg cgcactcgac agcgggcccg tggtccacgg accgtcgctc 840
tacaagaagg cgcccgccgc tctgggcggc cagggcatgt atggcgacat gtcctcgttc 900
ttccaggtgg tgctctctct tttccgcgac gacggcaagc tgctcaagcc cgcgtcggtc 960
aagctgttct ttgagccgca gctggcgtcc gaggcagcac acgccggcct catgcacagc 1020
acggagaact cggggtggat tactggcgac gtccccgaca ccaaggagta cgactggagc 1080
gtcggcggtc tgctggtgac ggggcattcg cacccgttcc ggaagaaggg tgcagcacta 1140
tgggccggcg ccatcaacct aacctgggtg agtttttacg ttatatcccc ctctcttgtg 1200
atgacgatgc caccgatgct aacaatacca gatcatcgac aaggaggccg atgtttgtgc 1260
cgtgtttgca tccaactacc agccgccggg cgaccagcag ggcaaggcct tgatgcggca 1320
gtgggaggag tttgtctacc cgcaggcaaa gacggcgaag ctataa 1366
Claims (10)
1. A method for preparing lipase for resolving chiral compounds, which is characterized by comprising the following steps:
s1: cloning a gene fragment shown as SEQ.ID NO.1 into an expression vector, converting competent cells, selecting a positive transformant to obtain a recombinant expression vector, and then transferring the recombinant expression vector into an escherichia coli strain to obtain recombinant lipase gene engineering bacteria;
s2: inoculating the recombinant lipase gene engineering bacteria into a first culture medium for culture to obtain a seed culture solution;
s3: inoculating the seed culture solution into a second culture medium for culturing, taking the culture solution and centrifuging, and collecting the supernatant to obtain the lipase for splitting the chiral compound.
2. The method of claim 1, wherein: the expression vector is pET-28 a.
3. The method according to claim 1, wherein the competent cell is Escherichia coli DH5 α.
4. The method of claim 1, wherein: the culture temperature of the recombinant lipase gene engineering bacteria in S2 is 35-40 ℃, and the culture time is 15-20 h.
5. The preparation method of claim 1, wherein the step of culturing the seed culture solution in S3 comprises the steps of inoculating the seed culture solution into a second culture medium with an inoculation amount of 1-3% of the volume of the second culture medium, culturing at 35-40 ℃ until the OD600 value is 0.6-0.8, adding isopropyl- β -D-galactoside, culturing at 25 ℃ for 20-24 h, centrifuging, and collecting the supernatant to obtain the lipase for resolving the chiral compound.
6. The method according to claim 5, wherein isopropyl- β -D-galactoside is added to the solution at a final concentration of 0.25 mM.
7. The method of claim 1, wherein: the first culture medium and the second culture medium are both LB liquid culture media, and the LB liquid culture media comprise the following components in percentage by mass:
tryptone 1%, yeast extract 0.5%, sodium chloride 3%, and water in balance.
8. A lipase prepared by the preparation method of any one of claims 1 to 7 for resolving a chiral compound.
9. Use of the lipase for resolving chiral compounds according to claim 8 in the preparation of (R) -6-fluoro chroman-2-carboxylic acid.
10. Use according to claim 9, characterized in that it comprises the following steps:
(1) adding 6-fluoro chroman-2-carboxylic acid ethyl ester with the final concentration of 10-300 mmol/L, cosolvent with the mass percent concentration of 2-15% and recombinant lipase with the mass percent concentration of 0.01-1% into a phosphate buffer solution, and reacting for 16-24 hours at the temperature of 25-30 ℃;
(2) extracting the reacted mixture with extractant, taking aqueous phase and regulating pH value to 1, then decompressing and concentrating until crystal is separated out, and obtaining (R) -6-fluoro chroman-2-carboxylic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911231329.8A CN110791488A (en) | 2019-12-05 | 2019-12-05 | Lipase for splitting chiral compound and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911231329.8A CN110791488A (en) | 2019-12-05 | 2019-12-05 | Lipase for splitting chiral compound and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110791488A true CN110791488A (en) | 2020-02-14 |
Family
ID=69447482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911231329.8A Pending CN110791488A (en) | 2019-12-05 | 2019-12-05 | Lipase for splitting chiral compound and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110791488A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114150036A (en) * | 2021-12-23 | 2022-03-08 | 华东理工大学 | Continuous two-phase batch resolution process for preparing optically pure 6-fluoro-chroman-2-carboxylic acid |
| CN114149956A (en) * | 2021-12-23 | 2022-03-08 | 华东理工大学 | Escherichia coli genetic engineering bacterium for expressing esterase EstR and application thereof |
| CN114214261A (en) * | 2021-12-23 | 2022-03-22 | 华东理工大学 | Escherichia coli genetic engineering bacterium for expressing esterase EstS and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994020634A1 (en) * | 1993-03-03 | 1994-09-15 | Chiroscience Limited | Esterase and its use in biotransformation |
| US20130295622A1 (en) * | 2010-11-30 | 2013-11-07 | Menarini International Operations Luxembourg S.A. | Process for the preparation of nebivolol |
-
2019
- 2019-12-05 CN CN201911231329.8A patent/CN110791488A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994020634A1 (en) * | 1993-03-03 | 1994-09-15 | Chiroscience Limited | Esterase and its use in biotransformation |
| US20130295622A1 (en) * | 2010-11-30 | 2013-11-07 | Menarini International Operations Luxembourg S.A. | Process for the preparation of nebivolol |
Non-Patent Citations (2)
| Title |
|---|
| HARIDAS等: "EPE07666.1", 《GENBANK》 * |
| 王桂霞等: "具有生物活性的色满衍生物不对称合成研究", 《化学进展》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114150036A (en) * | 2021-12-23 | 2022-03-08 | 华东理工大学 | Continuous two-phase batch resolution process for preparing optically pure 6-fluoro-chroman-2-carboxylic acid |
| CN114149956A (en) * | 2021-12-23 | 2022-03-08 | 华东理工大学 | Escherichia coli genetic engineering bacterium for expressing esterase EstR and application thereof |
| CN114214261A (en) * | 2021-12-23 | 2022-03-22 | 华东理工大学 | Escherichia coli genetic engineering bacterium for expressing esterase EstS and application thereof |
| CN114150036B (en) * | 2021-12-23 | 2024-01-09 | 华东理工大学 | Continuous biphasic batch resolution process for preparing optically pure 6-fluoro-chroman-2-carboxylic acid |
| CN114214261B (en) * | 2021-12-23 | 2024-04-09 | 华东理工大学 | Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof |
| CN114149956B (en) * | 2021-12-23 | 2024-04-09 | 华东理工大学 | Escherichia coli genetically engineered bacterium for expressing esterase EstR and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2459871C2 (en) | Method for enzymatic production of 2-hydroxy-2-methyl carboxylic acids | |
| CN110791488A (en) | Lipase for splitting chiral compound and preparation method and application thereof | |
| CN108690854B (en) | Method for producing L-glufosinate-ammonium by using chemical-enzymatic method | |
| CN110951799B (en) | Method for synthesizing (2S,3R) -p-methylsulfonyl phenyl serine by whole cell asymmetry of' one bacterium multienzyme | |
| US20240158819A1 (en) | Use of Biological Enzyme for Preparing Orlistat Intermediate, and Preparation Method | |
| JP7401116B2 (en) | Novel L-amino acid oxidase and method for producing D-amino acid or derivatives thereof | |
| CN114196715A (en) | Method for synthesizing pseudouridine by chemical enzyme method | |
| CN114134134B (en) | L-threonine aldolase mutant and application thereof in synthesis of L-syn-p-methylsulfonyl phenylserine | |
| CN112522228B (en) | R-aminotransferase from pseudomonas ammoxidation and synthesis method thereof | |
| CN111394289B (en) | Genetically engineered bacterium and application thereof, and method for producing prostaglandin E2 | |
| CN116814572A (en) | Carbonyl reductase and mutant thereof and application of carbonyl reductase and mutant in preparation of chiral (R) -8-chloro-6-hydroxy ethyl octanoate | |
| CN115433721B (en) | Carbonyl reductase mutant and application thereof | |
| CN108424937B (en) | Method for synthesizing tanshinol by enzyme method | |
| CN110791483B (en) | Short-chain reductase and preparation method and application thereof | |
| CN116855467A (en) | Chemical-enzyme coupling method for synthesizing ergothioneine | |
| CN110791536B (en) | Biosynthesis method of levodopa | |
| CN110373440B (en) | Method for preparing DL-serine by one-pot enzyme method | |
| CN110791467B (en) | Recombinant bacterium for producing acetylacetone and construction method and application thereof | |
| CN114480315B (en) | Baeyer-Villiger monooxygenase and application thereof in brivaracetam synthesis | |
| CN111118074B (en) | Method for preparing phenylpyruvic acid | |
| CN115747194B (en) | L-threonine aldolase mutant, gene and method for preparing L-anti-p-methylsulfonylphenyl serine | |
| CN114231522B (en) | Immobilized N-deoxyribotransferase and deoxynucleoside preparation method | |
| CN116254279B (en) | Method for catalyzing xylitol to biosynthesize L-xylose by using double-enzyme cascade recombinant escherichia coli | |
| CN116286567B (en) | Recombinant escherichia coli producing alpha-amino acid ester acyltransferase, and construction method and application thereof | |
| CN110819616B (en) | Maleic acid isomerase mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200214 |
|
| RJ01 | Rejection of invention patent application after publication |