CN110819616B

CN110819616B - Maleic acid isomerase mutant and application thereof

Info

Publication number: CN110819616B
Application number: CN201810914716.0A
Authority: CN
Inventors: 任丽梅; 李鹤; 朱科; 李红飞; 楚伟冬; 王艳艳; 袁国强
Original assignee: Cspc Group Secret Snow Glucose Co ltd
Current assignee: Cspc Group Secret Snow Glucose Co ltd
Priority date: 2018-08-13
Filing date: 2018-08-13
Publication date: 2022-12-27
Anticipated expiration: 2038-08-13
Also published as: CN110819616A

Abstract

The invention discloses a novel maleate isomerase mutant, which corresponds to an amino acid sequence of maleate isomerase shown as SEQ ID No.1, wherein the amino acid sequence of the maleate isomerase mutant has mutations of F39L and A224G. The invention discovers that the novel maleate isomerase and the mutant thereof have higher enzyme activity and stability and are more prominent. In addition, the invention also discloses the combination of the maleate isomerase and the L-aspartate ammonia lyase in any form and application of the maleate isomerase and the L-aspartate ammonia lyase in aspartic acid production, wherein the maleate isomerase and the L-aspartate ammonia lyase are coupled together to form a co-expressed single-enzyme double-enzyme form.

Description

Maleic acid isomerase mutant and application thereof

Technical Field

The invention relates to the field of bioengineering, in particular to a maleic acid isomerase and application thereof.

Background

L-aspartic acid, one of the 20 basic amino acids, is widely involved in the synthesis of various proteins and is a precursor of various biosyntheses. As a raw material, L-aspartic acid is widely applied to the aspects of food, medicine, chemical industry and the like, and downstream products comprise alanine, environment-friendly materials of polyaspartic acid, aspartame and the like.

The traditional method for producing L-aspartic acid is ring-opening cracking of benzene by a chemical method, producing fumaric acid by a chemical catalysis method, and producing L-aspartic acid by the whole bacteria catalysis of an L-aspartic acid production strain. The step involves 2 steps of chemical catalysis and one step of fermentation full-thallus catalysis, and has long route and is not economical and environment-friendly.

In recent years, a whole-organism green conversion method has been reported, in which maleic acid (maleic acid) is used as a starting substrate, cis-butenedioic acid Isomerase (Maleate cis-trans Isomerase, maiA, ec 5.2.1.1) is used for catalyzing isomerization to generate fumaric acid, and aspartic acid is catalyzed and synthesized by aspartic acid ammonia lyase to generate aspartic acid (see CN106755157A, CN 107475320A). However, although the processes for synthesizing L-aspartic acid in green by organisms make great progress, the processes have the disadvantages of relatively high cost, low isomerase activity, poor stability and the like. Therefore, the whole biological method adopting the new process is still in the dilemma of industrial popularization.

To solve the above problems, it is most critical to improve the expression activity and stability of isomerase, and further integrate to compress the technology of biological enzyme method to the minimum. Currently, the isomerases have been reported to be derived from species such as Serratia marcesens, rhodococcus sp.RHA1, alcaligenes faecalis IFO13111, and B.stearothermo.Philus MI 102. However, these isomerases still have the disadvantages of low enzyme activity, poor stability, and easy cost limitation in industrial production.

Thus, there remains a need in the art for novel maleate isomerases and modes of use thereof.

Disclosure of Invention

In order to solve the above technical problems, the present invention provides a novel maleate isomerase that has improved enzyme activity and stability compared to the currently known maleate isomerase, and that has better substrate conversion effect and more flexible and simple usage when converting maleic acid to produce L-aspartic acid.

The present invention provides the following technical solutions.

In one aspect, the present invention provides a mutant maleate enzyme corresponding to the amino acid sequence of maleate isomerase shown in SEQ ID NO.1, the amino acid sequence of the mutant maleate isomerase having F39L and/or A224G mutations.

SEQ ID No.1 shows NCBI sequence ID: amino acid sequence of maleate isomerase of WP _ 010929891.1. According to the three-dimensional structure characteristics of the maleic acid isomerase and the random mutation technology of enzyme engineering, a series of mutants are obtained after mutation is carried out on one or more sites, and the maleic acid isomerase mutant provided by the invention is obtained through screening of stability, enzyme activity and the like. Specifically, the maleate isomerase mutant provided by the invention is a mutation of a two-point mutant enzyme (F39L, A224G) relative to the known maleate isomerase (parent).

Preferably, the maleate isomerase mutant of the present invention comprises an amino acid sequence shown as SEQ ID NO. 3; more preferably, the amino acid sequence of the maleate isomerase mutant is shown in SEQ ID NO. 3.

In another aspect, the present invention provides a gene sequence encoding the maleate isomerase mutant;

preferably, the gene sequence comprises a nucleotide sequence shown as SEQ ID NO. 4;

more preferably, the gene sequence comprises a nucleotide sequence as shown in SEQ ID NO. 4.

In yet another aspect, the present invention provides a vector comprising the gene sequence;

preferably, the vector is a recombinant vector, preferably a recombinant expression vector, more preferably a recombinant expression vector for expression in bacteria, such as e.

According to a particular embodiment of the invention, the vector is pET29a-Bptm.

In yet another aspect, the present invention provides a host cell comprising the vector;

preferably, the host cell is a host cell, preferably a bacterial cell, such as an e.coli (e.coli) cell, for expressing the maleate isomerase mutant from the vector.

Experiments show that in the aspect of converting substrate maleic acid into fumaric acid, the maleic acid isomerase mutant provided by the invention has obviously improved enzyme activity and stability compared with the parent enzyme or maleic acid isomerase derived from other strains, and has the application of catalyzing maleic acid isomerization to generate fumaric acid.

Therefore, in a further aspect, the present invention provides the use of the maleate isomerase mutant, the gene sequence, the vector or the host cell in catalyzing the isomerization of maleic acid to fumaric acid. In said use, the maleate isomerase mutant or a maleate isomerase mutant derived from the gene sequence, the vector or the host cell may be in free or immobilized form of the enzyme.

The fumaric acid obtained by the above conversion may be simultaneously or further converted into aspartic acid by the action of an aspartic acid ammonia lyase. Therefore, the invention provides the application of the maleate isomerase mutant, the gene sequence, the vector or the host cell in the production of L-aspartic acid by using maleic acid as a substrate. In said use, the maleate isomerase mutant or a maleate isomerase mutant derived from the gene sequence, the vector or the host cell may be in free or immobilized form of the enzyme.

The invention further provides the following technical scheme.

In one aspect, the invention provides a genetic construct (e.g., a nucleotide sequence) comprising a gene sequence encoding an L-aspartate ammonia lyase and a gene sequence encoding a maleate isomerase or a mutant maleate isomerase;

preferably, the genetic construct further comprises elements, such as ribosome binding sequences, for expressing L-aspartate ammonia lyase and maleate isomerase, or a mutant of maleate isomerase.

According to a particular embodiment of the invention, the amino acid sequence of the L-aspartate ammonia lyase is as defined in NCBI sequence ID: WP _ 086258271.1.

The maleate isomerase comprises an amino acid sequence shown as SEQ ID NO.1; preferably, the amino acid sequence of the maleate isomerase is shown as SEQ ID NO.1; or the maleate isomerase mutant comprises an amino acid sequence shown as SEQ ID NO. 3; preferably, the amino acid sequence of the maleate isomerase mutant is shown in SEQ ID NO. 3.

In another aspect, the present invention provides a vector comprising a gene sequence encoding L-aspartate ammonia lyase and a gene sequence encoding maleate isomerase or a mutant maleate isomerase.

Preferably, the vector comprises the gene construct provided by the present invention;

According to a particular embodiment of the invention, the vector is pET29a-Bptm-EAsp.

preferably, the host cell is a host cell, preferably a bacterial cell, such as an e.coli (e.coli) cell, for expressing the L-aspartate ammonia lyase and the maleate isomerase or maleate isomerase mutant from the vector.

Experiments show that the gene construct of the invention co-expresses the maleate isomerase or the mutant thereof and the L-aspartate ammonia lyase in a proper system, and when the isomerase or the mutant thereof meets the requirement of converting the enzyme activity, the enzyme activity of the L-aspartate synthetase can also meet the same requirement of converting the same substrate, so the gene construct has the application in producing the L-aspartate by taking the maleic acid as the substrate.

Therefore, in a further aspect, the present invention provides the use of said genetic construct, said vector or said host cell for the production of L-aspartic acid using maleic acid as a substrate. In the use, the maleate isomerase or mutant thereof and the L-aspartate synthetase obtained from the gene construct, the vector or the host cell may be in free form or in immobilized form.

The invention further provides the following technical scheme.

In one aspect, the invention provides a method for producing L-aspartic acid by using maleic acid as a substrate, wherein the method comprises the step of using maleic acid as a substrate, and combining the maleic acid isomerase mutant, the gene sequence, the vector or the host cell provided by the invention with an L-aspartic acid ammonia lyase to convert the substrate into L-aspartic acid in one step.

Alternatively, the present invention provides a method for producing L-aspartic acid using maleic acid as a substrate, comprising the step of synthesizing L-aspartic acid by converting the substrate in one step using maleic acid as a substrate using the gene construct, the vector or the host cell provided by the present invention.

In the method provided by the present invention, preferably, the enzyme activity ratio of the enzyme involved in the conversion is: the ratio of maleate isomerase/L-aspartic acid ammonia lyase is 100-120U/2000-4000U, or the ratio of maleate isomerase mutant/L-aspartic acid ammonia lyase is 120-150U/2000-4000U.

Preferably, the conversion starting concentration of the maleic acid is 180-200g/L;

preferably, the method comprises: the reaction temperature was 40 ℃ and the pH was 8.0.

Preferably, the method further comprises recycling maleic acid, comprising: after the conversion reaction is finished, regulating the pH value by adopting maleic acid to precipitate crystals, removing impurities from the obtained supernatant, adding maleic acid, and controlling the content of L-aspartic acid to be below 2% for the next conversion reaction.

Specifically, the invention synthesizes a gene sequence of Bordetella pertussis Tohama I maleic acid isomerase (NCBI sequence ID: WP-010929891.1; bpt for short) through a whole gene, then clones the gene onto an expression vector pET29a, transforms a recombined expression plasmid into a corresponding host cell, and then obtains the enzyme lysate through induction expression, lysis and the like. Meanwhile, gene sequences of other known maleic acid isomerases which are representative at present are prepared, cloned into the same plasmid, expressed in parallel in corresponding host cells, lysed, and the like, and the activity and stability data of the isomerases are compared. When the isomerase sequence with high activity and high stability is confirmed to be obtained, a series of mutants are designed according to the laboratory experience and the three-dimensional structure characteristics of the isomerase, and finally a two-point mutant strain (bptm) is obtained.

The enzyme activity and stability of the enzyme (Bptm for short) of the strain are inspected, and the enzyme activity of the maleate isomerase with the mutation site is improved by about 20-88 percent, and the stability at 40 ℃ is improved by about 20-35 percent. The amino acid sequence of the enzyme is shown as SEQ ID NO. 3; the recombinant plasmid is pET29a-Bptm, and the recombinant plasmid before mutation is pET29a-Bpt.

Further through primer design, the sequence ID of the Escherichia coli L-aspartate ammonia lyase NCBI is adjusted: WP _086258271.1 (EAsp) gene sequence (Asp for short), cloning Asp gene onto recombinant plasmid pET29a-Bpt or pET29a-Bptm, serial recombination of Bpt or Bptm and Asp to convert the expression plasmid into corresponding host cell, expressing and cracking to prepare corresponding enzyme liquid, and utilizing the prepared enzyme liquid and the ultimate one-bacterium double-enzyme combined strain to obtain the conversion condition for exploration, so as to realize simultaneous examination of the combination of the gene and L-aspartic acid ammonia lyase.

The result shows that the enzyme activity of the L-aspartate ammonia lyase can meet the same requirement of converting the same substrate while the isomerase meets the requirement of converting the enzyme activity by a ribosome binding site accompanying mode, that is, the enzyme activity proportion of the two enzymes is very suitable: the enzyme activity ratio can reach Bpt + EAsp:100-120U/2000-4000U; bptm + EAsp:120-150U/2000-4000U. Moreover, the above combination has been found to further enhance the stability of the isomerase or its mutant (stability increase of about 20-35% at 40 ℃).

The increased enzyme activity and stability and the proper enzyme activity ratio ensure that better substrate conversion effect can be achieved only by less thalli or enzyme liquid prepared by the thalli. Therefore, the one-bacterium two-enzyme system obtains more reasonable enzyme activity ratio for complete conversion and more stable activity of isomerase or mutant thereof, further reduces production cost, and makes great progress on the technology of preparing L-aspartic acid from maleic acid by one-step method. For example, under the final optimized conditions, the wet thallus provided by the invention only needs 3-5g/L, and can complete the complete conversion of maleic acid with the substrate concentration of 20% into L-aspartic acid. And finally, the transformation experiment proves that no matter the small-scale reaction or the pilot-scale reaction, the isomerase from the strain or the mutant thereof obtains good transformation effect when being combined with any type of aspartate ammonia lyase. The application mode of the enzyme can comprise two modes of enzyme liquid and thallus.

In addition, the inventor of the invention finds that the maleic acid isomerase or the mutant thereof can tolerate the regulation of pH by using maleic acid instead of sulfuric acid to separate out crystals no matter how the maleic acid isomerase or the mutant thereof is matched with the aspartic acid ammonia lyase, and the cyclic application of the maleic acid can be met as long as the enzyme activity meets the requirement. Thereby further reducing the cost, realizing a green circulating path and reducing the sulfate pollution.

In general, the method has the advantages of lower technical cost, greenness, little pollution, less acid and alkali consumption, short production period, high product quality and high purity of the final product, and the purity can reach 99.78-99.9%.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 shows the single-restriction map of the recombinant plasmid, wherein the lanes are: 1.EcoRI singly cuts pET29a-Bpt; pET29a-Bpt plasmid; m. marker; xhoI single cut pET29a-Bpt-EAsp; pET29a-Bpt-EAsp plasmid.

FIG. 2 shows a schematic structure of the plasmid, wherein 2A is plasmid pET29a,2B is recombinant plasmid pET29a-Bpt,2C is recombinant plasmid pET29a-Bptm,2D is recombinant plasmid pET29a-Bpt-Easp, and 2E is recombinant plasmid pET29a-Bptm-Easp.

FIG. 3 shows HPLC analysis charts of three acid standards, in which the retention time of L-aspartic acid is 2.120min, that of maleic acid is 2.850min, and that of fumaric acid is 3.015min.

Detailed Description

The invention is illustrated below with reference to specific examples. It will be understood by those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

The experimental procedures in the following examples are all conventional ones unless otherwise specified. The raw materials and reagents used in the following examples are all commercially available products unless otherwise specified.

Example 1Obtaining of maleic acid isomerase (Bpt) and its mutant (Bptm)

Bpt gene sequence after the codon optimization of the escherichia coli is synthesized by the whole gene, and Bpt target gene segments (SEQ ID NO.1; SEQ ID NO. 2) are amplified by taking the synthesized sequence as a template. The primer sequence is as follows:

primer 1: CCGGAATTCATGCAAAAACCTACCGTATTG (SEQ ID NO. 6)

Primer 2: CCGGAATTCTTAATACGCACCGCTCAGC (SEQ ID NO. 7)

PCR amplification reaction System: sterile water 22uL, KAPA2 MIX 25uL, primer 1 (10 uM) 1uL, primer 2 (10 uM) 1uL, template 1uL, total volume of 50uL.

And (3) PCR reaction conditions: 4min at 98 ℃; 20sec at 98 ℃, 15sec at 60 ℃, 1min at 72 ℃ and 30 cycles; 10min at 72 ℃.

The size of the amplified target fragment is about 0.75Kb, and the PCR product is purified and recovered. And (3) carrying out single enzyme digestion on the PCR product and the Escherichia coli expression vector pET29a by using EcoR1, dephosphorizing the vector after enzyme digestion by using CIP, and respectively purifying and recovering to obtain corresponding enzyme digestion products. The cleavage products were ligated into the corresponding sites in the vector pET29a by T4DNA ligase. The ligation product was transformed into E.coli competent BL21 (DE 3) strain and cultured overnight at 37 ℃ on LB plate (kan-resistant). Carrying out colony PCR identification on a single colony growing on the plate by using a target gene specific primer, carrying out plasmid extraction on a positive transformant identified by the colony PCR, carrying out single enzyme digestion identification on a corresponding plasmid by using EcoR1, and sequencing a recombinant plasmid with a correct identification band. The correctly sequenced plasmid is the recombinant plasmid pET29a-Bpt.

According to the laboratory experience and the characteristics of the three-dimensional structure of the isomerase, a series of mutants are designed, the enzyme activity is screened in a laboratory mutation mode to obtain improved strain monoclonals, the obtained strains with improved enzyme activity are extracted to obtain plasmids, and the plasmids are sent to sequencing to obtain the position of the mutant. Mutant strains (Bptm) were obtained in which the isomerase mutant (Bptm) included two mutation sites: phe to Leu mutation at position 39 and Ala to Gly mutation at position 224 (SEQ ID NO. 3). The recombinant plasmid pET29a-Bptm was constructed as described above.

The restriction enzyme identification results of each plasmid are shown in FIG. 1, and the structure is schematically shown in FIG. 2.

The strains containing the recombinant plasmids are named as BL21 (DE 3) -pET29a-Bpt and BL21 (DE 3) -pET29a-Bptm respectively.

Example 2Cloning of aspartate ammonia lyase (EAsp) in tandem with Bpt and Bptm genes

The EAsp gene sequence is the E.coli native aspartate ammonia lyase (NCBI accession No.: WP-086258271.1) gene. The primer sequence is as follows:

primer 3: CCGCTCGAGtc taggaaaagaagagaaatac tagATGATGTCAAACAACATTCG (SEQ ID NO. 8);

(additional added is a ribosome binding site (SEQ ID NO. 5), referred to herein as NRBS)

And (4) primer: CCGCTCGAGTTACTGTTCGCTTTCAT (SEQ ID NO. 9).

PCR amplification reaction System: sterile water 22uL, KAPA2 MIX 25uL, primer 3 (10 uM) 1uL, primer 4 (10 uM) 1uL, template 1uL, total volume of 50uL.

And (3) PCR reaction conditions: 4min at 98 ℃; 20sec at 98 ℃, 15sec at 60 ℃, 1.5min at 72 ℃ and 30 cycles; 10min at 72 ℃.

The size of the amplified target fragment is about 1.4Kb, and the PCR product is purified and recovered. And (3) performing single enzyme digestion on the PCR product and the recombinant vector pET29a-Bpt or pET29a-Bptm by using Xho1, dephosphorizing the vector after enzyme digestion by using CIP, and purifying and recovering to obtain a corresponding enzyme digestion product. And (3) connecting the enzyme digestion product into a corresponding site in the vector under the action of T4 NDA ligase. The ligation product was transformed into E.coli competent BL21 (DE 3) strain and cultured overnight at 37 ℃ on LB plate (kan-resistant). Colony PCR identification is carried out on a single colony growing on the plate by using a target gene specific primer, plasmid extraction is carried out on a positive transformant identified by the colony PCR, a corresponding plasmid is identified by Xho1 single enzyme digestion, and sequencing is carried out on a recombinant plasmid with a correct identification band. The recombinant plasmid pET29a-Bpt-EAsp or pET29a-Bptm-EAsp is obtained after the sequencing is correct.

The strains containing the recombinant plasmids are named as BL21 (DE 3) -pET29a-Bpt-EAsp and BL21 (DE 3) -pET29a-Bptm-EAsp respectively.

Example 3Recombinant prokaryotic expression and enzyme activity

Other maleic acid isomerase genes from reported sources were cloned into the same pET29a vector as described in examples 1 and 2 to obtain a recombinant plasmid, and a strain containing the recombinant plasmid was obtained as a control strain.

The strains BL21 (DE 3) -pET29a-Bpt, BL21 (DE 3) -pET29a-Bptm, BL21 (DE 3) -pET29a-Bpt-EAsp, BL21 (DE 3) -pET29a-Bptm-EAsp and the control strain were each cultured in LB liquid (kan-resistant) medium, cultured at 37 ℃ and 220rpm for 4 to 5 hours, and IPTG was added to OD1.0 or so to induce the desired protein to express. And (3) inducing conditions: 20 ℃ C., 169h, 220rpm. And (4) centrifugally collecting thalli, and weighing wet weight of the thalli. The collected cells were resuspended in a pH7.020mM phosphate buffer solution to a cell concentration of 100mg/mL. Ultrasonic thallus crushing: the ultrasonic power is 200W, the ultrasonic working time is 3S, and the interval is 7S,30min. Centrifuging the ultrasonic lysate, collecting supernatant enzyme solution, simultaneously preparing supernatant and precipitated protein samples, and performing SDS-PAGE detection. The supernatant enzyme solution was stored at-80 ℃ for detection of enzyme activity.

The following measurement and analysis methods were used.

1.HPLC method for determining maleic acid, fumaric acid and L-aspartic acid in the reaction solution

Mobile phase: A.pH2.5 mM potassium dihydrogen phosphate; B. acetonitrile; a: B = 95: 5;

detection wavelength: 205nm;

flow rate: 0.8ml/min;

sample introduction amount: 10 mu L of the solution;

a chromatographic column: innoval ODS-2 150mmx4.6mm5 μm;

column temperature: at 30 ℃.

The specific analysis table is shown in FIG. 3.

2. Enzyme activity assay of maleate isomerase

After the substrate maleic acid (50 g/L, pH 8.0) solution reached 37 ℃ under the water bath condition, 950. Mu.L of the substrate solution was aspirated and added to a 2mL centrifuge tube, 50. Mu.L of the enzyme solution (10 mg/mL) was added, and the reaction was carried out for 20min at 37 ℃ with shaking at 120rpm in a shaker. Diluting to 200 times in 2 times after reaction, boiling for 2min, filtering with 0.45 μm filter membrane, sucking 10 μ L, injecting into HPLC, measuring fumaric acid production in reaction solution, and calculating enzyme activity. 1U is defined as the amount of enzyme required to produce 1 micromole of product at 37 ℃.

3. Enzyme activity assay of aspartate ammonia lyase

After a substrate fumaric acid mother liquor (200 g/L, pH 8.0) solution reaches 37 ℃ under the water bath condition, sucking 4mL of fumaric acid mother liquor, adding 0.1mL (4.1 mg/mL) of enzyme solution, and shaking and reacting for 10min at 37 ℃ by 220rpm of a shaking table. Adding 950 μ L of mobile phase into 50 μ L of reaction solution, diluting with purified water 10 times, mixing, boiling for 2min, cooling, filtering with 0.45 μm filter membrane, sucking 10 μ L, injecting into HPLC, measuring L-aspartic acid production in the reaction solution, and calculating enzyme activity. 1U is defined as the amount of enzyme required to produce 1 micromole of product at 37 ℃.

4. Calculation of enzyme activity retention rate at different temperatures

And (3) keeping the temperature for a certain time at different temperatures, and then determining the enzyme activity, wherein the enzyme activity determination mode refers to the method, the enzyme activity after treatment is divided by the enzyme activity without treatment, and the percentage of the ratio is defined as the enzyme activity retention rate at different temperatures and different treatment times.

The results are shown in Table 1 below.

TABLE 1 enzyme Activity of the Malate isomerase under various conditions

As shown in table 1, the enzyme activities and stabilities of Bpt and Bptm expressed alone were high, significantly greater than those of the control species, with the Serratia marcessens-derived isomerase being less active and not assessed for its temperature stability. The activity of Bpt enzyme is about 90-120U/mL, the highest Bptm of the mutant can reach 170U/mL, the enzyme activity stability at 40 ℃ after mutation is obviously improved for 2h and 4h, the 2h is 65.29v.s.72.3, the 4h is 21.58v.s.28.11, and the stability is improved by about 20-35%.

Meanwhile, the enzyme activity of the EAsp is 2000-4000U when the enzyme is a single-strain double-enzyme. Therefore, by means of a ribosome binding site accompanying mode, the enzyme activity of the L-aspartate ammonia lyase can meet the requirement of converting the same substrate while the maleate isomerase meets the requirement of converting the enzyme activity, namely, the unexpected effect that the enzyme activity proportion of the two enzymes is matched very suitably is achieved, and the enzyme activity proportion of the two enzymes can reach Bpt + asp:100-120U/2000-4000U; bptm + asp:120-150U/2000-4000U.

And further finds that the above-mentioned compounding mode further enhances the stability of the maleate isomerase at 40 ℃ for one-bacterium double enzymes, and that the stability for Bpt is 65.29v.s.84.87, and the stability for 4h is 21.58v.s.29.13; for Bptm,2h is 72.3v.s.88.36,4h is 28.11v.s.37.23, and the stability is improved by about 20-35%. The unexpected effect enables better conversion effect to be achieved with less thalli or enzyme liquid prepared from the thalli, belongs to unexpected one-bacterium double-enzyme combination effect, and further reduces production cost.

The abbreviations for the cells and the enzyme solutions used in the following examples are shown in Table 2 below.

TABLE 2 bacteria and enzyme solutions

Source	Thallus	Enzyme solution
			BL21(DE3)-pET29a-Bpt	Cell body	1	Enzyme solution 1
BL21(DE3)-pET29a-Bptm	Cell	2					Enzyme solution 2
			BL21(DE3)-pET29a-Bpt-EAsp	Cell	3	Enzyme solution 3
BL21(DE3)-pET29a-Bptm-EAsp	Cell	4					Enzyme solution 4

Substrate maleic acid conversion = (initial acid concentration-actual acid concentration)/initial acid concentration × 100%.

Example 4

Enzyme solution 1, enzyme solution 2 amplification reaction-1

Transferring a maleic acid substrate (200 g/L) solution into a 250mL three-neck flask, controlling the reaction volume to be 100mL, controlling the temperature to be 38 ℃ at the beginning, controlling the pH value to be 7.9-8.0, adding enzyme liquid 1 or enzyme liquid 2 (maleic acid isomerase 2000-3000U/L), independently adding 83mg (about 2-3 ten thousand U/L, powder or liquid) of aspartate ammonia lyase, uniformly stirring, controlling the temperature to react at 40 ℃, controlling the rotating speed to be 110-130rpm, controlling the pH value to be 8.0, sampling every 1h to determine the residual amount of maleic acid and obtain the conversion rate, controlling the reaction time to be 22-36h, and controlling the final conversion rate of the reaction to be 99.8-100%.

Example 5

Enzyme solution 1, enzyme solution 2 amplification reaction-1

Maleic acid substrate (200 g/L) solution is transferred into a 250mL three-neck flask, the reaction volume is 100mL, the initial temperature is controlled at 38 ℃, the pH value is 7.9-8.0, enzyme solution 1 or enzyme solution 2 (maleic acid isomerase 4000-6000U/L) is added, 83mg (about 2-3 ten thousand U/L, powder) of aspartate ammonia lyase is independently added and stirred uniformly, the temperature is controlled at 40 ℃ for reaction, the rotating speed is 110-130rpm, the pH value is 8.0, samples are taken every 1h to determine the residual amount of maleic acid and obtain the conversion rate, the reaction time is 5-7h, and the final conversion rate of the reaction is 99.8-100%.

Example 6Amplification reaction of cell 1 and cell 2-1

Maleic acid substrate (200 g/L) solution is transferred into a 250mL three-neck flask, the reaction volume is 100mL, the initial temperature is controlled at 38 ℃, the pH value is 7.9-8.0, thallus 1 or thallus 2 (3-5 g/L; maleic acid isomerase 4000-6000U/L) is added, 83mg (about 2-3 ten thousand U/L, powder) of aspartate ammonia lyase is independently added and stirred uniformly, the temperature is controlled at 40 ℃ for reaction, the rotating speed is 110-130rpm, the pH value is 8.0, samples are taken every 1h to determine the residual quantity of maleic acid and obtain the conversion rate, the reaction time is 28-48h, and the final conversion rate of the reaction is 99.8-100%.

Example 7Amplification reaction of cell 1 and cell 2-1

Maleic acid substrate (200 g/L) solution is transferred into a 250mL three-neck flask, the reaction volume is 100mL, the initial temperature is controlled at 38 ℃, the pH value is 7.9-8.0, thalli 1 and thalli 2 (5-8 g/L; maleic acid isomerase 4000-6000U/L) are added, 83mg (about 2-3 ten thousand U/L, powder) of aspartate ammonia lyase is independently added and stirred evenly, the temperature is controlled at 40 ℃ for reaction, the rotation speed is 110-130rpm, the pH value is 8.0, samples are taken every 1h to determine the residual amount of maleic acid and obtain the conversion rate, the reaction time is 16-26h, and the final conversion rate of the reaction is 99.8-100%.

Example 8

Enzyme solution 3 and enzyme solution 4 amplification reaction-1

Transferring a maleic acid substrate (200 g/L) solution into a 250mL three-neck flask, controlling the reaction volume to be 100mL, controlling the temperature to be 38 ℃ at the beginning, controlling the pH value to be 7.9-8.0, adding enzyme liquid 3 or enzyme liquid 4 (maleic acid isomerase 2000-3000U/L, aspartic acid ammonia lyase 2-4 ten thousand U/L), uniformly stirring, controlling the temperature to be 40 ℃ for reaction, controlling the rotating speed to be 110-130rpm, controlling the pH value to be 8.0, sampling every 1h, determining the residual quantity of maleic acid and obtaining the conversion rate, wherein the reaction time is 22-36h, and the final conversion rate of the reaction is 99.8-99.9%.

Example 9

Enzyme solution 3 and enzyme solution 4 amplification reaction-2

Transferring the maleic acid substrate (200 g/L) solution into a 250mL three-neck flask, controlling the reaction volume to be 100mL, controlling the temperature to be 38 ℃ at the beginning, controlling the pH value to be 7.9-8.0, adding enzyme liquid 3 or enzyme liquid 4 (maleic acid isomerase 4500-6000U/L, aspartate ammonia lyase 4-8 ten thousand U/L), uniformly stirring, controlling the temperature to be 40 ℃ for reaction, controlling the rotating speed to be 110-130rpm, and controlling the pH value to be 8.0. Sampling every 1h to determine the residual amount of maleic acid and obtain the conversion rate, wherein the reaction time is 4-7h, and the final conversion rate of the reaction is 99.9-99.9%.

Example 10

Cell 3 and cell 4 reaction-1

Maleic acid substrate (200 g/L) solution is transferred into a 250mL three-neck flask, the reaction volume is 100mL, the initial temperature is controlled at 38 ℃, the pH value is 7.9-8.0, and the thallus 3 or thallus 4 (thallus 3-5 g/L) is evenly stirred, the temperature is controlled at 40 ℃ for reaction, the rotating speed is 110-130rpm, and the pH value is 8.0. Sampling every 1h to determine the residual amount of maleic acid and obtain the conversion rate, wherein the reaction time is 28-48h, and the final conversion rate of the reaction is 99.8-99.9%.

Example 11

Cell 3 and cell 4 reaction-2

Maleic acid substrate (200 g/L) solution is transferred into a 250mL three-neck flask, the reaction volume is 100mL, the initial temperature is controlled at 38 ℃, the pH value is 7.9-8.0, and the thallus 3 or thallus 4 (thallus 5-8 g/L) is stirred uniformly, the temperature is controlled at 40 ℃ for reaction, the rotating speed is 110-130rpm, and the pH value is 8.0. Sampling every 1h to determine the residual amount of maleic acid and obtain the conversion rate, wherein the reaction time is 24-28h, and the final conversion rate of the reaction can reach 99.9%.

Example 12

Enzyme solution 3 catalyzed macroreaction

2t (concentration about 18-20%) (ammonium maleate pH 8.5) of the prepared substrate solution was introduced into the reaction vessel, stirring was started, and 0.25kg of magnesium sulfate was added after the temperature was reduced to 38-42 ℃. Adding 20L of maleic acid isomerase concentrated solution (enzyme 3 concentrated solution; 20-25 ten thousand U/L of maleic acid isomerase; 500-1000 ten thousand U/L of aspartic acid ammonia lyase) into a tank, starting reaction, sampling every 1h, recording the temperature change, pH and the acid residual quantity of maleic acid in the reaction tank, and obtaining the conversion rate. The conversion reaction is completed within 12h, and the final conversion rate is more than 98.2 percent.

Example 13

Enzyme solution 4 catalyzed large reaction

2t (concentration about 18-20%) (ammonium maleate pH 8.5) of the prepared substrate solution was introduced into the reaction vessel, stirring was started, and 0.25kg of magnesium sulfate was added after the temperature was reduced to 38-42 ℃. 20L of maleic acid isomerase concentrated solution (enzyme 4 concentrated solution; 25-30 ten thousand U/L of maleic acid isomerase; 500-1000 ten thousand U/L of aspartic acid ammonia lyase) is added into a tank to start reaction, and samples are taken every 1h to record the temperature change, the pH value and the acid residual amount of maleic acid in the reaction tank and obtain the conversion rate. After 6-8h, the conversion reaction is completed, and the final conversion rate is more than 98.2 percent and can reach 99.9 percent at most.

Example 14

Thallus 3 catalytic large reaction

1.5t (the concentration is about 18-20%) of the prepared substrate solution (ammonium maleate with the pH value of 8.5) is pressed into a reaction tank, stirring is started, magnesium sulfate is added at 0.25kg when the temperature is reduced to 38-42 ℃, the final concentration of thalli in the conversion tank is estimated to be 0.8% -1% according to the thalli yield (wet bacterial weight of fermentation liquor per liter) after fermentation is finished, the reaction is started, samples are taken every 1h, the temperature change, the pH value and the acid residual quantity of maleic acid of the reaction tank are recorded, the conversion rate is obtained, the conversion reaction is finished after 36-48h, and the final conversion rate is higher than 97% and can reach 99% at most.

Example 15

Cell 4 catalysisLarge scale reaction

1.5t (the concentration is about 18-20%) (ammonium maleate with pH value of 8.5) of the prepared substrate solution is pressed into a reaction tank, stirring is started, when the temperature is reduced to 38-42 ℃, 0.25kg of magnesium sulfate is added, the fermentation broth of the thallus 4 after fermentation in the fermentation tank is pressed, the final thallus concentration in the conversion tank is estimated to be 0.8% -1% according to the thallus yield (wet thallus weight per liter) after fermentation, the reaction is started, and the temperature change, the pH value and the residual acid amount of the maleic acid in the reaction tank are sampled and recorded every 1h, so that the conversion rate is obtained. After 36-48h, the conversion reaction is completed, and the final conversion rate is more than 98 percent and can reach 99.5 percent at most.

Example 16Product post-extraction process

Keeping the temperature at 80 ℃ for 1h to kill enzyme when the conversion rate reaches more than 98%; adding 1-2 per mill of activated carbon into the reaction tank, and continuously stirring for 1h for decolorization; centrifuging, filtering to remove active carbon, measuring light transmittance, transferring into a crystallizing tank, adding sulfuric acid or maleic acid, adjusting pH to 2.4-2.8, naturally cooling to 70 deg.C, opening cooling water, cooling to about 30 deg.C, crystallizing, and centrifuging. And (4) washing with water, and stopping washing until no sulfuric acid or maleic acid exists. And (4) after the water washing is finished, removing the liquid. And (5) after the liquid removal is finished, preparing for discharging. And opening a screw conveyor button, opening a centrifuge discharge button, and discharging. And (5) measuring indexes such as product content, optical rotation, light transmittance, impurity residue and the like after drying. The conversion rate of the final product aspartic acid is 98.2-99.9%, various parameter indexes meet the standard, the final product aspartic acid is white crystal powder, the purity is 99.78-99.9%, and the final product aspartic acid reaches the export grade.

Example 17Maleic acid application experiment

Taking out supernatant liquid of crystals precipitated after pH adjustment by maleic acid, removing impurities by passing through a 5-10kD cellulose membrane and a nanofiltration membrane, measuring the residual amount of L-aspartic acid in the supernatant liquid, then proportioning the supernatant liquid again with a certain proportion of maleic acid solution, controlling the residual amount of the L-aspartic acid after proportioning to be less than 2%, or controlling the residual amount of the L-aspartic acid in the secondary reaction liquid to be less than 2% by membrane adsorption treatment, starting the next batch of reaction, wherein the first batch can reach 99.5% of conversion rate, and the later batch can also reach more than 98% of conversion rate. The accumulated recycling batch can be used for 5-10 times.

Example 18Enzyme storage stability

The

enzyme solution

1 and 2 are refrigerated for 7-10 days at 4 ℃ and the enzyme activity retention rate is about 78 percent; the

thalli

1 and 2 are refrigerated for 3-4 days at 4 ℃, and the enzyme activity is kept above 80%. The enzyme solution 3 is refrigerated for 11-12 days at 4 ℃ with the enzyme activity retention rate of about 85 percent; the thallus 3 is refrigerated for 3-4 days at 4 ℃, and the enzyme activity is kept above 80%. The enzyme solution 4 is refrigerated at 4 ℃ for 12-15 days, and the enzyme activity retention rate is about 85 percent; the thallus 4 is stored at 4 ℃ for 4-5 days, and the enzyme activity is kept above 80%.

The above description of the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art may make various changes and modifications without departing from the spirit of the present invention, which should fall within the scope of the appended claims.

Claims

1. A maleic acid isomerase mutant, the amino acid sequence of which is shown in SEQ ID NO. 3.

2. A nucleic acid molecule encoding the mutant maleate isomerase of claim 1.

3. The nucleic acid molecule of claim 1, wherein the nucleotide sequence of said nucleic acid molecule is set forth in SEQ ID No. 4.

4. A vector comprising the nucleic acid molecule of claim 2 or 3.

5. The vector of claim 4, wherein the vector is a recombinant vector.

6. The vector of claim 4 or 5, wherein the vector is a recombinant expression vector.

7. The vector of claim 4 or 5, wherein the vector is a recombinant expression vector for expression in bacteria.

8. A host cell comprising the vector of any one of claims 4 to 7.

9. The host cell of claim 8, wherein the host cell is a host cell for expressing the maleate isomerase mutant from the vector.

10. The host cell of claim 8 or 9, wherein the host cell is a bacterial cell.

11. Use of the mutant maleate isomerase enzyme of claim 1, the nucleic acid molecule of claim 2 or 3, the vector of any one of claims 4 to 7 or the host cell of any one of claims 8 to 10 to catalyse the isomerization of maleic acid to fumaric acid.

12. Use of the mutant maleate isomerase of claim 1, the nucleic acid molecule of claim 3 or 2, the vector of any one of claims 4 to 7 or the host cell of any one of claims 8 to 10 for the production of L-aspartic acid using maleic acid as a substrate.

13. A gene construct, which comprises a gene sequence for coding L-aspartic acid ammonia lyase and a gene sequence for coding a mutant of maleic acid isomerase, wherein the amino acid sequence of the mutant of maleic acid isomerase is shown as SEQ ID NO. 3.

14. The genetic construct of claim 13, further comprising a ribosome binding sequence having the amino acid sequence set forth in SEQ ID No. 5.

15. A vector comprising the genetic construct of claim 13 or 14.

16. The vector of claim 15, wherein the vector is a recombinant vector.

17. The vector of claim 15 or 16, wherein the vector is a recombinant expression vector.

18. The vector according to claim 15 or 16, wherein the vector is a recombinant expression vector for expression in bacteria.

19. A host cell comprising the vector of any one of claims 15 to 18.

20. The host cell of claim 19, wherein the host cell is a host cell for expressing the L-aspartate ammonia lyase and the maleate isomerase mutant from the vector.

21. The host cell of claim 19 or 20, wherein the host cell is a bacterial cell.

22. Use of the genetic construct of claim 13 or 14, the vector of any one of claims 15 to 18 or the host cell of any one of claims 19 to 21 for the production of L-aspartic acid using maleic acid as a substrate.

23. A method for producing L-aspartic acid using maleic acid as a substrate, the method comprising using the mutant maleate isomerase of claim 1, the nucleic acid molecule of claim 2 or 3, the vector of any one of claims 4 to 7, or the host cell of any one of claims 8 to 10, and a maleic acid ammonia lyase as a substrate to convert the substrate in one step to synthesize L-aspartic acid.

24. A method for producing L-aspartic acid using maleic acid as a substrate, the method comprising synthesizing L-aspartic acid using maleic acid as a substrate by one-step transformation of the substrate with the genetic construct of claim 13 or 14, the vector of any one of claims 15 to 18, or the host cell of any one of claims 19 to 21.

25. The method according to claim 23 or 24, wherein the enzyme activity ratio of the enzyme involved in the conversion is: the maleic acid isomerase mutant/L-aspartic acid ammonia lyase is 120-150U/2000-4000U.

26. The method of claim 23 or 24, wherein the conversion starting concentration of maleic acid is 180-200g/L.

27. The method according to claim 23 or 24, characterized in that the method comprises: the reaction temperature was 40 ℃ and the pH was 8.0.

28. The method of claim 23 or 24, further comprising recycling maleic acid, comprising: after the conversion reaction is finished, regulating pH by using maleic acid to precipitate crystals, removing impurities from the obtained supernatant, adding maleic acid, and controlling the content of L-aspartic acid to be below 2% for the next conversion reaction.