CN114214261A - Escherichia coli genetic engineering bacterium for expressing esterase EstS and application thereof - Google Patents

Escherichia coli genetic engineering bacterium for expressing esterase EstS and application thereof Download PDF

Info

Publication number
CN114214261A
CN114214261A CN202111589724.0A CN202111589724A CN114214261A CN 114214261 A CN114214261 A CN 114214261A CN 202111589724 A CN202111589724 A CN 202111589724A CN 114214261 A CN114214261 A CN 114214261A
Authority
CN
China
Prior art keywords
ests
escherichia coli
esterase
chroman
fluoro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111589724.0A
Other languages
Chinese (zh)
Other versions
CN114214261B (en
Inventor
高蓓
魏东芝
王风清
江敏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Original Assignee
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology filed Critical East China University of Science and Technology
Priority to CN202111589724.0A priority Critical patent/CN114214261B/en
Publication of CN114214261A publication Critical patent/CN114214261A/en
Application granted granted Critical
Publication of CN114214261B publication Critical patent/CN114214261B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
    • C12P41/003—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by ester formation, lactone formation or the inverse reactions
    • C12P41/005—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by ester formation, lactone formation or the inverse reactions by esterification of carboxylic acid groups in the enantiomers or the inverse reaction

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses an escherichia coli genetic engineering bacterium for expressing esterase EstS, which is prepared by cloning a target fragment with an EstS gene sequence shown as SEQ ID NO.3 into an expression vector and then transforming the expression vector into escherichia coli BL21(DE3) competent cells. The invention discloses application of escherichia coli genetic engineering bacteria for expressing esterase EstS. The invention also discloses a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by resolution by a microbial enzyme method, wherein escherichia coli genetic engineering bacteria for expressing esterase EstS is used as a catalyst, and racemic 6-fluoro-chroman-2-carboxylic acid methyl ester is used as a substrate for reaction, so that excellent stereoselectivity is provided by the method. Meanwhile, the invention realizes the resolution preparation of (S) -6-fluoro-chroman-2-carboxylic acid by esterase EstS for the first time.

Description

Escherichia coli genetic engineering bacterium for expressing esterase EstS and application thereof
Technical Field
The invention belongs to the technical field of pharmaceutical biochemical engineering, and particularly relates to escherichia coli genetic engineering bacteria for expressing esterase EstS and a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by splitting the escherichia coli genetic engineering bacteria.
Background
6-fluoro-chroman-2-carboxylic acid is an important pharmaceutical intermediate. The chemical name is 6-fluoro-3, 4-dihydro-2H-1-benzopyran-2-formic acid, and the chemical formula is C10H9O3F has a molecular weight of 196.18 and a structural formula:
Figure BDA0003429434270000011
the chroman building blocks of 6-fluoro-chroman are found in many biologically active molecular structures. For example, the structures are widely included in vitamin E and many antihypertensive agents that antagonize the beta receptor. Optically pure 6-fluoro-chroman-2-carboxylic acid is used for synthesizing novel antihypertensive drug (S, R, R, R) -nebivolol. The (S, R, R, R) -nebivolol is a third-generation heart highly selective beta 1 receptor blocker with a vasodilatation effect, is mainly used for treating primary hypertension, can effectively control hypertension and maintain the function of the left ventricle, and has the advantages of low dosage, less side effect, good tolerance and the like.
6-fluoro-chroman-2-carboxylic acid is a key intermediate for the preparation of nebivolol, and its resolution efficiency determines the final result of the synthetic process for preparing nebivolol. However, there are few reports on the resolution method of 6-fluoro-chroman-2-carboxylic acid (R) -, (S) -optical isomer. Heretofore, chemical methods, biological resolution methods, and the like have been commonly used for the resolution of organic acids. The literature reports the resolution of racemic 6-fluoro-3, 4-dihydro-2H-1-benzopyran-2-carboxylic acid using dehydroabietylamine with a total resolution yield of about 32%. The chemical resolution method has a long process, and the dehydroabietylamine chiral resolution reagent has high price and low efficiency. EP2646426 reports the resolution of racemic ethyl 6-fluoro-chroman-2-carboxylate using an esterase from the fungus Ophiotoma novo-ulmi, separation and purification to give (R) -6-fluoro-chroman-2-carboxylic acid with an ee value of 90.72% and a conversion of 50.28%. The method is simple and convenient to operate and mild in conditions. But the stereoselectivity is not high.
At present, the method on the market mainly uses lipase or esterase for resolution to prepare (R) -6-fluoro-chroman-2-carboxylic acid, and no report on the resolution to prepare (S) -6-fluoro-chroman-2-carboxylic acid by using lipase or esterase exists in the literature, so that other lipase/esterase with high activity and high stereoselectivity is urgently needed to be found. Based on this, the invention develops a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by resolving S-esterase.
Disclosure of Invention
The invention takes racemic 6-fluoro-chroman-2-carboxylic acid methyl ester as a substrate, takes in vitro esterase EstS or freeze-dried thalli (fdcEstS) of recombinant escherichia coli for efficiently expressing the EstS as a catalyst, selectively catalyzes the hydrolysis reaction of the (S) -6-fluoro-chroman-2-carboxylic acid methyl ester, and prepares the optically pure (S) -6-fluoro-chroman-2-carboxylic acid, and has high conversion rate and strong stereorotation. Therefore, the first purpose of the invention is to provide an escherichia coli genetically engineered bacterium for expressing esterase EstS. The second purpose of the invention is to provide the application of the escherichia coli genetic engineering bacteria for expressing esterase EstS. The third purpose of the invention is to provide a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by microbial enzymatic resolution.
In order to achieve the purpose, the invention adopts the following technical scheme:
as a first aspect of the invention, the escherichia coli genetic engineering bacteria for expressing esterase EstS is prepared by cloning a target fragment with an EstS gene sequence shown in SEQ ID NO.3 into an expression vector to obtain a recombinant plasmid, and then transforming the recombinant plasmid into escherichia coli BL21(DE3) competent cells.
According to the invention, the expression vector is a pET-28a (+) expression vector.
As a second aspect of the invention, a preparation method of escherichia coli genetic engineering bacteria for expressing esterase EstS comprises the following steps:
step one, extracting the genome DNA of Geobacillus thermocatenulatus strain BGSC 93A 1;
designing an upstream primer and a downstream primer according to an EstS sequence of the geobacillus thermochains, wherein the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2;
step three, carrying out PCR amplification by taking the genome DNA of the Geobacillus thermocatenulatus strain BGSC 93A1 in the step one as a template to obtain a target DNA fragment, wherein the sequence is shown as SEQ ID NO. 3;
cloning the target DNA fragment to a pET-28a (+) expression vector to obtain a recombinant plasmid;
and step five, transforming the recombinant plasmid into escherichia coli BL21(DE3) competent cells to obtain a recombinant strain.
As a third aspect of the invention, a recombinant plasmid containing an esterase EstS gene is prepared by cloning a target fragment with an EstS gene sequence shown in SEQ ID NO.3 into an expression vector.
According to the invention, the expression vector is a pET-28a (+) expression vector.
As a fourth aspect of the present invention, a method for preparing a recombinant plasmid containing an esterase EstS gene, comprising the steps of:
step one, extracting the genome DNA of Geobacillus thermocatenulatus strain BGSC 93A 1;
designing an upstream primer and a downstream primer according to an EstS sequence of the geobacillus thermochains, wherein the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2;
step three, carrying out PCR amplification by taking the genome DNA of the Geobacillus thermocatenulatus strain BGSC 93A1 in the step one as a template to obtain a target DNA fragment, wherein the sequence is shown as SEQ ID NO. 3;
and step four, cloning the target DNA fragment to a pET-28a (+) expression vector to obtain a recombinant plasmid.
And step five, transforming the recombinant plasmid into escherichia coli BL21(DE3) competent cells to obtain a recombinant strain.
As a fifth aspect of the invention, an esterase EstS gene has an EstS gene sequence shown in SEQ ID NO. 3.
As a sixth aspect of the present invention, a method for preparing an esterase EstS gene, comprising the steps of:
step one, extracting the genome DNA of Geobacillus thermocatenulatus strain BGSC 93A 1;
designing an upstream primer and a downstream primer according to an EstS sequence of the geobacillus thermochains, wherein the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2;
and step three, carrying out PCR amplification by taking the genome DNA of the Geobacillus thermocatenulatus strain BGSC 93A1 in the step one as a template to obtain a target DNA fragment, wherein the sequence is shown as SEQ ID NO. 3.
As a seventh aspect of the invention, the application of the escherichia coli genetic engineering bacteria for expressing esterase EstS in the method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution is provided.
Furthermore, the escherichia coli genetic engineering bacteria for expressing esterase EstS is used as a catalyst in the method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution.
As the eighth aspect of the invention, the method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by resolution by a microbial enzyme method is to use the escherichia coli genetic engineering bacteria for expressing esterase EstS as a catalyst, racemic 6-fluoro-chroman-2-carboxylic acid methyl ester as a substrate, add an organic solvent into a buffer solution with the pH of 6.0-8.5, react for 1-12 hours at the temperature of 20-60 ℃, and then carry out separation and purification.
Preferably, the pH is 7.0.
According to the invention, the organic solvent is one of isopropanol, butanol, toluene, n-hexane, n-heptane or isooctane.
Preferably, the organic solvent is toluene.
According to the invention, the volume percentage of the toluene is 10-50%.
Preferably, the volume percent of toluene is 20-30%.
According to the invention, the concentration of the escherichia coli genetic engineering bacteria for expressing esterase EstS is 10g/L, and the concentration of racemic 6-fluoro-chroman-2-methyl carboxylate is 100-30 OmM.
Preferably, the concentration of racemic 6-fluoro-chroman-2-carboxylic acid methyl ester is 200 mM.
According to the separation and purification, after the reaction is finished, after escherichia coli genetic engineering bacteria expressing esterase EstS are removed by adopting a filtering method, 5M sodium hydroxide solution is added to adjust the pH value to 11-12, an organic phase and a water phase are separated, hydrochloric acid solution is added to the water phase to adjust the pH value to 1-2, ethyl acetate is used for extraction for 3 times, and the solvent is removed by rotary evaporation to obtain the (S) -6-fluoro-chroman-2-carboxylic acid white solid.
The escherichia coli genetic engineering bacteria for expressing esterase EstS has the beneficial effects that: 1. the catalyst can be used in a method for preparing (S) -6-fluorine-chroman-2-carboxylic acid by enzymatic resolution, so that the method for preparing (S) -6-fluorine-chroman-2-carboxylic acid by enzymatic resolution can provide higher stereoselectivity; 2. the (S) -6-fluoro-chroman-2-carboxylic acid is prepared by utilizing esterase EstS resolution for the first time, and the application prospect is good.
The method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by resolution of the microbial enzyme method has the beneficial effects that: the conversion rate is more than 46 percent, the ee value is 95-96 percent, and the method has the characteristics of high reaction efficiency, high stereoselectivity, relatively simple process and the like.
Drawings
FIG. 1 shows the effect of organic solvent ratio on the reaction.
FIG. 2 is a graph showing the effect of temperature on the reaction.
FIG. 3 is a graph showing the effect of pH on the reaction.
FIG. 4 is a liquid phase diagram of (S) -6-fluoro-chroman-2-carboxylic acid.
Detailed Description
The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention. The experimental procedures, in which specific conditions are not specified, in the following examples are generally conducted under conventional conditions, or under conditions provided by the manufacturers.
Example 1 construction of Escherichia coli Gene engineering bacteria and efficient expression of esterase EstS
1. Geobacillus thermocatenulatus strain BGSC 93A1 was recovered using a medium (Peptone 5g, Meat extract 3g, distilled water 1L), aerobically cultured in a constant temperature shaker at 60 ℃ for 12 hours, and the bacterial concentration was measured using an ultraviolet spectrophotometer.
2. Extracting bacterial DNA, namely extracting the bacterial genomic DNA by using a bacterial genomic DNA rapid extraction kit (general Biotech, Shanghai, China) to obtain the Geobacillus thermocatenulatus genomic DNA.
3. Designing a primer according to an esterase EstS gene sequence of the Geobacillus thermocatenulatus strain, wherein an upstream primer and a downstream primer are designed as follows:
an upstream primer: 5' CGCGGATCCATGGTCATTGTTGAAACAGA 3', SEQ ID NO.1, wherein the underlined part is the BamH I recognition site;
a downstream primer: 5' CGCAAGCTTTTACACATGCTCGCGAAACC 3', SEQ ID NO.2, wherein the underlined part is a Hind III recognition site;
4. then, the genome DNA of the Geobacillus thermocatenulatus is taken as a template, and Polymerase Chain Reaction (PCR) is utilized to carry out gene amplification to obtain a PCR product containing the esterase EstS full-length gene, wherein the nucleotide sequence is shown as SEQ ID NO.3, and the amino acid sequence is shown as SEQ ID NO. 4. Wherein, the PCR amplification system is Primer STAR Max 25 mu L; the forward primer and the reverse primer are respectively 1.5 mu L; 22 mu L of water; template 0.5. mu.L.
The nucleotide sequence is as follows:
ATGGTCATTGTTGAAACAGAACGGCTGGCTGATGTGCCGGTGCTTCATGTTGTCAAGCCGGAAAAGCGGGACGCACGGCTGCCGCTCATTTTCTTTATTCACGGCTTTACAAGCGCGAAAGAGCATAATTTGCATTTCGGCTACTTGCTTGCCGAGGCAGGCTATCGCGTTGTGCTTCCCGACGCGCTGTTTCACGGCGAGCGGGACGAAGGTTTGAGCGAGCGGAAATTGCAGCTGTCGTTTTGGGACATTGTCGTGCGCACGATCACCGAAATCGAGGAGATGAAAAACGACCTTGTCAGCCGCGGGCTGGCTGACCAAGAACGGATTGGGCTCGCTGGGACATCGATGGGCGGCATCGTCACATTCGGCGCGCTCGCCGTCTATCCGTGGGTGAAGGCGGCGGTGGCGCTTATGGGCTGCCCGAACTACAGCGCCTTTTTTGACGCGATGATGGAAGAAGCGAAGCGGCGTCAGATCGACATCCCGATGCCGCCGACGCTGTTGGCGCTTGAAAGAGAAAAGCTCGCTCGCTACGATTTATCCAAGCAGCCGGAAACACTCGCCGGGCGGCCGTTGTTCATCTGGCACGGGAAAGCCGACCAAGTCGTCCCGTATAGTTATACATATGAATTTTACCAGCAAATTAAGCCGCTTTATGAAGGAAACGAAGACCGGCTGCAATTCATCGCCGACCCGCACGCCGGCCATAAAGTGACGCGCGAGGCGTTTTTGGAAACGGTGCGCTGGTTTCGCGAGCATGTGTAA，SEQ ID NO.3。
amino acid sequence:
MVIVETERLADVPVLHVVKPEKRDARLPLIFFIHGFTSAKEHNLHFGYLLAEAGYRVVLPDALFHGERDEGLSERKLQLSFWDIVVRTITEIEEMKNDLVSRGLADQERIGLAGTSMGGIVTFGALAVYPWVKAAVALMGCPNYSAFFDAMMEEAKRRQIDIPMPPTLLALEREKLARYDLSKQPETLAGRPLFIWHGKADQVVPYSYTYEFYQQIKPLYEGNEDRLQFIADPHAGHKVTREAFLETVRWFREHV，SEQ ID NO.4。
5. the pET-28a (+) empty plasmid, and the gene with BamH I and Hind III cleavage sites obtained in step 4 (the sequence is shown in SEQ ID NO. 3) were double-digested with BamH I and Hind III, respectively. Recovering large fragments, connecting by using T4DNA ligase, transforming escherichia coli BL21 by a heat shock method, screening by using LB solid culture medium containing 50 mug/mL kanamycin, picking positive clones by a PCR method, extracting positive clone plasmids by using the kit, and obtaining correct clone plasmids by gene sequencing identification, thereby constructing and obtaining the esterase EstS genetic engineering strain lycEstS.
6. The positive recombinant strain (esterase EstS genetically engineered strain lycEstS of step 5) was inoculated into 5mL of LB medium containing 50. mu.g/mL of kanamycin for overnight culture at 37 ℃ and then inoculated into 50mL of fresh LB medium containing 50. mu.g/mL of kanamycin at 1% of the inoculum for further propagation, and when OD600 reached 0.6 to 0.8, IPTG was added to a final concentration of 0.1 mM. After 16-18 hours of induction at 20 ℃, the thalli are collected by centrifugation and then are frozen in a freeze dryer for 12 hours, and freeze-dried bacterial powder is prepared and stored in a refrigerator for later use.
Example 2 separation and purification of (S) -6-fluoro-chroman-2-carboxylic acid and liquid phase detection method
The kinetic resolution of the hydrolysis of methyl (. + -.) -6-fluoro-chroman-2-carboxylate was carried out with the lyophilized powder (lycEstS) prepared in example 1 in 0.1M phosphate buffer, but no good activity and selectivity was observed. Thus, the reaction is carried out in a biphasic system comprising different organic solvents (organic solvent and phosphate buffer).
After the reaction is finished, removing thalli by adopting a filtration method, adding a 5M sodium hydroxide solution to adjust the pH value to 11-12, separating an organic phase and a water phase, then adding a hydrochloric acid solution to adjust the pH value to 1-2 in the water phase, extracting for 3 times by using ethyl acetate, and removing the solvent by rotary evaporation to obtain the (S) -6-fluoro-chroman-2-carboxylic acid white solid. And (4) analyzing by high performance liquid chromatography (chiral column Chirasil-AD-H), and determining the substrate conversion rate and the ee value of the product. The specific analysis conditions were: the column temperature was 25 ℃, the mobile phase was n-hexane-isopropanol (90:10), the flow rate was 1.0mL/mL, and the detection wavelength was 254 nm.
Example 3 conditions for preparation of (S) -6-fluoro-chroman-2-carboxylic acid were examined using lyophilized E.coli cells (lycEstS) as a catalyst
The reaction system comprises: thalli, (+/-) -6-fluoro-chroman-2-carboxylic acid methyl ester, organic solvent, reaction temperature, reaction time, reaction pH, substrate concentration, buffer, and (+/-) -6-fluoro-chroman-2-carboxylic acid methyl ester as a substrate.
Using the recombinant E.coli cells (esterase EstS genetic engineering strain of step 5) in example 1 as an enzyme source, the selection of an organic solvent, the ratio of the organic solvent to be added, the reaction temperature, the reaction pH, the substrate concentration and other factors were examined to improve the space-time yield of the target product (S) -6-fluoro-chroman-2-carboxylic acid.
1. Investigating the influence of the selected organic solvent on the reaction
In a 10mL reaction system, the thallus concentration is 10 g/L; the dosage of the (+/-) -6-fluoro-chroman-2-carboxylic acid methyl ester is 100 mM; the ratio of organic solvent to PB Buffer (pH7.4) was 1: 4; the reaction temperature is 30 ℃; the reaction time was 6 h. The organic solvent selected includes isopropanol, butanol, toluene, n-hexane, n-heptane, and isooctane. The results are shown in Table 1.
TABLE 1 Effect of organic solvents on the reaction
Organic solvent log P Conversion (%) ee(％)
Isopropanol (I-propanol) 0.38 65.3 21.3
Butanol 0.88 10.2 2.7
Toluene 2.5 46.6 99.0
N-hexane 3.5 38.4 81.4
N-heptane 4.0 71.7 27.5
Isooctane 4.5 87.8 24.6
The results show that: the organic solvent selected had good toluene conversion and ee value.
2. The effect of toluene and PB Buffer (pH7.4) on the reaction was examined.
In a 10mL reaction system, the thallus concentration is 10 g/L; the dosage of the (+/-) -6-fluoro-chroman-2-carboxylic acid methyl ester is 100 mM; the reaction temperature is 30 ℃; the reaction pH was 7.4; the reaction time was 6 h. The proportion of toluene selected to the total volume was 10%, 20%, 30%, 40%, 50% (v/v). The results are shown in FIG. 1.
The results in FIG. 1 show that the ee values at 20% and 30% by volume of toluene are good.
3. The effect of temperature on the reaction was examined.
In a 10mL reaction system, the thallus concentration is 10 g/L; the dosage of the (+/-) -6-fluoro-chroman-2-carboxylic acid methyl ester is 100 mM; the ratio of toluene to PB Buffer (pH7.4) was 1: 3; the reaction time was 6 h. The reaction temperature is 20-60 ℃. The results are shown in FIG. 2.
The results in FIG. 2 show that the ee value and the conversion are good at reaction temperatures of 30 ℃ and 40 ℃.
4. The effect of pH on the reaction was examined.
In a 10mL reaction system, the thallus concentration is 10 g/L; the dosage of the (+/-) -6-fluoro-chroman-2-carboxylic acid methyl ester is 100 mM; the ratio of toluene to Buffer is 1: 3; the reaction time was 6 h. The reaction pH chosen was 6, 6.5, 7, 7.5, 8, 8.5. The results are shown in FIG. 3.
The results in FIG. 3 show that the ee and conversion are good when the reaction pH is 7.0.
5. The effect of substrate concentration on the reaction was examined. In a 10mL reaction system, the ratio of toluene to Buffer is 1: 3; the reaction temperature is 30 ℃; the reaction pH was 7.0. The substrate concentrations chosen were 100, 200, 300, 400 mM. The results are shown in Table 2.
TABLE 2 influence of substrate concentration on the reaction
Concentration of substrate Reaction time Conversion (%) ee(％)
100mM 1.5h 48.9 99.2
200mM 4h 49.1 99.1
300mM 6h 45.7 98.8
400mM 8h 38.0 98.5
The results in Table 2 show that the conversion and the ee value are good at substrate concentrations of 100mM, 200mM and 300 mM.
Example 4
Using colibacillus thallus (esterase EstS genetic engineering strain in step 5) as enzyme source, and adopting enzyme method to split (+/-) -6-fluorine-chroman-2-methyl carboxylate to produce (S) -6-fluorine-chroman-2-carboxylic acid
According to the optimum resolution conditions determined in example 3, using the lyophilized E.coli cells of example 1 above as a catalyst, 2g of cells, (. + -.) -6-fluoro-chroman-2-carboxylic acid methyl ester 200mM, toluene and PB Buffer (pH7.0) were added to 0.2 liter of the reaction mixture at a ratio of 1: 3; the reaction temperature is 30 ℃, the conversion time is 6h, and the hydrolysis resolution of the (+/-) -6-fluoro-chroman-2-carboxylic acid methyl ester is carried out. The liquid phase diagram of (S) -6-fluoro-chroman-2-carboxylic acid is shown in fig. 4 using the separation and purification and liquid phase detection method of (S) -6-fluoro-chroman-2-carboxylic acid of example 2.
As a result, the content of (S) -6-fluoro-chroman-2-carboxylic acid was determined to be 89.3 mM; the conversion was 46.9%; the ee value is 99.07%.
The foregoing is merely an example of the embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of east China's college of science
<120> escherichia coli genetic engineering bacteria for expressing esterase EstS and application thereof
<130> 211157
<141> 2021-12-23
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgcggatcca tggtcattgt tgaaacaga 29
<210> 2
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cgcaagcttt tacacatgct cgcgaaacc 29
<210> 3
<211> 768
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atggtcattg ttgaaacaga acggctggct gatgtgccgg tgcttcatgt tgtcaagccg 60
gaaaagcggg acgcacggct gccgctcatt ttctttattc acggctttac aagcgcgaaa 120
gagcataatt tgcatttcgg ctacttgctt gccgaggcag gctatcgcgt tgtgcttccc 180
gacgcgctgt ttcacggcga gcgggacgaa ggtttgagcg agcggaaatt gcagctgtcg 240
ttttgggaca ttgtcgtgcg cacgatcacc gaaatcgagg agatgaaaaa cgaccttgtc 300
agccgcgggc tggctgacca agaacggatt gggctcgctg ggacatcgat gggcggcatc 360
gtcacattcg gcgcgctcgc cgtctatccg tgggtgaagg cggcggtggc gcttatgggc 420
tgcccgaact acagcgcctt ttttgacgcg atgatggaag aagcgaagcg gcgtcagatc 480
gacatcccga tgccgccgac gctgttggcg cttgaaagag aaaagctcgc tcgctacgat 540
ttatccaagc agccggaaac actcgccggg cggccgttgt tcatctggca cgggaaagcc 600
gaccaagtcg tcccgtatag ttatacatat gaattttacc agcaaattaa gccgctttat 660
gaaggaaacg aagaccggct gcaattcatc gccgacccgc acgccggcca taaagtgacg 720
cgcgaggcgt ttttggaaac ggtgcgctgg tttcgcgagc atgtgtaa 768
<210> 4
<211> 255
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Met Val Ile Val Glu Thr Glu Arg Leu Ala Asp Val Pro Val Leu His
1 5 10 15
Val Val Lys Pro Glu Lys Arg Asp Ala Arg Leu Pro Leu Ile Phe Phe
20 25 30
Ile His Gly Phe Thr Ser Ala Lys Glu His Asn Leu His Phe Gly Tyr
35 40 45
Leu Leu Ala Glu Ala Gly Tyr Arg Val Val Leu Pro Asp Ala Leu Phe
50 55 60
His Gly Glu Arg Asp Glu Gly Leu Ser Glu Arg Lys Leu Gln Leu Ser
65 70 75 80
Phe Trp Asp Ile Val Val Arg Thr Ile Thr Glu Ile Glu Glu Met Lys
85 90 95
Asn Asp Leu Val Ser Arg Gly Leu Ala Asp Gln Glu Arg Ile Gly Leu
100 105 110
Ala Gly Thr Ser Met Gly Gly Ile Val Thr Phe Gly Ala Leu Ala Val
115 120 125
Tyr Pro Trp Val Lys Ala Ala Val Ala Leu Met Gly Cys Pro Asn Tyr
130 135 140
Ser Ala Phe Phe Asp Ala Met Met Glu Glu Ala Lys Arg Arg Gln Ile
145 150 155 160
Asp Ile Pro Met Pro Pro Thr Leu Leu Ala Leu Glu Arg Glu Lys Leu
165 170 175
Ala Arg Tyr Asp Leu Ser Lys Gln Pro Glu Thr Leu Ala Gly Arg Pro
180 185 190
Leu Phe Ile Trp His Gly Lys Ala Asp Gln Val Val Pro Tyr Ser Tyr
195 200 205
Thr Tyr Glu Phe Tyr Gln Gln Ile Lys Pro Leu Tyr Glu Gly Asn Glu
210 215 220
Asp Arg Leu Gln Phe Ile Ala Asp Pro His Ala Gly His Lys Val Thr
225 230 235 240
Arg Glu Ala Phe Leu Glu Thr Val Arg Trp Phe Arg Glu His Val
245 250 255

Claims (10)

1. An escherichia coli genetic engineering bacterium for expressing esterase EstS is characterized in that a target fragment with an EstS gene sequence shown as SEQ ID NO.3 is cloned into an expression vector to obtain a recombinant plasmid, and then the recombinant plasmid is transformed into escherichia coli BL21(DE3) competent cells to prepare the escherichia coli genetic engineering bacterium.
2. The genetically engineered escherichia coli for expressing esterase EstS of claim 1, wherein the expression vector is a pET-28a (+) expression vector.
3. A method for preparing the esterase EstS-expressing Escherichia coli genetic engineering bacteria as claimed in claim 1 or 2, comprising the steps of:
step one, extracting the genome DNA of Geobacillus thermocatenulatus strain BGSC 93A 1;
designing an upstream primer and a downstream primer according to an EstS sequence of the geobacillus thermochains, wherein the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2;
step three, carrying out PCR amplification by taking the genome DNA of the Geobacillus thermocatenulatus strain BGSC 93A1 in the step one as a template to obtain a target DNA fragment, wherein the sequence is shown as SEQ ID NO. 3;
cloning the target DNA fragment to a pET-28a (+) expression vector to obtain a recombinant plasmid;
and step five, transforming the recombinant plasmid into escherichia coli BL21(DE3) competent cells to obtain a recombinant strain.
4. A recombinant plasmid containing an esterase EstS gene is characterized in that the recombinant plasmid is prepared by cloning a target fragment with an EstS gene sequence shown in SEQ ID NO.3 into an expression vector.
5. An esterase EstS gene, which has an EstS gene sequence shown as SEQ ID NO. 3.
6. An application of the escherichia coli genetic engineering bacteria expressing esterase EstS as claimed in claim 1 or 2 in a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution.
7. An escherichia coli genetically engineered bacterium expressing esterase EstS as described in claim 1 or 2, for use as a catalyst in a method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by enzymatic resolution.
8. A method for preparing (S) -6-fluoro-chroman-2-carboxylic acid by resolution by a microbial enzyme method is characterized in that escherichia coli genetic engineering bacteria expressing esterase EstS as claimed in claim 1 or 2 is used as a catalyst, racemic 6-fluoro-chroman-2-carboxylic acid methyl ester is used as a substrate, an organic solvent is added into a buffer solution with the pH value of 6.0-8.5, the reaction is carried out for 1-12 hours at the temperature of 20-60 ℃, and then separation and purification are carried out.
9. The method of claim 8, wherein the organic solvent is one of isopropanol, butanol, toluene, n-hexane, n-heptane, or isooctane.
10. The method as claimed in claim 8, wherein the separation and purification comprises removing genetically engineered escherichia coli expressing esterase EstS by filtration after the reaction is completed, adding 5M sodium hydroxide solution to adjust the pH to 11-12, separating an organic phase and an aqueous phase, adding hydrochloric acid solution to adjust the pH to 1-2 in the aqueous phase, extracting for 3 times with ethyl acetate, and removing the solvent by rotary evaporation to obtain the (S) -6-fluoro-chroman-2-carboxylic acid white solid.
CN202111589724.0A 2021-12-23 2021-12-23 Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof Active CN114214261B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111589724.0A CN114214261B (en) 2021-12-23 2021-12-23 Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111589724.0A CN114214261B (en) 2021-12-23 2021-12-23 Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof

Publications (2)

Publication Number Publication Date
CN114214261A true CN114214261A (en) 2022-03-22
CN114214261B CN114214261B (en) 2024-04-09

Family

ID=80705319

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111589724.0A Active CN114214261B (en) 2021-12-23 2021-12-23 Escherichia coli genetically engineered bacterium for expressing esterase EstS and application thereof

Country Status (1)

Country Link
CN (1) CN114214261B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110791488A (en) * 2019-12-05 2020-02-14 西南交通大学 Lipase for splitting chiral compound and preparation method and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110791488A (en) * 2019-12-05 2020-02-14 西南交通大学 Lipase for splitting chiral compound and preparation method and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
EUNHYE JO等: "Identification and characterization of a novel thermostable GDSL-type lipase from Geobacillus thermocatenulatus", J MICROBIOL BIOTECHNOL., vol. 31, no. 3, pages 483 - 491 *
LEE, Y.-J.等: "GenBank: AST00345.1", GENBANK *
LEE, Y.-J.等: "GenBank: CP018058.1", GENBANK *
MIN JIANG等: "Sequential resolution of (S) and (R)-6- fl uoro- chroman-2-carboxylic acid by two esterases in turn", (S)-6-FLUOROCHROMAN-2-CARBOXYLIC ACID, vol. 24, pages 3235 *

Also Published As

Publication number Publication date
CN114214261B (en) 2024-04-09

Similar Documents

Publication Publication Date Title
CN107858340B (en) High-catalytic-activity D-fructose-6-phosphate aldolase A mutant, recombinant expression vector, genetically engineered bacterium and application thereof
CN113430181B (en) Bacterial laccase derived from Asian elephant intestinal metagenome and gene thereof
EP3591062A1 (en) Long-chain dibasic acid with low content of hydroxyl acid impurity and production method thereof
CN111454918B (en) Enol reductase mutant and application thereof in preparation of (R) -citronellal
CN113637654A (en) Recombinant phospholipase D mutant and application thereof in synthesis of phosphatidylserine
CN110592045B (en) Recombinant esterase, gene, engineering bacterium and application of recombinant esterase to resolution of (R, S) -indoline-2-ethyl formate
CN109897870B (en) Method for preparing 10-hydroxy-2-decenoic acid from capric acid as raw material by using escherichia coli engineering bacteria
CN112175839A (en) D-pantoic acid lactone hydrolase, producing strain, genetic engineering strain and application thereof
CN114085820B (en) Ketopantolactone reductase from Candida viswanathii
CN113913399B (en) Ketopantolactone reductase from Candida maltosa Xu316
CN114214261A (en) Escherichia coli genetic engineering bacterium for expressing esterase EstS and application thereof
WO2019123166A1 (en) Nucleotide sequences encoding 3-quinuclidinone reductase and glucose dehydrogenase and soluble expression thereof
CN113652408B (en) Carbonyl reductase mutant and application thereof in synthesis of (R) -4-chloro-3-hydroxybutyrate ethyl ester
CN114149956A (en) Escherichia coli genetic engineering bacterium for expressing esterase EstR and application thereof
CN115433721A (en) Carbonyl reductase mutant and application thereof
CN109182286B (en) Improved cyano reductase and application thereof in synthesis of 3-chloropyrazine-2 methylamine
CN114150036B (en) Continuous biphasic batch resolution process for preparing optically pure 6-fluoro-chroman-2-carboxylic acid
CN109943618B (en) Application of recombinant lipase in resolution of (R, S) -alpha-ethyl-2-oxo-1-pyrrolidine methyl acetate
US9670493B2 (en) Low-phosphate repressible promoter
EP3591043A1 (en) A long-chain dibasic acid with low content of fatty acid impurity and a method of producing the same
CN113025671B (en) Application of nitrile hydratase derived from sinorhizobium meliloti in preparation of amide pyrazine compounds
CN110004119B (en) -ketoester reductase mutant and application thereof in catalyzing and synthesizing (R) -alpha-lipoic acid precursor
CN115029329B (en) Carbonyl reductase mutant and application thereof in preparation of R-mandelic acid
CN113249348B (en) Carbonyl reductase, gene thereof, recombinant expression transformant containing the gene and use thereof
CN115011569B (en) Bose NemR-PS mutant and application thereof in preparation of (S) -citronellol

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant