CN114181966A

CN114181966A - Method for creating corn dwarfing material based on Zm00001d008708 gene

Info

Publication number: CN114181966A
Application number: CN202111405976.3A
Authority: CN
Inventors: 宋广树; 吕庆雪; 王宝宝; 周德龙; 高嵩
Original assignee: Jilin Academy of Agricultural Sciences
Current assignee: Jilin Academy of Agricultural Sciences
Priority date: 2021-11-24
Filing date: 2021-11-24
Publication date: 2022-03-15
Anticipated expiration: 2041-11-24
Also published as: CN114181966B

Abstract

The invention discloses a method for creating a corn dwarfing material based on Zm00001d008708 gene, belonging to the technical field of genetic engineering. The invention discloses a method for creating a corn dwarfing material based on Zm00001d008708 gene, which is characterized in that the CRISPR/Cas9 technology is used for carrying out gene editing on the Zm00001d008708 gene of the corn, and further screening to obtain a mutant material containing a target gene deletion fragment, wherein the corn dwarfing material has important breeding value.

Description

Method for creating corn dwarfing material based on Zm00001d008708 gene

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for creating a corn dwarfing material based on Zm00001d008708 gene by using a gene editing technology.

Background

The improvement of the corn yield in the twentieth century mainly depends on the improvement of the planting density of the corn in a unit area, but the over-high density is accompanied by the risk of lodging, the yield can be reduced, and therefore, the reduction of the plant height of the corn to a certain extent is beneficial to the improvement of the corn yield. At the end of the last 60 s, the famous green revolution opened the vernicity that semi-dwarf plants could improve yield. High yielding varieties of semi-dwarf rice and wheat were successfully created during the "green revolution". Many maize dwarf mutants have been identified over the past few decades, but have not been fully applied to maize breeding.

The traditional method for creating the short-stalk corn is mainly a backcross transformation method, and usually needs 6 backcross generations, so that not only is the time consumption long, but also gene redundancy is frequently accompanied, so that some non-target characters are introduced, and the application effect of improved materials is limited. Zm00001d008708 is a DUF1421 structural family protein, and the function is unknown at present.

Therefore, the problem to be solved by the technical personnel in the field is to provide a method for creating a maize dwarfing material based on the Zm00001d008708 gene.

Disclosure of Invention

In view of the above, the invention provides a method for creating a corn dwarfing material based on a Zm00001d008708 gene.

In order to achieve the purpose, the invention adopts the following technical scheme:

a method for creating a corn dwarfing material based on Zm00001d008708 gene comprises the following specific steps:

(1) designing a sgRNA action site based on CRISPR/Cas9 aiming at a gene Zm00001d 008708;

the nucleotide sequence of the sgRNA action site is as follows:

5'-TCCAGCACCAGCGGTTCTTCTGG-3', respectively; SEQ ID No. 3; and

5’-CCGTGCGGAGGCTGACTGAAAAC-3’；SEQ ID NO.4；

(2) PCR amplification of a target fragment is carried out by taking pCBC-MT1T2 plasmid as a template and MT1T2-F, MT1T2-F0, MT2T2-R0 and MT2T2-R as primers;

the primer sequences are as follows:

MT1T2-F：5’-AATAATGGTCTCAGGCGCCAGCACCAGCGGTTCTTC-3’；SEQ ID NO.5；

MT1T2-F0：5’-GCCAGCACCAGCGGTTCTTCGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.6；

MT1T2-R0：5’-TGCGGAGGCTGACTGAAAACGCTTCTTGGTGCC-3’；SEQ ID NO.7；

MT1T2-R：5’-ATTATTGGTCTCTAAACTGCGGAGGCTGACTGAAAA-3’；SEQ ID NO.8；

the PCR reaction system is as follows: 1 μ l of pCBC-MT1T2 plasmid, 0.5 μ l of MT1T2-F, 00.5 μ l of MT1T2-F, 00.5 μ l of MT1T2-R, 0.5 μ l of MT1T2-R, 2 XMix 10 μ l, ddH₂O7 mu l; the PCR amplification reaction program is as follows: 3min at 98 ℃; 30s at 98 ℃, 30s at 57 ℃, 1min at 72 ℃ and 35 cycles; 72 ℃ for 5min, 4 ℃ infinity.

(3) Performing enzyme digestion connection on the target fragment obtained in the step (2) and a vector pBUE411 to construct a Zm00001d008708 gene editing vector pBUE411-2gR-Zm00001d 008708;

the enzyme digestion and connection reaction system is as follows: 2 μ l of the target fragment, pBUE4112 μ l, 10xNEB T4Buffer 1.5 μ l, 10xBSA 1.5 μ l, BsaI 1 μ l, T4 Ligase 1 μ l, ddH2O 6 μ l, Total 15 μ l;

(4) and (3) transferring the gene editing vector pBUE411-2gR-Zm00001d008708 obtained in the step (3) into agrobacterium LBA4404, performing corn genetic transformation, and screening and identifying to obtain a corn dwarfing material.

Two sgRNA action sites are connected in series to the same gene editing vector through different expression cassettes.

The vector carrying Cas9 is pBUE 411.

The corn is Zheng 58 of an inbred line.

According to the technical scheme, compared with the prior art, the invention discloses a method for creating the maize dwarf material by utilizing the gene editing technology based on the Zm00001d008708 gene, the gene editing technology can accurately edit the target gene and does not introduce the peripheral gene, and the invention can accurately knock out Zm00001d008708 by the gene editing technology, so that the height of the maize plant can be accurately reduced, and other agronomic characters are not changed.

The invention discloses the biological function of the corn Zm00001d008708 gene for the first time, carries out gene editing on the corn Zm00001d008708 gene by the CRISPR/Cas9 technology, and further screens and obtains mutant materials containing target gene fragment deletion, and the corn dwarfing materials have important breeding value. The maize dwarfing material created by the invention belongs to a high dwarfing material, has shortened internode development but normal fructification, and can be applied to the production of hybrid maize through reasonable cultivation management measures.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a diagram showing the results of sequencing alignment according to the present invention;

FIG. 2 is a drawing showing mutant strains according to the present invention;

wherein A is a mutant maize plant; b is wild corn plant.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The invention utilizes a gene editing technology to create a maize dwarfing material, designs a sgRNA sequence based on CRISPR/Cas9 aiming at a target gene Zm00001d008708 in maize, connects a DNA fragment containing the sgRNA sequence to a vector carrying Cas9, transforms the maize by using the constructed vector (such as an agrobacterium-mediated method), realizes the site-specific mutation of the gene Zm00001d008708, and further obtains a maize plant with the loss of Zm00001d008708 gene function.

Example 1 construction of Gene editing vectors

(1) The gene for controlling the plant height of the corn is Zm00001d008708 gene, and the nucleotide sequence of the gene is as follows:

ATGAACGCGTCGCAGTTCATGGACAAGCAGATCCTCGGCCTGGCTGCCTCCGCTTCCCCCTCCGGCGGCGGCGCGGGGGGCGGTGGGGGTGTGGATCTCAGCGATCTGATGATACCGATCCCCCAGGAGGACGCCGAGAACCGCCTCGGTCGCCGGCGTAGCAGCACCAGCGTCAACGGAACCGCAGACGACATGCTACCCAGTTATGACTTCCAGCCCATCCGCACTAGTGGCGGCGCCGCGGCCGCCGCCGCGCCTCAGGCCTCGTGGGGGTCGCTCGACTCCAAGGCACCCTCTGCCTCATACAACCTCAAGAGTGCTGGTATATTGGAGCCGCATGTGCTGAAGAAAGTTAGTCATGAGGAAGACAAGAGTAACTTTCCTACAGTTACTATTGCGGATATTGATCGAACCATGAAGAAGTACTCTGATAACCTTTTGCATGCACTGGAAGGTGTAAGCTCAAGGCTTTCACAGATGGAGGGTAGAACACACCAACTCGAAAACTCTGTTGACGAGTTGAAGTTAACAATCGGTAACTATAATGGTAGCACTGATGGAAAACTGAGGAACCTTGAGAACATGCTCAGGGAGGTCCAAGCAGGTGTGCAGATTTTGCGAGACAAGCAGGAAATTGTCGAGACACAGCTCCACCTTGCGAAGCTCCAGACAAACAAAACCGATGGCCAATCATCAGAAAATAGTGGGTCTGGACAGGCTGGTTTACAGCAGCAGCCGGTGGTTCCTCCACAAGCAGCCATTCAGCCACAACAAGTCCTAACCCCTTCGCAACCACCTGCACTTCCTGCCCTTCCTGCTCCAAATGCACCACCTCCACCTCCAACGCTTCAAAACCAATCATCATTACAGTTTCCAAGTCATTTACAACATTCACAGGTACCATCTGTGCCTTCTGTTGCACTGGCACCCACAGTTCCAGCTTTACCAAGGGATGCTTACTATGCCCCATCTGCTCAGCCGACCGAGACCATGCACCAGCAGTATCAAGCTCCGCCAGTTCCACAGCCACAGGCACCTCCTGCACCACCTCAGCAGTACCAATCCCAAACCCAGTTCCCTCAATATGCACAGCCACCTCAGCCTGCAAATGTTAACCCTTCAACTCCCCATGTGCCCCATGCACCCCAGCAACCAGAGGAAACTATGCCTTATGCACCAGCTCAGAGCTATCCACCTAATGCAATCGCTGCACCTTATATGCAACCACCTAGTGGACCTGCTCCTCCTTACTATGGGCAGCAAAACCCTAGCATGTATGAACCTCCTGCAGGCCGGGCTAACCCTGGGCCACCATCATCCTACGGTTCTGGTGGGTACGGGCCACAGGGTGGAGGTAGTTTCTCTGAATCTTATGGTTACACTGGATCTCCTTCCCACCGTGGCAATGCTGGAATGAAGCAGTCTTCACCTTTTGCTCAATCCTCTGGAGGAAGCGGCAGCTATGGCAGTGGCAAGCTCCCTACTGCCCAGATGCTTCCACAAGCAGTGCCGATCAGCTCCTCCAGCACCAGCGGTTCTTCTGGCAATAGAGTGCCACTTGACGATGTAGTGGAGAAGGTTGCTACGATGGGATTCTCAAGAGAGCAGGTGAGAGCAACCGTGCGGAGGCTGACTGAAAACGGGCAGAACGTGGACCTGAATGTGGTGCTCGACAAGCTGATGAACGGATGA；SEQ ID NO.1。

the amino acid sequence of the Zm00001d008708 protein is as follows:

MNASQFMDKQILGLAASASPSGGGAGGGGGVDLSDLMIPIPQEDAENRLGRRRSSTSVNGTADDMLPSYDFQPIRTSGGAAAAAAPQASWGSLDSKAPSASYNLKSAGILEPHVLKKVSHEEDKSNFPTVTIADIDRTMKKYSDNLLHALEGVSSRLSQMEGRTHQLENSVDELKLTIGNYNGSTDGKLRNLENMLREVQAGVQILRDKQEIVETQLHLAKLQTNKTDGQSSENSGSGQAGLQQQPVVPPQAAIQPQQVLTPSQPPALPALPAPNAPPPPPTLQNQSSLQFPSHLQHSQVPSVPSVALAPTVPALPRDAYYAPSAQPTETMHQQYQAPPVPQPQAPPAPPQQYQSQTQFPQYAQPPQPANVNPSTPHVPHAPQQPEETMPYAPAQSYPPNAIAAPYMQPPSGPAPPYYGQQNPSMYEPPAGRANPGPPSSYGSGGYGPQGGGSFSESYGYTGSPSHRGNAGMKQSSPFAQSSGGSGSYGSGKLPTAQMLPQAVPISSSSTSGSSGNRVPLDDVVEKVATMGFSREQVRATVRRLTENGQNVDLNVVLDKLMNG；SEQ ID NO.2。

(2) aiming at the gene Zm00001d008708, the nucleotide sequence of the sgRNA action site is as follows:

5'-TCCAGCACCAGCGGTTCTTCTGG-3', respectively; SEQ ID No. 3; (target 1) and

5'-CCGTGCGGAGGCTGACTGAAAAC-3', respectively; SEQ ID No. 4; (target 2).

Primers were designed based on the selected editing sites and the restriction sites at the multiple cloning sites of the vector pCBC-MT1T2 and pBUE411, and the sequences of the primers were as follows:

MT1T2-F：5’-AATAATGGTCTCAGGCGCCAGCACCAGCGGTTCTTC-3’；SEQ ID NO.5；

MT1T2-F0：5’-GCCAGCACCAGCGGTTCTTCGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.6；

MT1T2-R0：5’-TGCGGAGGCTGACTGAAAACGCTTCTTGGTGCC-3’；SEQ ID NO.7；

MT1T2-R：5’-ATTATTGGTCTCTAAACTGCGGAGGCTGACTGAAAA-3’；SEQ ID NO.8；

(3) the target fragment was amplified by one round of PCR using two pairs of primers MT1T2-F, MT1T2-F0, MT2T2-R0, MT2T2-R, and pCBC-MT1T2 plasmid as template.

The PCR amplification reaction system is as follows: 1 μ l of pCBC-MT1T2 plasmid, 0.5 μ l of MT1T2-F, 00.5 μ l of MT1T2-F, 00.5 μ l of MT1T2-R, 0.5 μ l of MT1T2-R, 2 XMix 10 μ l, ddH₂O 7μl。

The PCR amplification reaction program is as follows: 3min at 98 ℃; 30s at 98 ℃, 30s at 57 ℃, 1min at 72 ℃ and 35 cycles; 72 ℃ for 5min, 4 ℃ infinity.

The obtained target fragment is subjected to enzyme digestion connection with a vector pBUE411, and the reaction system is as follows:

2. mu.l of the target fragment (964bp), pBUE 4112. mu.l, 10 xNBT 4Buffer 1.5. mu.l, 10xBSA 1.5. mu.l, BsaI (NEB) 1. mu.l, T4 Ligase (NEB)/high concentration 1. mu.l, ddH₂O 6μl，Total 15μl。

Reaction conditions are as follows: 5h at 37 ℃, 5min at 50 ℃ and 10min at 80 ℃.

Construct and obtain Zm00001d008708 gene editing vector pBUE411-2gR-Zm00001d 008708.

Example 2 Gene editing vector transfer into Agrobacterium LBA4404

1)CaCl₂Method for preparing agrobacterium tumefaciens competent cells

(1) From YEP plate (Rif)^R，Str^R) A fresh LBA4404 single colony is picked up and inoculated in a YEP liquid culture medium containing 50mg/L Str and 25mg/L Rif, and is subjected to shaking culture at the temperature of 28 ℃ and the rpm of 220 overnight for 24-36 h;

(2) inoculating 2mL of overnight activated logarithmic phase bacterial liquid in 50mL YEP liquid culture medium, and culturing bacterial liquid OD at 20 deg.C₆₀₀To about 0.4 to 0.6;

(3) transferring the bacterial liquid into a 50mL sterile centrifuge tube precooled by ice, carrying out ice bath for 30min, centrifuging for 10min at 4 ℃ by 4,000 Xg, and enriching thalli;

(4) precooling 0.05M CaCl with 10mL of ice₂Suspending thallus, ice-cooling for 30min, centrifuging at 4,000 Xg for 10min at 4 deg.C, and enriching thallus;

(5) precooling 0.05M CaCl with 1mL of ice₂Resuspending the thallus, storing the prepared competent cells at 4 ℃, ensuring the highest transformation efficiency within 24-48 h, or subpackaging 100 mu L of the competent cells into sterile tubes, adding glycerol with the final concentration of 20%, quickly freezing with liquid nitrogen, and storing at-80 ℃.

2) Freeze-thawing method for transforming agrobacterium tumefaciens competent cells

(1) Taking out the agrobacterium-infected state (200 mu L), placing on ice, adding plasmid DNA (1 mu g) when the agrobacterium-infected state is just thawed, placing in liquid nitrogen for 1min, and then placing in a metal bath at 37 ℃ for 5 min;

(2) taking out the centrifuge tube, adding 1mL YEB liquid culture medium (without antibiotics), placing on a shaking bed, and culturing at 28 ℃ for 35h at 180 r/min;

(3) centrifuging at 3000rpm for 1min, taking out excessive supernatant, retaining 100 μ L, resuspending, pouring onto YEB plate culture medium (kan, rif), smearing uniformly, and culturing at 28 deg.C in constant temperature incubator for 36-48 h;

(4) and (4) selecting a monoclonal, detecting and reserving a positive colony. And (3) carrying out PCR identification on bacterial liquid by using a primer OsU3-FD3/TaU 3-RD.

Wherein the OsU3-FD3/TaU3-RD primer sequence is as follows:

OsU3-FD3：5’-GACAGGCGTCTTCTACTGGTGCTAC-3’；SEQ ID NO.9；

TaU3-RD：5’-CTCACAAATTATCAGCACGCTAGTC-3’；SEQ ID NO.10。

reaction system:

bacterial suspension 1. mu.l, OsU3-FD 31. mu.l, TaU3-RD 1. mu.l, 2 × mix 10. mu.l, ddH₂O 7μl，Total 20μl。

The PCR amplification reaction program is as follows: 3min at 98 ℃; 30s at 98 ℃, 45s at 57 ℃, 1min at 72 ℃ and 35 cycles; 72 ℃ for 5min, 4 ℃ infinity.

The colony PCR product size was 831 bp.

Example 3 genetic transformation of maize

(1) Taking embryo material as Zheng 58 of corn inbred line, observing young embryo of corn in the ninth day after pollination, and taking the ear back to the laboratory for embryo taking when the young embryo grows to about 1.5 mm.

(2) Preparing Agrobacterium infection solution, and shaking activated Agrobacterium to specific concentration (OD) in YEB liquid culture medium₅₅₀Bacterial pellets were collected by low speed centrifugation and then treated with inf (composition per liter: 2g of N6 salt and vitamin (sigma), 68.5 g of sucrose, 36 g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2, 4-D1.5 ml) + AS (Acetosyringone, (100mM, 1ml)) liquid medium, and then the suspension is shaken at 25 ℃ for 24h at 75r/min until the concentration is OD₅₅₀The content of the compound is 0.3-0.4.

(3) And (3) washing the immature embryos taken out in the step (1) for 2 times by using an inf + AS (same AS above) liquid culture medium, then adding an agrobacterium infection solution, and infecting for 20min-30 min.

(4) The infected embryos were transferred to a co-cultivation medium (composition: 4g of N6 salt and vitamin, 40 g of sucrose, 30g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2,4-d 1.5ml, 5g of agarose (low EEO), 0.1ml of silver nitrate, 0.4g of L-cysteine, 100mg/ml of DTT, 0.154g) with the scutellum of the embryos facing upwards, the axes of the embryos contacting the surface of the medium, the dishes sealed with a sealing membrane, and cultured in a dark at 20 ℃ for 3 days in an incubator.

(5) The immature embryos were transferred from the co-cultivation medium to a resting medium (composition per liter: 4g of N6 salt and vitamins, 40 g of sucrose, 30g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2,4-d 1.5ml, 0.1ml of silver nitrate, 8.5mg/ml of L-cysteine, 0.4g of 0.5M/L of DTT, 0.154g of Timentin (Timentin, Sigma)100mg), sealed in a petri dish with a sealing film, and cultured in the dark at 28 ℃ for 7 days.

(6) All of the embryos were transferred to selection medium I (composition: 4g of N6 salt and vitamin, 40 g of sucrose, 30g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2,4-d 1.5ml, 0.1ml of silver nitrate, 0.4g of L-cysteine, 0.5M/L of DTT, 0.154g of Timentin, 0.5ml of Bialaphos) and cultured in the dark at 28 ℃ for two weeks.

(7) All of the embryos were transferred to selection medium II (composition: 4g of N6 salt and vitamin, 40 g of sucrose, 30g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2,4-d 1.5ml, 8.5mg/ml of silver nitrate 0.1ml, 100mg/ml of L-cysteine 0.4g, 0.5M/L of DTT 0.154g, 100mg of Timentin, 3mg/ml of Bialaphos 1ml), at which time selection was carried out, and the embryos of bright color were selected and cultured in the dark at 28 ℃ for two weeks.

(8) After two selections, regeneration is started, germination and rooting are carried out in a regeneration medium I (the composition of each liter: MS (Murashige and Skoog) salt (sigma)4.3g, cane sugar 60g, gel 2.5g, 2mg/ml glycine 1ml and Timentin 100mg), and when obvious leaf and root growth is seen, the germination and rooting are transferred to a regeneration medium II (the composition of each liter: MS salts 2.9g, cane sugar 30g, gel 2.5g, 2mg/ml glycine 1ml and Timentin 100 mg). From this step, light culture was performed.

(9) And when 3-4 leaves grow out from the regenerated seedlings, transferring the regenerated seedlings to a greenhouse, checking, reserving positive plants, transferring the regenerated seedlings to soil after 2-3 days of seedling revival, then carrying out normal corn growth management, and measuring the plant height after one week of flowering.

Example 4 identification of transgenic maize plants that undergo editing

Transferring the leaves into soil for one week, screening glufosinate-ammonium, extracting DNA from the leaves of the corn which survives after screening glufosinate-ammonium by adopting a CTAB method, carrying out PCR identification by using Zm00001d008708 gene specific primers, and detecting the amplified product by using 1% agarose gel electrophoresis.

The sequences of Zm00001d008708 gene specific primers are as follows:

Zm00001d008708-CRISPR-F1：5’-CCACCATCATCCTACGGT-3’；SEQ ID NO.11；

Zm00001d008708-CRISPR-R1：5’-CAGGCACAATCAGGTATGC-3’；SEQ ID NO.12；

the reaction system is as follows:

DNA 1μl，Zm00001d008708-CRISPR-F1 1μl，Zm00001d008708-CRISPR-R1 1μl，2×mix 10μl，ddH₂O 7μl，Total 20μl。

the reaction procedure is as follows: 5min at 94 ℃; 30s at 98 ℃, 30s at 58 ℃ and 1min at 72 ℃ for 35 cycles; extension at 72 ℃ for 10min, infinity at 4 ℃.

The primer pair (Zm00001d008708-CRISPR-F1/R1) is used for amplifying the mutation of the target 1 and the target 2, and the product size is about 0.5 Kb; PCR products with the correct band size of the amplified products were sent for sequencing and the sequencing results (Zm00001d008708MT) were compared to the wild type (Zm00001d008708WT) and are shown in FIG. 1 (only mutation sites are shown). 1 mutant strain edited by Zm00001d008708 gene was screened (FIG. 2, A). The homozygous mutant material where editing occurred was significantly shorter than the wild type maize (fig. 2, B) plants. The maize dwarfing material has important breeding value.

The plant heights of the wild type (Zm00001d008708WT) and mutant (Zm00001d008708MT) strains are counted, the average plant height of the wild type plant is 158.2cm, the average plant height of the mutant strain is 135.9cm, and the variance analysis difference between the wild type plant and the mutant strain is obvious.

The invention provides a method for creating a corn dwarfing material, which is characterized in that a corn plant with an edited target gene is prepared according to the method, and then the corn plant with the edited target gene is hybridized, backcrossed, selfed or asexually propagated, so that the corn dwarfing material is created.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Jilin province academy of agricultural sciences

<120> method for creating maize dwarfing material based on Zm00001d008708 gene

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1692

<212> DNA

<213> Artificial Sequence

<400> 1

atgaacgcgt cgcagttcat ggacaagcag atcctcggcc tggctgcctc cgcttccccc 60

tccggcggcg gcgcgggggg cggtgggggt gtggatctca gcgatctgat gataccgatc 120

ccccaggagg acgccgagaa ccgcctcggt cgccggcgta gcagcaccag cgtcaacgga 180

accgcagacg acatgctacc cagttatgac ttccagccca tccgcactag tggcggcgcc 240

gcggccgccg ccgcgcctca ggcctcgtgg gggtcgctcg actccaaggc accctctgcc 300

tcatacaacc tcaagagtgc tggtatattg gagccgcatg tgctgaagaa agttagtcat 360

gaggaagaca agagtaactt tcctacagtt actattgcgg atattgatcg aaccatgaag 420

aagtactctg ataacctttt gcatgcactg gaaggtgtaa gctcaaggct ttcacagatg 480

gagggtagaa cacaccaact cgaaaactct gttgacgagt tgaagttaac aatcggtaac 540

tataatggta gcactgatgg aaaactgagg aaccttgaga acatgctcag ggaggtccaa 600

gcaggtgtgc agattttgcg agacaagcag gaaattgtcg agacacagct ccaccttgcg 660

aagctccaga caaacaaaac cgatggccaa tcatcagaaa atagtgggtc tggacaggct 720

ggtttacagc agcagccggt ggttcctcca caagcagcca ttcagccaca acaagtccta 780

accccttcgc aaccacctgc acttcctgcc cttcctgctc caaatgcacc acctccacct 840

ccaacgcttc aaaaccaatc atcattacag tttccaagtc atttacaaca ttcacaggta 900

ccatctgtgc cttctgttgc actggcaccc acagttccag ctttaccaag ggatgcttac 960

tatgccccat ctgctcagcc gaccgagacc atgcaccagc agtatcaagc tccgccagtt 1020

ccacagccac aggcacctcc tgcaccacct cagcagtacc aatcccaaac ccagttccct 1080

caatatgcac agccacctca gcctgcaaat gttaaccctt caactcccca tgtgccccat 1140

gcaccccagc aaccagagga aactatgcct tatgcaccag ctcagagcta tccacctaat 1200

gcaatcgctg caccttatat gcaaccacct agtggacctg ctcctcctta ctatgggcag 1260

caaaacccta gcatgtatga acctcctgca ggccgggcta accctgggcc accatcatcc 1320

tacggttctg gtgggtacgg gccacagggt ggaggtagtt tctctgaatc ttatggttac 1380

actggatctc cttcccaccg tggcaatgct ggaatgaagc agtcttcacc ttttgctcaa 1440

tcctctggag gaagcggcag ctatggcagt ggcaagctcc ctactgccca gatgcttcca 1500

caagcagtgc cgatcagctc ctccagcacc agcggttctt ctggcaatag agtgccactt 1560

gacgatgtag tggagaaggt tgctacgatg ggattctcaa gagagcaggt gagagcaacc 1620

gtgcggaggc tgactgaaaa cgggcagaac gtggacctga atgtggtgct cgacaagctg 1680

atgaacggat ga 1692

<210> 2

<211> 563

<212> PRT

<213> Artificial Sequence

<400> 2

Met Asn Ala Ser Gln Phe Met Asp Lys Gln Ile Leu Gly Leu Ala Ala

1 5 10 15

Ser Ala Ser Pro Ser Gly Gly Gly Ala Gly Gly Gly Gly Gly Val Asp

20 25 30

Leu Ser Asp Leu Met Ile Pro Ile Pro Gln Glu Asp Ala Glu Asn Arg

35 40 45

Leu Gly Arg Arg Arg Ser Ser Thr Ser Val Asn Gly Thr Ala Asp Asp

50 55 60

Met Leu Pro Ser Tyr Asp Phe Gln Pro Ile Arg Thr Ser Gly Gly Ala

65 70 75 80

Ala Ala Ala Ala Ala Pro Gln Ala Ser Trp Gly Ser Leu Asp Ser Lys

85 90 95

Ala Pro Ser Ala Ser Tyr Asn Leu Lys Ser Ala Gly Ile Leu Glu Pro

100 105 110

His Val Leu Lys Lys Val Ser His Glu Glu Asp Lys Ser Asn Phe Pro

115 120 125

Thr Val Thr Ile Ala Asp Ile Asp Arg Thr Met Lys Lys Tyr Ser Asp

130 135 140

Asn Leu Leu His Ala Leu Glu Gly Val Ser Ser Arg Leu Ser Gln Met

145 150 155 160

Glu Gly Arg Thr His Gln Leu Glu Asn Ser Val Asp Glu Leu Lys Leu

165 170 175

Thr Ile Gly Asn Tyr Asn Gly Ser Thr Asp Gly Lys Leu Arg Asn Leu

180 185 190

Glu Asn Met Leu Arg Glu Val Gln Ala Gly Val Gln Ile Leu Arg Asp

195 200 205

Lys Gln Glu Ile Val Glu Thr Gln Leu His Leu Ala Lys Leu Gln Thr

210 215 220

Asn Lys Thr Asp Gly Gln Ser Ser Glu Asn Ser Gly Ser Gly Gln Ala

225 230 235 240

Gly Leu Gln Gln Gln Pro Val Val Pro Pro Gln Ala Ala Ile Gln Pro

245 250 255

Gln Gln Val Leu Thr Pro Ser Gln Pro Pro Ala Leu Pro Ala Leu Pro

260 265 270

Ala Pro Asn Ala Pro Pro Pro Pro Pro Thr Leu Gln Asn Gln Ser Ser

275 280 285

Leu Gln Phe Pro Ser His Leu Gln His Ser Gln Val Pro Ser Val Pro

290 295 300

Ser Val Ala Leu Ala Pro Thr Val Pro Ala Leu Pro Arg Asp Ala Tyr

305 310 315 320

Tyr Ala Pro Ser Ala Gln Pro Thr Glu Thr Met His Gln Gln Tyr Gln

325 330 335

Ala Pro Pro Val Pro Gln Pro Gln Ala Pro Pro Ala Pro Pro Gln Gln

340 345 350

Tyr Gln Ser Gln Thr Gln Phe Pro Gln Tyr Ala Gln Pro Pro Gln Pro

355 360 365

Ala Asn Val Asn Pro Ser Thr Pro His Val Pro His Ala Pro Gln Gln

370 375 380

Pro Glu Glu Thr Met Pro Tyr Ala Pro Ala Gln Ser Tyr Pro Pro Asn

385 390 395 400

Ala Ile Ala Ala Pro Tyr Met Gln Pro Pro Ser Gly Pro Ala Pro Pro

405 410 415

Tyr Tyr Gly Gln Gln Asn Pro Ser Met Tyr Glu Pro Pro Ala Gly Arg

420 425 430

Ala Asn Pro Gly Pro Pro Ser Ser Tyr Gly Ser Gly Gly Tyr Gly Pro

435 440 445

Gln Gly Gly Gly Ser Phe Ser Glu Ser Tyr Gly Tyr Thr Gly Ser Pro

450 455 460

Ser His Arg Gly Asn Ala Gly Met Lys Gln Ser Ser Pro Phe Ala Gln

465 470 475 480

Ser Ser Gly Gly Ser Gly Ser Tyr Gly Ser Gly Lys Leu Pro Thr Ala

485 490 495

Gln Met Leu Pro Gln Ala Val Pro Ile Ser Ser Ser Ser Thr Ser Gly

500 505 510

Ser Ser Gly Asn Arg Val Pro Leu Asp Asp Val Val Glu Lys Val Ala

515 520 525

Thr Met Gly Phe Ser Arg Glu Gln Val Arg Ala Thr Val Arg Arg Leu

530 535 540

Thr Glu Asn Gly Gln Asn Val Asp Leu Asn Val Val Leu Asp Lys Leu

545 550 555 560

Met Asn Gly

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 3

tccagcacca gcggttcttc tgg 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 4

ccgtgcggag gctgactgaa aac 23

<210> 5

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 5

aataatggtc tcaggcgcca gcaccagcgg ttcttc 36

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 6

gccagcacca gcggttcttc gttttagagc tagaaatagc 40

<210> 7

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 7

tgcggaggct gactgaaaac gcttcttggt gcc 33

<210> 8

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 8

attattggtc tctaaactgc ggaggctgac tgaaaa 36

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 9

gacaggcgtc ttctactggt gctac 25

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 10

ctcacaaatt atcagcacgc tagtc 25

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 11

ccaccatcat cctacggt 18

<210> 12

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 12

caggcacaat caggtatgc 19

Claims

1. A method for creating a corn dwarfing material based on Zm00001d008708 gene is characterized by comprising the following specific steps:

the nucleotide sequence of the sgRNA action site is as follows:

5'-TCCAGCACCAGCGGTTCTTCTGG-3', respectively; SEQ ID No. 3; and

5’-CCGTGCGGAGGCTGACTGAAAAC-3’；SEQ ID NO.4；

the primer sequences are as follows:

MT1T2-F：5’-AATAATGGTCTCAGGCGCCAGCACCAGCGGTTCTTC-3’；SEQ ID NO.5；

MT1T2-F0：5’-GCCAGCACCAGCGGTTCTTCGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.6；

MT1T2-R0：5’-TGCGGAGGCTGACTGAAAACGCTTCTTGGTGCC-3’；SEQ ID NO.7；

MT1T2-R：5’-ATTATTGGTCTCTAAACTGCGGAGGCTGACTGAAAA-3’；SEQ ID NO.8；

the enzyme digestion and connection reaction system is as follows: mu.l of the fragment of interest, pBUE 4112. mu.l, 10xNEB T4Buffer 1.5. mu.l, 10xBSA 1.5. mu.l, BsaI 1. mu.l, T4 Ligase 1. mu.l, ddH₂O 6μl，Total 15μl；

2. The method for creating the maize dwarfing material based on the Zm00001d008708 gene as claimed in claim 1, wherein the PCR reaction system in the step (2) is: 1 μ l of pCBC-MT1T2 plasmid, 0.5 μ l of MT1T2-F, 00.5 μ l of MT1T2-F, 00.5 μ l of MT1T2-R, 0.5 μ l of MT1T2-R, 2 XMix 10 μ l, ddH₂O7 mu l; the PCR amplification reaction program is as follows: 3min at 98 ℃; 30s at 98 ℃, 30s at 57 ℃, 1min at 72 ℃ and 35 cycles; 72 ℃ for 5min, 4 ℃ infinity.