CN112391393B - Application of Zmcps gene in preparation of male sterile line of corn - Google Patents

Abstract

The invention discloses an application of a Zmcps gene in preparation of a male sterile line of corn, belonging to the technical field of genetic engineering. The invention discloses application of Zmcps gene in preparation of a corn male sterile line, and the protein Zmcps affecting male fertility can effectively realize complete abortion of corn pollen, can be further used for male sterile seed production of corn, improves the purity of corn seed production and reduces the seed production cost.

Description

Application of Zmcps gene in preparation of male sterile line of corn

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of a Zmcps gene in preparation of a male sterile line of corn.

Background

In actual grain production, the phenomenon of male sterility generally exists in high-grade crops such as corn, rice, wheat and the like, but most of corn sterile lines are incomplete, and a large amount of inbred line seeds are mixed in hybrid seeds, so that the seed quality is seriously influenced. The male sterile line is a good material for ensuring the purity of the hybrid seeds and reducing the production cost of the seeds.

Heterosis utilization is the major route for high yield in corn. However, hybrids can only be utilized when there is an efficient and economical pollination control method in maize to ensure cross pollination and prevent self pollination. Pollination control mechanisms include mechanical, chemical and genetic methods.

The mechanical methods of hybrid plant production may be applied if the plant has spatially segregated male and female flowers or segregates male and female plants. For example, there are male flowers producing pollen in the apical inflorescence of maize plants, with female flowers along the leaf axis of the stem. Outcrossing of maize is ensured by mechanical detasseling of the female parent to prevent selfing. Although emasculation is currently used in hybrid seed production of plants, such as maize, the above process is labor intensive and expensive, depending on the actual emasculation cost and yield loss of the female parent. In addition, most crop plants have functional male and female organs in the same flower, and emasculation is not a simple process. Although the pollen forming organs can be removed by hand prior to pollen dispersal, the above methods of hybrid production are extremely labor intensive and expensive.

Chemical methods for producing hybrid plants include the use of chemicals to kill or prevent the formation of viable pollen. These chemicals, known as gametocides, are used to impart temporary male sterility. Commercial production of hybrid plants using gametocides is limited due to the cost and effectiveness of chemicals, as well as the duration and reliability of application. One serious limitation of gametocides is their phytotoxic effect, the severity of which depends on the genotype. Other limitations include that these chemicals are not necessarily effective for prolonging the flowering stage of the crop, as the growing new flowers may not be affected. Therefore, repeated applications of the above chemicals are required.

In the nineties of the last century, Mariani et al initiated a new approach to artificially prepare male sterile lines, which transformed tobacco and oilseed rape with expression cassettes constructed using a promoter specific to the anther tapetum from tobacco (TA29) and a ribonuclease gene (Barnase), resulting in the disruption of the anther tapetum of transgenic plants, resulting in the formation of male sterile lines, and affecting other traits of transgenic plants. Besides the construction of male sterile lines by Barnase, many studies show that other functional genes can be widely applied to genetic engineering methods to construct transgenic male sterile plants.

Since the Zmcps gene is cloned, no report related to the creation of Zmcps male sterile line by using a transgenic technology is found so far. Therefore, providing the application of the Zmcps gene in preparing a male sterile line of corn is a problem to be solved urgently by the technical personnel in the field.

Disclosure of Invention

In view of the above, the invention provides an application of Zmcps gene in the preparation of a male sterile line of corn.

In order to achieve the purpose, the invention adopts the following technical scheme:

the nucleotide sequence of the Zmcps gene is shown as SEQ ID NO. 3.

Furthermore, the amino acid sequence of the protein coded by the Zmcps gene is shown as SEQ ID NO. 4.

Further, the Zmcps gene is applied to the preparation of a male sterile line of the corn.

The protein influencing male fertility is firstly separated from a tapetum development regulation gene Zmcps in the corn, can degrade starch in pollen grains, causes the sterility of corn transgenic pollen, has high accuracy, and effectively prevents transgenic crops from transmitting transgenic elements to other wild crop varieties through pollen; can be used for keeping the homozygous recessive state of the male sterile plant; meanwhile, the step of castration in the hybrid seed production process is omitted, the labor input and the influence on the yield are reduced, and the method has great cost benefit.

According to the technical scheme, compared with the prior art, the invention discloses the application of the Zmcps gene in the preparation of the corn male sterile line, the protein Zmcps influencing male fertility can effectively realize the complete abortion of corn pollen, and further can be used for male sterile seed production of corn, the purity of corn seed production is improved, the seed production cost is reduced, and the following beneficial effects are achieved:

(1) first separation: the protein Zmcps affecting male fertility of the present invention was first isolated from a corn variety.

(2) The gene drift is avoided: the gene Zmcps influencing male fertility is derived from corn, and in the later development stage of pollen, when starch in pollen grains is degraded by the Zmcps in advance, the energy source of the pollen grains can be collapsed, so that the development of the pollen is restrained, transgenic pollen sterility is caused, and transgenic crops are effectively prevented from transmitting transgenic elements to other wild crop varieties through the pollen.

(3) The benefit is good, and the accuracy is high: the gene Zmcps influencing male fertility of the invention interferes pollen formation and/or function, has high accuracy and can be used for keeping the homozygous recessive state of male sterile plants; and the step of castration in the hybrid seed production process is omitted, the labor input and the influence on the yield are reduced, and the method has great cost benefit.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a drawing showing the detection result of pollen viability of ZmCPS/ZmCPS of wild type in the present invention;

FIG. 2 is the result of pollen viability detection of transgenic offspring heterozygous ZmCPS/Zmcps.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

EXAMPLE 1 cloning of fragments of order

1) Extraction of plant Total RNA

(1) Respectively wrapping the mortar, the tweezers, the medicine spoon and the triangular flask with tinfoil, and then putting the wrapped mortar, the tweezers, the medicine spoon and the triangular flask into a dry heat sterilization box for sterilization;

(2) 2 days after corn ear emergence, respectively taking 50-100mg of fresh corn tassels in a mortar, adding a proper amount of liquid nitrogen for fully grinding, and then putting the powder into a silicified 1.5mL centrifuge tube;

(3) adding 1mL of Trizol, reversing for 5 times, and standing at room temperature for 5 min;

(4) adding 200 μ L chloroform, shaking vigorously for 15s, standing at room temperature for 5min, centrifuging at 4 deg.C and 12,000 × g for 15 min;

(5) sucking the supernatant into a new siliconized 1.5mL centrifuge tube, adding 500 μ L isopropanol, mixing, standing at room temperature for 10min, centrifuging at 4 deg.C for 15min at 12,000 × g;

(6) removing supernatant, adding 1mL of 75% ethanol, washing precipitate, centrifuging at 4 deg.C and 7,500 Xg for 5 min;

(7) removing ethanol, and adding into a sterile operating platform to perform RNA precipitation and drying;

(8) adding 50 mu L of Rnasefree water to dissolve RNA;

(9) the extracted RNA was detected and stored at-80 ℃.

Note that: in order to prevent RNA degradation, the used Tip head, centrifuge tube and the like are soaked overnight in water treated by 0.1 percent DEPC, and then sterilized under high pressure; dry heat sterilizing mortar, glass ware and medicine spoon at 180 deg.c for 12 hr; the solutions used were prepared using 0.1% DEPC treated water without RNase, and care was taken to change the set to prevent contamination by exogenous RNase.

2) First Strand cDNA Synthesis

First Strand Synthesis kit Using Tiangen cDNA

(1) The reverse transcription reaction liquid is prepared by the following components

(2) Standing at 70 deg.C for 5min on ice rapidly for 2 min.

(3) To the above PCR tube, 5 XFirst-Strand Buffer 4. mu.L, 1. mu.L of TIANCcript M-MLV (200U/. mu.L), and 0.5. mu.L of RNase (40U/. mu.L) were added in a total volume of 20. mu.L.

(4)42 ℃ for 50 min; the reaction was terminated at 95 ℃ for 5 min.

3) PCR amplification of full-length Zmcps Gene

The Zmcps full-length gene primer is designed according to the sequence of GRMZM2G081554 on the MaizeGDB, and the specific primer sequence is as follows:

Zmcps-F：5’-CCCCCGGGACGTGCCTGCATTGCGAT-3’；SEQ ID NO.1；

Zmcps-R：5’-CCGAGCTCTGCTTCTGCTACCATTACTCCTTA-3’；SEQ ID NO.2。

the following reaction components were added in sequence:

PCR amplification was performed as follows:

pre-denaturation at 94 ℃ for 5 min; 40 cycles: denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 1 min; final extension at 72 deg.C for 10min, and storage at 4 deg.C.

5 μ L of the amplification product was subjected to agarose electrophoresis.

4) Recovery of PCR products from electrophoresis gels

PCR products were recovered according to the small gel recovery kit from OMEGA:

(1) quickly cutting off the agarose block containing the target DNA under an ultraviolet lamp, and putting the agarose block into a 1.5mL centrifuge tube;

(2) adding 200-400 μ L Binding Buffer (XP2) into the gel, and carrying out water bath at 58 ℃ for 10min to completely dissolve the gel;

(3) adding the dissolved solution into an adsorption column, centrifuging for 30s at 12,000 Xg, and removing the solution;

(4) adding 300. mu.L Binding Buffer (XP2), centrifuging at 12,000 Xg for 30s, and removing the liquid;

(5) adding 500 μ L of Wash Buffer, standing for 1min, centrifuging at 12,000 × g for 30s, removing liquid, centrifuging at 12,000 × g for 1min, and repeating once;

(6) adding 30 μ L Elutionbuffer, standing for 1min, and centrifuging at 12,000 × g for 1 min;

(7) this was repeated once and the tubes containing the recovered DNA were stored at-20 ℃.

5) Ligation of Zmcps Gene to pGM19-T vector

Taking 4 mu L of gel to recover a product, detecting and quantifying by 1% agarose gel electrophoresis, connecting the recovered target fragment with pMD19-T Vector, and carrying out the following reaction system:

6) conversion of ligation products

(1) Adding 10 mu L of the ligation product into 50 mu L of escherichia coli DH5 alpha competent cells, flicking the tube bottom, mixing uniformly, and carrying out ice bath for 30 min;

(2) heating in water bath at 42 deg.C for 90s (without shaking), and rapidly standing on ice for 2 min;

(3) adding 500 μ L LB liquid culture medium, shaking and culturing at 37 deg.C and 150rpm for 1 h;

(4) respectively taking 50 mu L of bacterial liquid and 100 mu L of bacterial liquid, coating the bacterial liquid on an LB solid plate containing 30 mu L of Amp (50mg/mL), and performing inverted culture in an incubator at 37 ℃ for 12-16 h;

(5) single colonies were picked up in 5mL of liquid LB medium containing 50. mu.L of Amp (50mg/mL) and cultured at 37 ℃ for 12 hours with shaking at 220 rpm.

7) PCR identification of fragments of interest

(1) Preparation of a PCR reaction system:

(2) performing PCR amplification: 5min at 94 ℃; 38 cycles: 30s at 94 ℃, 30s at 56 ℃ and 1min at 72 ℃; final extension at 72 deg.C for 10 min;

(3) taking out 8 μ L of each reaction, and detecting the PCR product by 1.0% agarose gel electrophoresis;

(4) and (3) adding 0.5mL of bacteria liquid into 0.5mL of sterile 30% glycerol to a final concentration of 15% for the identified positive clone, preserving the strain at the temperature of minus 80 ℃, and delivering the strain to a sequencing company for sequencing.

The nucleotide sequence of the Zmcps gene is determined as follows:

ATGAAGCTCCTCTCGCCGGCGGCCGCACCGTCGTCCTCGCCGTTGTTCCCTCCTCGCATCGTCGAAGCTGCAGCTCGTCAATCAGGTCCATGCCGTATCCGCATCCGTATCCGTGGCAAAGCAGCAGCAGCAGGAGGAGGAGGAGGCGCGGGCGCGACGGGGCCCCGCGGCAGCCTCAGGCTCGCCGGGTGGTGGAGAGCGCAGCAGCAGGCCCCGGCCACGGCGACGACAACGCAGCAGCCTGACAACGTCTCCAGTGCTAAAGTGTTCCAGACCAGCCGTGTGGAAACCGAGTCCGAAATTGCGAAATGGCCAGGGAAACCACAAGACCTTGAGGATGAGCACCAGGCTGAGGAGGCAGAGCTGCAGCCACTTATCGACCAGGTGAGGGCGATGCTACGGTCGATGAACGACGGGGATACCAGCGCCTCGGCGTACGACACGGCGTGGGTGGCGATGGTGCCGAAGGTGGGCGGCGACGGCGGCGCCCAGCCCCAGTTCCCGGCCACCGTGCGCTGGATCGTGGACCACCAGCTGCCCGACGGCTCCTGGGGCGACTCGGCCCTGTTCTCCGCCTACGACCGCATGATCAACACCCTCGCCTGCGTCGTCGCGCTGACCAAGTGGTCGCTGGAGCCCGCGAGGTGCGAGGCGGGGCTCTCGTTCCTGCACGAGAACATGTGGAGGCTAGCGGAGGAGGAGGCGGAGTCGATGCCCATCGGCTTCGAGATCGCCTTCCCTTCTCTCATCCAGACGGCTAGGGACCTGGGCGTCGTCGACTTCCCGTACGGACACCCGGCGCTGCAGAGCATATACGCCAACAGGGAAGTCAAGCTGAAGCGGATCCCAAGGGACATGATGCACAGGGTCCCGACGTCCATCCTGCACAGCCTTGAAGGGATGCCTGACCTGGACTGGCCGAGGCTTCTGAACCTCCAGTCCTGCGACGGCTCCTTCTTGTTCTCTCCTTCGGCTACCGCTTACGCGCTGATGCAAACCGGTGACAAGAAGTGCTTCGAATACATCGACAGGATTGTCAAAAAATTCAACGGGGGAGTCCCCAATGTTTATCCGGTCGATCTTTTCGAGCACATCTGGGTTGTGGATCGGTTGGAGCGACTCGGGATCTCCCGCTACTTCCAACGAGAGATTGAGCAGTGCATGGACTATGTGAACAGGCACTGGACTGAAGATGGGATTTGCTGGGCTAGGAAATCCAATGTGAAGGATGTGGATGACACAGCTATGGCTTTCCGACTACTAAGGCTACATGGATACAATGTCTCTCCAAGTGTGTTTAAGAACTTTGAGAAAGATGGAGAGTTCTTTTGTTTTGTGGGCCAATCGACTCAAGCCGTCACTGGGATGTATAACCTCAACAGAGCCTCTCAGATAAGTTTTCAAGGAGAGGATGTATTGCATCGTGCTAGGGTTTTCTCGTATGAGTTTCTGAGACAGAGAGAAGAACAAGGCATGATCCGTGATAAATGGATCGTTGCCAAGGATCTACCTGGCGAGGTGCAATATACACTAGACTTCCCTTGGTATGCAAGCTTGCCTCGTGTAGAGGCAAGAACCTATCTAGATCAATATGGTGGTAAAGATGACGTTTGGATTGGAAAGACACTCTACAGGATGCCTCTTGTGAATAACGACACATATCTAGAGTTGGCAATAAGGGATTTCAACCATTGCCAAGCTCTGCATCAGCTTGAGTGTAATGGGCTGCAAACGTGGTACAAGGATAATTGCCTTGACGCTTTTGGAGTAGAACCACAAGATGTTTTAAGATCTTACTTTTTAGCTGCTGCTTGCATTTTTGAACCTAGCCGTGCTGCTGAGCGGCTTGCATGGGCTAGAACGTCAATGATTGCCAATGCCATTTCTACACATCTTCGTGACATTTCGGAAGACAAAAGATTAATTAACTTATTAGCACAAGAAGCATTGCCAATTCATGAAGGACAAAGATTCATACACAGTCTATTGAGTCTTGCATGGACCGAATGGATGTTGCAAAAGGCAAATAAAGAAGAAAACAAATATCACAAATGCAGTGGTATAGAACCACAATACATGGTTCATGATAGGCAAACATACTTACTTTTAGTTCAGGTTATTGAGATTTGTGCTGGACGAATTGGTGAGGCTGTGTCAATGATAAACAACAAGGATAATGATTGGTTTATTCAACTCACATGTGCTACTTGTGACAGTCTTAACCATAGGATGTTACTGTCCCAGGATACTATGAAGAATGAAGCAAGAATAAATTGGATTGAGAAGGAAATCGAGTTGAATATGCAAGAGCTTGCTCAATCTCTCCTTTTGAGATGTGATGAGAAAACTAGCAATAAGAAGACCAAGAAAACCTTATGGGATGTCCTAAGAAGTTTATACTATGCTACTCATTCCCCACAACATATGATCGATAGACATGTTTCCAGAGTTATCTTTGAGCCTGTTTAA；SEQ ID NO.3。

the amino acid sequence of the protein coded by the Zmcps gene is as follows:

MKLLSPAAAPSSSPLFPPRIVEAAARQSGPCRIRIRIRGKAAAAGGGGGAGATGPRGSLRLAGWWRAQQQAPATATTTQQPDNVSSAKVFQTSRVETESEIAKWPGKPQDLEDEHQAEEAELQPLIDQVRAMLRSMNDGDTSASAYDTAWVAMVPKVGGDGGAQPQFPATVRWIVDHQLPDGSWGDSALFSAYDRMINTLACVVALTKWSLEPARCEAGLSFLHENMWRLAEEEAESMPIGFEIAFPSLIQTARDLGVVDFPYGHPALQSIYANREVKLKRIPRDMMHRVPTSILHSLEGMPDLDWPRLLNLQSCDGSFLFSPSATAYALMQTGDKKCFEYIDRIVKKFNGGVPNVYPVDLFEHIWVVDRLERLGISRYFQREIEQCMDYVNRHWTEDGICWARKSNVKDVDDTAMAFRLLRLHGYNVSPSVFKNFEKDGEFFCFVGQSTQAVTGMYNLNRASQISFQGEDVLHRARVFSYEFLRQREEQGMIRDKWIVAKDLPGEVQYTLDFPWYASLPRVEARTYLDQYGGKDDVWIGKTLYRMPLVNNDTYLELAIRDFNHCQALHQLECNGLQTWYKDNCLDAFGVEPQDVLRSYFLAAACIFEPSRAAERLAWARTSMIANAISTHLRDISEDKRLINLLAQEALPIHEGQRFIHSLLSLAWTEWMLQKANKEENKYHKCSGIEPQYMVHDRQTYLLLVQVIEICAGRIGEAVSMINNKDNDWFIQLTCATCDSLNHRMLLSQDTMKNEARINWIEKEIELNMQELAQSLLLRCDEKTSNKKTKKTLWDVLRSLYYATHSPQHMIDRHVSRVIFEPV；SEQ ID NO.4。

EXAMPLE 2 construction of plant expression vector pCAMBIA3300-35 s-Zmccs

1) Extraction of pMD19-T-Zmcps plasmid

Plasmids were extracted by a small scale method according to the OMEGA plasmid small scale extraction kit:

(1) taking a proper amount of target bacterial liquid cultured overnight into a centrifugal tube of 1.5mL, centrifuging for 1min at the speed of 12,000 Xg, and discarding the filtrate;

(2) adding 250 mu L of solutionI/RNase to resuspend the precipitate;

(3) adding 250 mu L of solutionII, gently and fully turning over for a plurality of times, and fully cracking the thalli;

(4) adding 350 μ L of solutionIII, gently and thoroughly turning over for several times, and centrifuging at 12,000 × g for 10 min;

(5) sucking the supernatant of the step (4) and transferring the supernatant into a preparation tube, centrifuging the supernatant at 12,000 Xg for 1min, and removing liquid;

(6) adding 500 μ L of Buffer HB, centrifuging at 12,000 Xg for 1min, and removing liquid;

(7) add 700. mu.L of Wash Buffer, centrifuge for 1min at 12,000 Xg, remove the liquid, and repeat once;

(8) the preparation tube was placed in a new 1.5mL centrifuge tube, 30. mu.L of Elution Buffer was added to the center of the preparation tube membrane and left to stand at room temperature for 1min, and centrifugation was carried out at 12,000 Xg for 1min, and repeated once, to give pMD19-T-Zmcps plasmid.

2) Double enzyme digestion identification of recombinant plasmid and intermediate vector pCAMBIA3300-35s and gel recovery of target DNA fragment

The plasmid digestion reaction system is as follows:

and (3) carrying out gel recovery on the target DNA fragment subjected to double enzyme digestion.

3) Ligation of plant expression vectors to the Zmccs fragment of interest

Determination of a ligation reaction system: based on the intensity of the agarose gel electrophoresis band, the approximate concentration of the recovered fragment was determined by comparison with Marker, and the relative concentration was estimated as a molar ratio of the target fragment inserted into DNA to the DNA fragment inserted into the vector of 3: 1 or 1: 1, establishing a connection system, carrying out warm bath at 22 ℃ for 5h, carrying out warm bath at 16 ℃ overnight, and transforming the connection product into escherichia coli.

The 10. mu.L ligation was as follows:

4) coli DH5 alpha competent cells and identification of positive clones

The plates for selection of recombinants were LB solid medium containing 50mg/L Kan and cultured overnight at 37 ℃. And (3) selecting a single colony which can normally grow on a culture medium containing Kan, carrying out bacteria liquid PCR, and extracting plasmids of positive bacteria liquid in a small amount. The recombinant expression plasmid pCAMBIA3300-35s-Zmcps is subjected to double enzyme digestion identification of Xma I and Sac I, and the fact that the Zmcps gene is connected to the pCAMBIA3300-35s binary plant expression vector is proved.

EXAMPLE 3pCAMBIA3300-35s-Zmcps transformation of Agrobacterium

1)CaCl₂Method for preparing agrobacterium tumefaciens competent cells

(1) From YEP plate (Rif)^R，Str^R) A fresh EHA105 single colony is selected and inoculated in a YEP liquid culture medium containing 50mg/L Str and 25mg/L Rif, and is subjected to shaking culture at the speed of 220rpm at the temperature of 28 ℃ for 24-36 h overnight;

(2) inoculating 2mL of overnight activated bacteria solution in logarithmic growth phase into 50mL of YEP liquid, and culturing the bacteria solution OD at 20 ℃₆₀₀To about 0.4 to 0.6;

(3) transferring the bacterial liquid into a 50mL sterile centrifuge tube precooled by ice, carrying out ice bath for 30min, centrifuging for 10min at 4 ℃ by 4,000 Xg, and enriching thalli;

(4) precooling 0.05M CaCl with 10mL of ice₂Suspending thallus, ice-cooling for 30min, centrifuging at 4,000 Xg for 10min at 4 deg.C, and enriching thallus;

(5) precooling 0.05M CaCl with 1mL of ice₂Resuspending the thallus, storing the prepared competent cells at 4 ℃, ensuring the highest transformation efficiency within 24-48 h, or subpackaging 100 mu L of the competent cells into sterile tubes, adding glycerol with the final concentration of 20%, quickly freezing with liquid nitrogen, and storing at-80 ℃.

2) Freeze-thawing method for transforming agrobacterium tumefaciens competent cells

(1) The Agrobacterium is taken out of the infected state (200. mu.L), placed on ice, plasmid DNA (1. mu.g) is added when just thawing, placed in liquid nitrogen for 1min, and then placed in a 37 ℃ metal bath for 5 min.

(2) The centrifuge tube was removed, 1mL YEB broth (containing no antibiotics) was added, and the mixture was incubated at 28 ℃ and 180r/min for 35h on a shaker.

(3) Centrifuging at 3000rpm for 1min, taking out excessive supernatant, retaining 100 μ L, resuspending, pouring onto YEB plate culture medium (containing kan, rif resistance), smearing uniformly, and culturing at 28 deg.C in constant temperature incubator for 36-48 h;

(4) and (4) selecting a monoclonal, detecting and reserving a positive colony. And (5) PCR identification of the bacterial liquid.

Example 4 genetic transformation of maize

N6 salts and vitamins, Timentin (Timentin), MS (Murashige and Skoog) salts were purchased from sigma.

(1) Taking an embryo material as a maize inbred line C01, observing maize young embryos at the ninth day after pollination, and taking the ears back to a laboratory to take embryos when the young embryos grow to about 1.5 mm.

(2) Preparing Agrobacterium infection solution, and shaking activated Agrobacterium to specific concentration (OD) in YEB liquid culture medium₅₅₀Bacterial pellets were collected by low speed centrifugation and then treated with inf (composition per liter: 2g of N6 salt and vitamin, 68.5 g of sucrose, 36 g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2, 4-D1.5 ml) + AS (Acetosyringone, (100mM), 1ml)) liquid medium, and then the mixture is resuspended and shaken at 25 ℃ for 24h at 75r/min until the concentration is OD₅₅₀The content of the compound is 0.3-0.4.

(3) And (3) washing the immature embryos taken out in the step (1) for 2 times by using an inf + AS (same AS above) liquid culture medium, then adding an agrobacterium infection solution, and infecting for 20min-30 min.

(4) The infected embryos were transferred to a co-cultivation medium (composition: 4g of N6 salt and vitamin, 40 g of sucrose, 30g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2,4-d 1.5ml, 5g of agarose (low EEO), 0.1ml of silver nitrate, 0.4g of L-cysteine, 100mg/ml of DTT, 0.154g) with the scutellum of the embryos facing upwards, the axes of the embryos contacting the surface of the medium, the dishes sealed with a sealing membrane, and cultured in a dark at 20 ℃ for 3 days in an incubator.

(5) The immature embryos were transferred from the co-cultivation medium to a resting medium (composition: 4g of N6 salt and vitamin, 40 g of sucrose, 30g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2,4-d 1.5ml, 0.1ml of silver nitrate, 0.4g of L-cysteine, 0.5M/L of DT0.154g, 100mg of Timentin per liter), sealed with a sealing film, and cultured in the dark at 28 ℃ for 7 days.

(6) All of the embryos were transferred to selection medium I (composition: 4g of N6 salt and vitamin, 40 g of sucrose, 30g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2,4-d 1.5ml, 0.1ml of silver nitrate, 0.4g of L-cysteine, 0.5M/L of DTT, 0.154g of Tim, 100mg/ml of Bialaphos, 0.5ml per liter) and cultured in the dark at 28 ℃ for two weeks.

(7) All of the embryos were transferred to selection medium II (composition: 4g of N6 salt and vitamin, 40 g of sucrose, 30g of glucose, 0.7 g of L-proline, 0.5g of MES, 1mg/ml of 2,4-d 1.5ml, 0.1ml of silver nitrate, 0.4g of L-cysteine, 0.5M/L of DTT, 0.154g of Tim, 100mg of Bialaphos, 1ml) and they were sorted out and cultured in dark at 28 ℃ for two weeks.

(8) After two selections, regeneration was started, germination and rooting were carried out in regeneration medium I (composition per liter: MS (Murashige and Skoog) 4.3g of salt, 60g of sucrose, 2.5g of gel, 1ml of 2mg/ml glycine, and 100mg of Tim), and when significant leaf and root growth was observed, the regeneration medium II (composition per liter: MS salts 2.9g, 30g of sucrose, 2.5g of gel, 1ml of 2mg/ml glycine, and 100mg of Tim) was transferred. From this step, light culture was performed.

(9) Transferring the regenerated seedlings to a greenhouse when 3-4 leaves grow out, checking, retaining positive plants, transferring the seedlings to soil after 2-3 days of seedling recovering, then carrying out normal corn growth management, taking pollen 1-2 days after flowering, and carrying out pollen activity detection, wherein the result is shown in a figure 1-2.

Corn pollen determination method (iodine-potassium iodide method):

(1) sampling in the field: by adopting a bagging method, starting from the pollen dispersing of the tassels, 9 parts per day in the morning: collecting pollen at 00 hours regularly, mixing uniformly, refrigerating a part of pollen in an ice kettle, and rapidly returning the pollen to the room within 5 minutes for identification.

(2) Indoor determination of pollen viability

Preparing iodine-potassium iodide solution: dissolving 1.3g of potassium iodide in water, adding 0.3g of iodine crystal, and then diluting to 100mL of volume;

placing a small amount of pollen on a clean glass slide, dripping 2 drops of iodine-potassium iodide solution, placing in a 30 ℃ thermostat for 20-30 minutes, observing under a microscope, counting the number of fertile pollen and abortive pollen in the same field of view, and carrying out genetic analysis.

The detection result of the pollen activity of the wild ZmCPS/ZmCPS at the flowering phase is shown in figure 1; the results show that the wild type pollen is all fertile.

The detection result of the pollen activity of the heterozygous ZmCPS/Zmcps at the flowering stage is shown in figure 2; the result shows that the heterozygote pollen is 50% fertile and 50% sterile, and the Zmcps mutant type controls the maize pollen fertility.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Jilin province academy of agricultural sciences

Application of <120> Zmcps gene in preparation of male sterile line of corn

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 1

cccccgggac gtgcctgcat tgcgat 26

<210> 2

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 2

ccgagctctg cttctgctac cattactcct ta 32

<210> 3

<211> 2469

<212> DNA

<213> Artificial Sequence

<400> 3

atgaagctcc tctcgccggc ggccgcaccg tcgtcctcgc cgttgttccc tcctcgcatc 60

gtcgaagctg cagctcgtca atcaggtcca tgccgtatcc gcatccgtat ccgtggcaaa 120

gcagcagcag caggaggagg aggaggcgcg ggcgcgacgg ggccccgcgg cagcctcagg 180

ctcgccgggt ggtggagagc gcagcagcag gccccggcca cggcgacgac aacgcagcag 240

cctgacaacg tctccagtgc taaagtgttc cagaccagcc gtgtggaaac cgagtccgaa 300

attgcgaaat ggccagggaa accacaagac cttgaggatg agcaccaggc tgaggaggca 360

gagctgcagc cacttatcga ccaggtgagg gcgatgctac ggtcgatgaa cgacggggat 420

accagcgcct cggcgtacga cacggcgtgg gtggcgatgg tgccgaaggt gggcggcgac 480

ggcggcgccc agccccagtt cccggccacc gtgcgctgga tcgtggacca ccagctgccc 540

gacggctcct ggggcgactc ggccctgttc tccgcctacg accgcatgat caacaccctc 600

gcctgcgtcg tcgcgctgac caagtggtcg ctggagcccg cgaggtgcga ggcggggctc 660

tcgttcctgc acgagaacat gtggaggcta gcggaggagg aggcggagtc gatgcccatc 720

ggcttcgaga tcgccttccc ttctctcatc cagacggcta gggacctggg cgtcgtcgac 780

ttcccgtacg gacacccggc gctgcagagc atatacgcca acagggaagt caagctgaag 840

cggatcccaa gggacatgat gcacagggtc ccgacgtcca tcctgcacag ccttgaaggg 900

atgcctgacc tggactggcc gaggcttctg aacctccagt cctgcgacgg ctccttcttg 960

ttctctcctt cggctaccgc ttacgcgctg atgcaaaccg gtgacaagaa gtgcttcgaa 1020

tacatcgaca ggattgtcaa aaaattcaac gggggagtcc ccaatgttta tccggtcgat 1080

cttttcgagc acatctgggt tgtggatcgg ttggagcgac tcgggatctc ccgctacttc 1140

caacgagaga ttgagcagtg catggactat gtgaacaggc actggactga agatgggatt 1200

tgctgggcta ggaaatccaa tgtgaaggat gtggatgaca cagctatggc tttccgacta 1260

ctaaggctac atggatacaa tgtctctcca agtgtgttta agaactttga gaaagatgga 1320

gagttctttt gttttgtggg ccaatcgact caagccgtca ctgggatgta taacctcaac 1380

agagcctctc agataagttt tcaaggagag gatgtattgc atcgtgctag ggttttctcg 1440

tatgagtttc tgagacagag agaagaacaa ggcatgatcc gtgataaatg gatcgttgcc 1500

aaggatctac ctggcgaggt gcaatataca ctagacttcc cttggtatgc aagcttgcct 1560

cgtgtagagg caagaaccta tctagatcaa tatggtggta aagatgacgt ttggattgga 1620

aagacactct acaggatgcc tcttgtgaat aacgacacat atctagagtt ggcaataagg 1680

gatttcaacc attgccaagc tctgcatcag cttgagtgta atgggctgca aacgtggtac 1740

aaggataatt gccttgacgc ttttggagta gaaccacaag atgttttaag atcttacttt 1800

ttagctgctg cttgcatttt tgaacctagc cgtgctgctg agcggcttgc atgggctaga 1860

acgtcaatga ttgccaatgc catttctaca catcttcgtg acatttcgga agacaaaaga 1920

ttaattaact tattagcaca agaagcattg ccaattcatg aaggacaaag attcatacac 1980

agtctattga gtcttgcatg gaccgaatgg atgttgcaaa aggcaaataa agaagaaaac 2040

aaatatcaca aatgcagtgg tatagaacca caatacatgg ttcatgatag gcaaacatac 2100

ttacttttag ttcaggttat tgagatttgt gctggacgaa ttggtgaggc tgtgtcaatg 2160

ataaacaaca aggataatga ttggtttatt caactcacat gtgctacttg tgacagtctt 2220

aaccatagga tgttactgtc ccaggatact atgaagaatg aagcaagaat aaattggatt 2280

gagaaggaaa tcgagttgaa tatgcaagag cttgctcaat ctctcctttt gagatgtgat 2340

gagaaaacta gcaataagaa gaccaagaaa accttatggg atgtcctaag aagtttatac 2400

tatgctactc attccccaca acatatgatc gatagacatg tttccagagt tatctttgag 2460

cctgtttaa 2469

<210> 4

<211> 822

<212> PRT

<213> Artificial Sequence

<400> 4

Met Lys Leu Leu Ser Pro Ala Ala Ala Pro Ser Ser Ser Pro Leu Phe

1 5 10 15

Pro Pro Arg Ile Val Glu Ala Ala Ala Arg Gln Ser Gly Pro Cys Arg

20 25 30

Ile Arg Ile Arg Ile Arg Gly Lys Ala Ala Ala Ala Gly Gly Gly Gly

35 40 45

Gly Ala Gly Ala Thr Gly Pro Arg Gly Ser Leu Arg Leu Ala Gly Trp

50 55 60

Trp Arg Ala Gln Gln Gln Ala Pro Ala Thr Ala Thr Thr Thr Gln Gln

65 70 75 80

Pro Asp Asn Val Ser Ser Ala Lys Val Phe Gln Thr Ser Arg Val Glu

85 90 95

Thr Glu Ser Glu Ile Ala Lys Trp Pro Gly Lys Pro Gln Asp Leu Glu

100 105 110

Asp Glu His Gln Ala Glu Glu Ala Glu Leu Gln Pro Leu Ile Asp Gln

115 120 125

Val Arg Ala Met Leu Arg Ser Met Asn Asp Gly Asp Thr Ser Ala Ser

130 135 140

Ala Tyr Asp Thr Ala Trp Val Ala Met Val Pro Lys Val Gly Gly Asp

145 150 155 160

Gly Gly Ala Gln Pro Gln Phe Pro Ala Thr Val Arg Trp Ile Val Asp

165 170 175

His Gln Leu Pro Asp Gly Ser Trp Gly Asp Ser Ala Leu Phe Ser Ala

180 185 190

Tyr Asp Arg Met Ile Asn Thr Leu Ala Cys Val Val Ala Leu Thr Lys

195 200 205

Trp Ser Leu Glu Pro Ala Arg Cys Glu Ala Gly Leu Ser Phe Leu His

210 215 220

Glu Asn Met Trp Arg Leu Ala Glu Glu Glu Ala Glu Ser Met Pro Ile

225 230 235 240

Gly Phe Glu Ile Ala Phe Pro Ser Leu Ile Gln Thr Ala Arg Asp Leu

245 250 255

Gly Val Val Asp Phe Pro Tyr Gly His Pro Ala Leu Gln Ser Ile Tyr

260 265 270

Ala Asn Arg Glu Val Lys Leu Lys Arg Ile Pro Arg Asp Met Met His

275 280 285

Arg Val Pro Thr Ser Ile Leu His Ser Leu Glu Gly Met Pro Asp Leu

290 295 300

Asp Trp Pro Arg Leu Leu Asn Leu Gln Ser Cys Asp Gly Ser Phe Leu

305 310 315 320

Phe Ser Pro Ser Ala Thr Ala Tyr Ala Leu Met Gln Thr Gly Asp Lys

325 330 335

Lys Cys Phe Glu Tyr Ile Asp Arg Ile Val Lys Lys Phe Asn Gly Gly

340 345 350

Val Pro Asn Val Tyr Pro Val Asp Leu Phe Glu His Ile Trp Val Val

355 360 365

Asp Arg Leu Glu Arg Leu Gly Ile Ser Arg Tyr Phe Gln Arg Glu Ile

370 375 380

Glu Gln Cys Met Asp Tyr Val Asn Arg His Trp Thr Glu Asp Gly Ile

385 390 395 400

Cys Trp Ala Arg Lys Ser Asn Val Lys Asp Val Asp Asp Thr Ala Met

405 410 415

Ala Phe Arg Leu Leu Arg Leu His Gly Tyr Asn Val Ser Pro Ser Val

420 425 430

Phe Lys Asn Phe Glu Lys Asp Gly Glu Phe Phe Cys Phe Val Gly Gln

435 440 445

Ser Thr Gln Ala Val Thr Gly Met Tyr Asn Leu Asn Arg Ala Ser Gln

450 455 460

Ile Ser Phe Gln Gly Glu Asp Val Leu His Arg Ala Arg Val Phe Ser

465 470 475 480

Tyr Glu Phe Leu Arg Gln Arg Glu Glu Gln Gly Met Ile Arg Asp Lys

485 490 495

Trp Ile Val Ala Lys Asp Leu Pro Gly Glu Val Gln Tyr Thr Leu Asp

500 505 510

Phe Pro Trp Tyr Ala Ser Leu Pro Arg Val Glu Ala Arg Thr Tyr Leu

515 520 525

Asp Gln Tyr Gly Gly Lys Asp Asp Val Trp Ile Gly Lys Thr Leu Tyr

530 535 540

Arg Met Pro Leu Val Asn Asn Asp Thr Tyr Leu Glu Leu Ala Ile Arg

545 550 555 560

Asp Phe Asn His Cys Gln Ala Leu His Gln Leu Glu Cys Asn Gly Leu

565 570 575

Gln Thr Trp Tyr Lys Asp Asn Cys Leu Asp Ala Phe Gly Val Glu Pro

580 585 590

Gln Asp Val Leu Arg Ser Tyr Phe Leu Ala Ala Ala Cys Ile Phe Glu

595 600 605

Pro Ser Arg Ala Ala Glu Arg Leu Ala Trp Ala Arg Thr Ser Met Ile

610 615 620

Ala Asn Ala Ile Ser Thr His Leu Arg Asp Ile Ser Glu Asp Lys Arg

625 630 635 640

Leu Ile Asn Leu Leu Ala Gln Glu Ala Leu Pro Ile His Glu Gly Gln

645 650 655

Arg Phe Ile His Ser Leu Leu Ser Leu Ala Trp Thr Glu Trp Met Leu

660 665 670

Gln Lys Ala Asn Lys Glu Glu Asn Lys Tyr His Lys Cys Ser Gly Ile

675 680 685

Glu Pro Gln Tyr Met Val His Asp Arg Gln Thr Tyr Leu Leu Leu Val

690 695 700

Gln Val Ile Glu Ile Cys Ala Gly Arg Ile Gly Glu Ala Val Ser Met

705 710 715 720

Ile Asn Asn Lys Asp Asn Asp Trp Phe Ile Gln Leu Thr Cys Ala Thr

725 730 735

Cys Asp Ser Leu Asn His Arg Met Leu Leu Ser Gln Asp Thr Met Lys

740 745 750

Asn Glu Ala Arg Ile Asn Trp Ile Glu Lys Glu Ile Glu Leu Asn Met

755 760 765

Gln Glu Leu Ala Gln Ser Leu Leu Leu Arg Cys Asp Glu Lys Thr Ser

770 775 780

Asn Lys Lys Thr Lys Lys Thr Leu Trp Asp Val Leu Arg Ser Leu Tyr

785 790 795 800

Tyr Ala Thr His Ser Pro Gln His Met Ile Asp Arg His Val Ser Arg

805 810 815

Val Ile Phe Glu Pro Val

820

Claims (2)

1. The application of the Zmcps gene in preparing a male sterile line of corn is characterized in that the nucleotide sequence of the Zmcps gene is shown as SEQ ID No. 3.
2. 2. The use of Zmcps gene in the preparation of male sterile line of maize as claimed in claim 1, wherein the amino acid sequence of the protein encoded by the Zmcps gene is shown in SEQ ID No. 4.

Images