CN114181956B

CN114181956B - Wheat stripe rust resistance related metabolite and synthesis related gene and application thereof

Info

Publication number: CN114181956B
Application number: CN202210090847.8A
Authority: CN
Inventors: 杨宇衡; 刘赛斐; 马子慧; 肖牧野; 宿嘉轩; 田斌年; 方安菲; 余洋; 毕朝位
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2022-01-26
Filing date: 2022-01-26
Publication date: 2023-11-28
Anticipated expiration: 2042-01-26
Also published as: CN114181956A

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a wheat stripe rust resistance related metabolite, a synthesis related gene and application thereof. In the combined analysis of the metabolome and the transcriptome of wheat infected by the rust bacteria, the 2, 5-dihydroxyphenylacetic acid (HGA) and the synthesis related gene TaHPD thereof are induced to be up-regulated, and the exogenous spraying of the HGA can improve the resistance of the wheat and the corn to rust diseases and inhibit the germination of rust bacteria summer spores. Changes in HGA content have also been demonstrated to affect plant disease resistance by gene silencing and overexpression of TaHPD. The compound HGA can be processed into a control agent to realize green control of crop diseases.

Description

Wheat stripe rust resistance related metabolite and synthesis related gene and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a natural compound HGA screened in wheat and stripe rust non-compatible interaction, and a synthesis related gene and application thereof.

Background

Wheat is a grain crop with wide planting range, high yield and long planting history in the world. Food such as bread, noodles, steamed bread and the like processed by wheat is also popular, and occupies the consumer market. Statistics show that the planting area of Chinese wheat rises from 2407.16 ten thousand hectares in 2014 to 2451.04 ten thousand hectares in 2017, and the yield rises from 12621.52 ten thousand tons in 2014 to 13434.06 ten thousand tons in 2017, and the rise trend is year by year. Thus, the demand of wheat in China is continuously increased, and the demand is expected to be increased by 60% in 2050 according to the increasing speed. However, due to the influence of climate, variety and other reasons, wheat is threatened by various diseases at any time to reduce yield, and wheat stripe rust is one of the very important diseases.

Wheat stripe rust is a disease caused by the specialized (Puccinia striiformis f.sp.tritici, pst) of wheat of the stripe rust, and because the disease has the characteristics of rapid pathogenicity variation, frequent variation, outbreak, epidemic, long-term property, recurrent property and the like, the frequent loss of stripe rust resistance of the main cultivated wheat variety is easy to cause, the outbreak of the wheat stripe rust is popular, and the safety production of the wheat is seriously threatened.

At present, the disease control is mainly chemical control, but the long-term and excessive use of chemical agents causes the problems of destruction of beneficial microorganism population in soil, excessive heavy metal and other environmental pollution. Therefore, the research on the rust resistance mechanism of the wheat is enhanced, the rust resistance of the wheat is reasonably utilized, and the wheat rust resistance control method has important significance in delaying germ variation and controlling stripe rust in green color.

Disclosure of Invention

In view of the above, it is an object of the present invention to provide HGA, a significantly different metabolite in wheat non-affine interaction with stripe rust, and a synthetic related gene thereof.

The aim of the invention is achieved by the following technical means:

the metabolome and transcriptome association analysis of wheat and stripe rust non-compatible interaction is used for screening out differential metabolite HGA and relevant gene TaHPD for synthesizing HGA, wherein the gene TaHPD has three homologous copies on 6A,6B and 6D chromosomes, and the nucleotide sequences of the homologous copy genes TaHPD-6A, taHPD-6B, taHPD-6D are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. Para-hydroxyphenylpyruvate dioxygenase (HPD) is an important enzyme in the metabolic process of 2, 5-dihydroxyphenylacetate (HGA), and TaHPD is a gene encoding para-hydroxyphenylpyruvate dioxygenase (HPD). The amino acid sequences of the gene TaHPD-6A, taHPD-6B, taHPD-6D encoded protein HPD are respectively shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6.

It is a second object of the present invention to provide a gene silencing vector comprising the related gene TaHPD of the anabolite HGA.

It is a further object of the present invention to provide a recombinant vector pCNF3-TaHPD containing the gene TaHPD related to anabolic substances.

The fourth object of the invention is to provide the application of HGA in inhibiting the germination of wheat stripe rust spore and/or corn common rust spore.

The invention aims to provide the application of HGA as a wheat stripe rust and/or corn rust control agent, which provides a green control technology for the wheat stripe rust and has important application prospect.

The sixth purpose of the invention is the application of the recombinant vector pCNF3-TaHPD of the TaHPD gene in improving the resistance of tobacco to sclerotinia.

The seventh object of the present invention is to provide a method for controlling or inhibiting stripe rust disease of wheat, wherein HGA solution is sprayed on wheat leaves, wherein the concentration of HGA in HGA solution is 1-10mmol/L. The HGA can improve the capability of resisting the rust bacteria of the wheat and can effectively inhibit the germination of rust bacteria spores.

The eighth object of the present invention is to provide a method for controlling or inhibiting corn rust disease, which comprises spraying HGA solution to corn leaf, wherein the concentration of HAG in the HGA solution is 1-20mmol/L. The HGA can improve the capability of corn rust resistance and can effectively inhibit the germination of rust spores.

Compared with the prior art, the invention has the following beneficial technical effects: the invention discloses a natural compound HGA which participates in the process of resisting stripe rust and rust of plants for the first time, and the control effect of the HGA as a control agent for wheat stripe rust and corn rust. (1) The wheat stripe rust resistance related metabolite HGA is disclosed for the first time; (2) Obtaining the synthesized HGA related gene TaHPD and the nucleotide sequence thereof; (3) The molecular biology and genetic engineering technology are used for verifying that HGA participates in the process of resisting stripe rust bacteria and rust bacteria of plants; (4) The exogenous spray HGA can improve the rust resistance of wheat and corn and inhibit the germination of rust bacteria and rust bacteria spores. The invention proves the effect of HGA as a control agent for wheat stripe rust and corn rust, and realizes green control of wheat stripe rust and corn rust.

Drawings

FIG. 1 is a graph of differential metabolite trend analysis of example 1;

FIG. 2 is a diagram of the metabolome and transcriptome association analysis of example 1, the real-time fluorescent quantitative PCR assay of example 5, and the HGA assay after inoculation;

FIG. 3 is a phenotype diagram of exogenous spray HGAs of wheat (a) and corn (b) of example 2;

FIG. 4 is a graph showing the effect of HGA treatment of example 3 on germination of wheat rust spores (a) and corn rust spores (b);

FIG. 5 is a graph (d) showing the changes in HGA content after gene silencing of example 6, when the phenotype of the rust CYR23 is observed (a).

FIG. 6 is a graph (a) showing infection of sclerotinia by overexpressing TaHPD in example 7, diameter of lesion (b) after infection, and HGA content change after overexpressing TaHPD (c).

Detailed Description

The invention will be described in detail below with reference to the attached drawings and specific examples:

the wheat Suwo 11 (Su 11), mingXian169 (MX 169), corn, nicotiana benthamiana physiological race CYR23, CYR34, corn rust, escherichia coli competent DH5 alpha, agrobacterium competent GV3101, vector pCNF3, BSMV: gamma and the like are provided by plant fungal disease research rooms of the university of southwest plant protection college.

The following are examples of fluorescent quantitative primers designed using NCBI database, and the remaining primers were designed from primer 5 pieces. The synthesis of the test primer and the sequencing of the bacterial liquid are completed by the division of biological engineering (Shanghai).

The HGA used in the present invention is purchased from Taraxap (TCI) chemical industry development Co., ltd, and other reagents are commercially available.

LB medium formulation/L: 10g of tryptone, 5g of yeast extract, 5g of NaCl and 20g of agar powder when preparing solid; PDA media formulation/L: 200g of potato, 20g of glucose and 20g of agar.

Example 1 metabolite analysis after wheat infection by rust CYR23

(1) Material handling

Sterilizing wheat seeds of a water source 11 (Suwon 11) with 75% alcohol, cleaning with ultrapure water for 4-5 times, soaking the seeds for accelerating germination, sowing in a nutrition pot, culturing in an environment of 12+/-2 ℃ until wheat seedlings grow to a 1-leaf period, smearing physiological wheat seeds CYR23 of the rust on the leaves, and keeping moisture in darkness for 24 hours, wherein normally grown wheat is used as a control CK. The materials are respectively obtained at 12h,24h and 48h after inoculation.

(2) Method for detecting metabolite by using ultra-high performance liquid chromatography and tandem mass spectrometry

And (3) detecting the metabolite of the material obtained in the step (1) by using an ultra-high performance liquid chromatography and tandem mass spectrometry method. The specific operation method comprises the following steps: s1, standard substances and reagents, all chemical reagents are analytically pure. The water used is ultra-pure water after double deionized, and the ultra-pure water purifying system is Millipore product. Chemical standards were purchased from BioBioPha corporation and Sigma-Aldrich, USA. The standard was dissolved in dimethyl sulfoxide (DMSO) or methanol as a solvent and stored at-20 ℃. Working samples of the standard were diluted with 70% methanol to different gradient concentrations for mass spectrometry before use. And S2, extracting metabolites, taking out the biological material sample subjected to ultralow-temperature cryopreservation obtained in the step S1, and performing vacuum freeze drying on the sample. The dried sample was ground with a grinder (MM 400, retsch) at 30Hz for 1.5 minutes, 100mg of powder was weighed, and extracted overnight with 1.0ml of 70% methanol containing 0.1mg/l lidocaine as an internal standard at 4℃with three vortexing to give a more adequate extraction. After extraction 10000g were centrifuged for 10min, the supernatant was aspirated, the sample was filtered with a microporous filter (0.22 μm pore size) and stored in a sample bottle for subsequent LC-MS analysis. Quality control samples (QC) were prepared from a mix of sample extracts for analysis of the reproducibility of the samples under the same treatment methods. During the instrumental analysis, a QC sample is typically inserted into every 10 test analysis samples to examine the reproducibility of the analysis process. S3, metabolite detection, wherein the data acquisition instrument system mainly comprises ultra-high performance liquid chromatography (Ultra Performance Liquid Chromatograp, UPLC) (Shim-pack UFLC SHIMADZU CBM A, http:// www.shimadzu.com.cn /) and tandem mass spectrometry (Tandem mass spectrometry, MS/MS) (Applied Biosystems 4500QTRAP, http:// www.appliedbiosystems.com.cn /). The UPLC analysis conditions mainly include: chromatographic column: waters ACQUITY UPLC HSS T3C 181.8 μm,2.1 mm. Times.100 mm; mobile phase: the aqueous phase was ultrapure water (0.04% acetic acid was added) and the organic phase was acetonitrile (0.04% acetic acid was added); elution gradient, water: acetonitrile at 95:5V/V for 0min, at 5:95V/V for 11.0min, at 5:95V/V for 12.0min, at 95:5V/V for 12.1min, at 95:5V/V for 15.0 min; the flow rate is 0.4ml/min; column temperature is 40 ℃; the sample loading was 5. Mu.l. The separated sample enters ESI-QTRAP-MS for mass spectrometry. In the API 4500QTRAP LC/MS/MS system, the main parameters of the linear ion trap and the triple quaternary rod include: electrospray ion source (electrospray ionization, ESI) temperature was 550 ℃, mass spectrometry voltage was 5500V, curtain gas (CUR) was 25psi, and collision induced ionization (CD) parameter was set high. In a triple quaternary rod (QQQ), each ion pair is scan detected based on an optimized declustering voltage (declustering potential, DP) and Collision Energy (CE). The resulting data were data processed using software analysis 1.6.1 (AB SCIEX).

The detection result in the experiment shows that the most significant difference metabolites are obtained when the significant difference metabolites are 24 hours after the wheat is infected by the stripe rust CYR23, the significant difference metabolites are significantly down-regulated by SN-glycerol-3-phosphorylcholine, orotic acid, nicotinamide, nobiletin, ascorbic acid, hesperidin, salicylic acid and neohesperidin, the significant up-regulated 2-aminoadipic acid, methoxyindole acetic acid, N' -p-coumaryl agmatine, N-p-coumaryl agmatine, L-histidine, L- (+) -arginine, L-yeast amino acid and 2, 5-dihydroxyphenylacetic acid, the significant difference metabolites are subjected to trend analysis (see figure 1), and the genome and transcriptome association analysis shows that the 2, 5-dihydroxyphenylacetic acid (HGA) and the synthesis related genes TaHPD in the wheat water source 11 are all induced to be up-regulated by the wheat stripe rust CYR23, and the HGA is proved to participate in the stripe rust resistance reaction of the wheat.

Example 2 experiment of anti-Puccinia after leaf spraying Shi Xiaomai to HGA and corn

(1) Material culture

Sterilizing water source 11 wheat seeds with 75% alcohol, cleaning with ultrapure water for 4-5 times, soaking seeds, accelerating germination, seeding in a nutrition pot, culturing in a greenhouse at 12+ -2deg.C, and illuminating for 16h and darkness for 8h. Sterilizing semen Maydis with 75% alcohol, cleaning with ultrapure water for 4-5 times, soaking seeds, accelerating germination, seeding in nutrition pot, culturing in greenhouse at 25deg.C+ -2deg.C, illumination for 16 hr, and darkness for 8 hr.

(2) Material handling

HGA solutions with the concentration of 2.5mmol, 5mmol and 10mmol are respectively sprayed on wheat leaves, each treatment is repeated for 3 times, the control group CK is not sprayed, then the trichlla affine physiological micro-seed CYR34 is respectively rubbed and inoculated, and the incidence degree of the wheat leaves is observed after 12 days of inoculation.

HGA solutions with the concentration of 5mmol, 10mmol and 20mmol are respectively sprayed on corn leaf surfaces, each treatment is repeated for 3 times, the control group CK is not sprayed, then corn common rust is respectively rubbed and inoculated, and then the incidence degree of the corn leaf surfaces is observed.

The experiment shows that the incidence degree of wheat leaves sprayed with 2.5, 5 and 10mmol/L HGA is obviously lower than that of a control group, wherein the incidence degree of the wheat leaves sprayed with 10mmol/L HGA is the lowest. Proved by the exogenous spraying of the wheat with the HGA of 2.5 to 10mmol/L, the incidence degree of wheat stripe rust can be reduced. The incidence degree of corn leaves sprayed with 5, 10 and 20mmol/L HGA is obviously lower than that of a control group, wherein the incidence degree of corn leaves sprayed with 20mmol/L HGA is the lowest. The exogenous spraying of HGA can reduce the occurrence of common rust of corn.

Example 3 experiment of the Effect of HGA on germination Rate of Puccinia gracilis spores and corn common rust spores

HGA solutions were prepared at concentrations of 1mmol/L, 2mmol/L, 5mmol/L and 10mmol/L, respectively. Taking a clean glass slide, adding a drop of HGA solution with different concentrations, adding a drop of distilled water into a control group CK, picking a small amount of Rumex patiens spores by using a dissecting needle, respectively placing the small amount of Rumex patiens spores into the solution with different concentrations and the distilled water, and regulating the spore concentration under a low power microscope, wherein the spores have about 40-60 spores/visual field. The slides were placed in petri dishes lined with absorbent paper and then incubated in an incubator at 12 ℃ ±2 ℃. Taking out and observing after 24 hours, repeating each treatment for 3 times, wherein the corn rust spore inhibition experiment method is the same as that, and the culture temperature is 20+/-2 ℃.

The experimental result shows that in the experiment of inhibiting the spores of the wheat stripe rust, the HGA with the concentration of 1, 2,5 and 10mmol/L can inhibit the germination of the spores, wherein the HGA with the concentration of 10mmol/L has the best effect of inhibiting the spores of the stripe rust, can completely inhibit the germination of the spores, and can cause the malformation of the germ tubes generated by the summer spores in a low concentration (1-5 mmol/L) state. In the spore inhibition experiment on corn rust, 1-10mmol/L HGA can cause the spore to generate deformity and inhibit the elongation of the bud tube. The experiment proves that the HGA with the concentration of 1-10mmol/L can effectively inhibit the germination of the wheat stripe rust and the corn rust spores.

Example 4 acquisition of the TaHPD Gene

(1) Extraction of Total RNA and reverse transcription thereof

Wheat leaves were subjected to extraction of total RNA from wheat seedlings using a plant total RNA extraction kit (purchased from Tiangen Biochemical Co., ltd.), and then RNA was subjected to reverse transcription of cDNA using a reverse transcription kit (purchased from Thermo Scientific Co.), and the reaction system was as follows. First strand cDNA synthesis was performed using 1. Mu.g total RNA according to the instructions of Thermo Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo) kit, and the following components were added to a PCR tube of nucleic-free: total RNA 1. Mu.g 10 XDNaseI Buffer 1. Mu.L DNaseI 1. Mu.L nucleic-free ddH2O up to 10. Mu.L were mixed and incubated in a PCR apparatus at 37℃for 30min, and then incubated at 65℃for 5min to inactivate the enzyme, immediately inserted into ice for cooling, and the following components were continuously added to the system: oligo (dT) 18 (0.5. Mu.g/. Mu.L) 1. Mu.L of nucleic-free ddH2O 1. Mu.L were mixed and incubated at 65℃for 5min, cooled on ice for 2min, and then the following were added: 5 Xreaction Buffer 4. Mu. L Ribollock Rnase Inhibitor (20U/. Mu.L) 1. Mu.L 10mM dNTP Mix 2. Mu.L Reverted air M-MuL V RT (200U/. Mu.L) 1. Mu.L were mixed and incubated in a PCR apparatus at 45℃for 1h, and then incubated at 70℃for 5min to inactivate the enzyme, and the product was stored at-20℃for later use.

(2) Amplification and recovery of the full-length sequence of the TaHPD gene.

An upstream primer: 5'-ATGCCGCCCACCCCCACC-3', as shown in SEQ ID NO. 7;

a downstream primer: 5'-ATCCCTGAACTGCAGCAGATTG-3', as shown in SEQ ID NO. 8;

the TaHPD gene was amplified by PCR using the cDNA of the reaction product obtained in step (1) as a template for PCR reaction, and the reaction system was as shown in Table 1.

TABLE 1 Gene amplification reaction System

The PCR amplification reaction procedure was: the reaction was terminated at 95℃for 3min, (95℃for 30sec,55℃for 30sec,72℃for 90 sec) for 35 cycles, 72℃for 10min, and 16 ℃.

The PCR products are subjected to agarose gel electrophoresis detection, the gel with the target band is recovered, and the gel is sequenced by a biological engineering (Shanghai) stock company, the gene TaHPD has three homologous copies on 6A,6B and 6D chromosomes, and the nucleotide sequences of the homologous copy gene TaHPD-6A, taHPD-6B, taHPD-6D are respectively shown as SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO. 11. The amino acid sequences of the gene TaHPD-6A, taHPD-6B, taHPD-6D coding protein HPD are respectively shown as SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14, and the HPD is an important enzyme in the metabolic process of the HGA.

The nucleotide sequence of TaHPD-6A is:

ATGCCGCCCACCCCCACCACCCCCGCAGCCACCGGCGCCGCCGCGGTGACGCCGGAGCACGCGCGGCCGCGCCGAATGGTCCGCTTCAACCCGCGCAGCGACCGCTTCCACACGCTCGCCTTCCACCACGTCGAGTTCTGGTGCGCGGACGCCGCCTCCGCCGCCGGCCGCTTCGCCTTCGCGCTCGGCGCGCCGCTCGCCGCCAGGTCCGACCTCTCCACGGGGAACTCCGTGCACGCCTCCCAGCTGCTCCGCTCGGGCAACCTCGCCTTCCTCTTCACGGCCCCCTACGCCAACGGCTGCGACGCCGCCACCGCCTCCCTGCCCTCCTTCTCCGCCGACGCCGCGCGCCAGTTCTCCGCGGACCACGGCCTCGCGGTGCGCTCCATAGCGCTGCGCGTCGCGGACGCTGCCGAGGCCTTCCGCGCCAGCGTCGACGGGGGCGCGCGCCCGGCCTTCAGCCCTGTGGACCTCGGCCGCGGCTTCGGCTTCGCGGAGGTCGAGCTCTACGGCGACGTCGTGCTCCGCTTCGTCAGCCACCCGGACGGCAGGGACGTGCCCTTCTTGCCGGGGTTCGAGGGCGTGAGCAACCCAGACGCCGTGGACTACGGCCTGACGCGGTTCGACCACGTCGTCGGCAACGTCCCGGAGCTTGCCCCCGCCGCGGCCTACGTCGCCGGGTTCACGGGGTTCCACGAGTTCGCCGAGTTCACGACGGAGGACGTGGGCACGGCCGAGAGCGGGCTCAACTCGATGGTGCTCGCCAACAACTCGGAGGGCGTGCTGCTGCCGCTCAACGAGCCGGTGCACGGCACCAAGCGCCGGAGCCAGATACAGACGTTCCTGGAACACCACGGCGGCTCGGGCGTGCAGCACATCGCGGTGGCCAGCAGCGACGTGCTCAGGACGCTCAGGGAGATGCGTGCGCGCTCCGCCATGGGCGGCTTCGACTTCCTGCCACCCCCGCTGCCGAAGTACTACGAAGGCGTGCGGCGCATCGCCGGGGATGTGCTCTCGGAGGCGCAGATCAAGGAATGCCAGGAGCTGGGGGTGCTCGTCGACAGGGACGACCAAGGGGTGTTGCTACAAATCTTCACCAAGCCAGTAGGGGACAGGCCGACGTTGTTCCTGGAGATGATCCAGAGGATCGGGTGCATGGAGAAGGACGAGAGAGGGGAAGAGTACCAGAAGGGTGGCTGCGGCGGGTTCGGCAAAGGCAACTTCTCCGAGCTGTTCAAGTCCATTGAAGATTACGAGAAGTCCCTTGAAGCCAAGCAATCTGCTGCAGTTCAGGGATCATAG

the nucleotide sequence of TaHPD-6B is:

ATGCCGCCCACCCCCACCACCCCGGCAGCTACCGGCGCCGCCGCCGCCGCCGCGGTGACGCCGGAGCATGCACGGCCACGTAGAATGGTCCGCTTCAACCCGCGGAGCGACCGCTTCCACACGCTCGCCTTCCACCACGTCGAGTTCTGGTGCGCGGACGCCGCCTCCGCCGCCGGCCGCTTCGCCTTCGCGCTCGGCGCGCCGCTCGCCGCCAGGTCCGACCTCTCCACGGGGAACTCCGTGCACGCCTCCCAGCTGCTCCGCTCGGGCAACCTCGCCTTCCTCTTCACCGCGCCCTACGCGAACGGCTGCGACGCCGCCACCGCCTCCCTGCCCTCCTTCTCCGCCGACGCCGCGCGCCGGTTCTCCGCGGACCACGGGCTCGCAGTGCGCTCCATAGCACTGCGCGTCGCAGACGCCGCAGAGGCCTTCCGCGCCAGCGTCGACGGAGGCGCGCGCCCGGCCTTCAGCCCCGTGGACCTCGGCCGCGGCTTCGGCTTCGCGGAGGTCGAGCTCTACGGCGACGTCGTGCTCCGCTTCGTCAGTCACCCGGATGACACGGACGTGCCCTTCTTGCCGGGGTTCGAGGGCGTGAGCAACCCGGATGCCGTGGACTACGGCCTGACGCGGTTCGACCACGTCGTCGGCAACGTCCCGGAGCTTGCCCCCGCCGCCGCATACGTCGCCGGGTTCGCGGGGTTCCACGAGTTCGCCGAGTTCACGACGGAGGACGTGGGCACGGCCGAGAGCGGGCTCAACTCGATGGTGCTCGCCAACAACTCCGAGGGCGTGCTGCTGCCGCTCAACGAGCCGGTGCACGGCACCAAGCGCCGGAGCCAGATACAGACGTTCCTGGAACACCACGGTGGCCCGGGCGTGCAGCACATCGCGGTGGCCAGCAGCGACGTGCTCAGGACGCTCAGGGAGATGCGTGCGCGCTCCGCCATGGGCGGCTTCGACTTCCTGCCACCCCCGCTGCCGAAGTACTATGAAGGCGTGCGGCGCATCGCGGGGGATGTGCTCTCGGAGGCGCAGATCAAGGAATGCCAGGAGCTGGGGGTGCTCGTCGACAGGGACGACCAAGGGGTGTTGCTCCAAATCTTCACCAAGCCAGTGGGGGACAGGCCAACGCTGTTCCTGGAGATGATCCAAAGGATCGGGTGCATGGAGAAGGACGAGAGAGGGGAAGAGTACCAGAAGGGTGGCTGCGGCGGGTTTGGCAAAGGCAACTTCTCCGAGCTGTTCAAGTCCATTGAGGATTATGAGAAATCCCTTGAAGCCAAGCAATCTGCTGCAGTTCAGGCATCATAG

the nucleotide sequence of TaHPD-6D is:

ATGCCGCCCACCCCCACCACCCCCGCAGCCACCGGCGCCGGCGCTGCCGCCGCGGTGACGCCGGAGCACGCGCGGCCGCGCCGAATGGTCCGCTTCAACCCGCGCAGCGACCGCTTCCACACGCTCTCCTTCCACCACGTCGAGTTCTGGTGCGCGGACGCCGCCTCCGCCGCCGGCCGCTTCGCCTTCGCGCTCGGCGCGCCGCTCGCCGCCAGGTCCGACCTCTCCACGGGGAACTCCGTGCACGCCTCCCAGCTGCTCCGCTCGGGCAACCTCGCCTTCCTCTTCACCGCGCCCTACGCCAACGGCTGCGACGCCGCCACCGCCTCCCTGCCCTCCTTCTCCGCCGACGCCGCGCGCCGGTTCTCCGCGGACCACGGGCTCGCGGTGCGCTCCATAGCGCTGCGCGTCGCGGACGCCGCCGAGGCCTTCCGCGCCAGCGTCGACGGGGGCGCGCGCCCGGCCTTCAGCCCCGTGGACCTCGGCCGCGGCTTCGGCTTTGCGGAGGTCGAGCTCTACGGCGACGTCGTGCTCCGCTTCGTCAGCCATCCGGACGGCACGGACGTGCCCTTCTTGCCGGGGTTCGAGGGCGTGAGCAACCCGGGTGCCGTGGACTACGGCCTGACACGGTTTGACCACGTCGTCGGCAACGTCCCGGAGCTTGCTTCCGCCGCCGCCTACGTAGCCGGCTTCACGGGTTTCCATGAGTTCGCCGAGTTCACGACGGAGGACGTGGGCACGGCCGAGAGCGGGCTCAACTCGATGGTGCTCGCCAACAACTCGGAGGGCGTGCTGCTGCCGCTCAACGAGCCGGTGCACGGCACCAAGCGCCGGAGCCAGATACAGACGTTCCTGGAACACCACGGCGGCCCGGGTGTGCAGCACATCGCGGTGGCCAGCAGCGACGTGCTCAGGACGCTCAGGGAGATGCGTGCGCGCTCCGCCATGGGCGGCTTCGACTTCCTGCCACCCCCGCTGCCGAAGTACTACGAAGGCGTGCGGCGCATCGCCGGGGATGTGCTCTCGGAGGCGCAGATCAAGGAATGCCAGGAGCTGGGGGTGCTCGTCGACAGGGACGACCAAGGGGTGTTGCTACAAATCTTCACAAAGCCAGTGGGGGACAGGCCAACGCTGTTCCTGGAGATGATCCAAAGGATCGGGTGCATGGAGAAGGACGAGAGAGGGGAAGAGTACCAGAAGGGTGGCTGCGGCGGGTTCGGCAAAGGCAACTTCTCCGAGCTGTTCAAGTCCATTGAAGATTACGAGAAGTCCCTTGAAGCCAAGCAATCTGCTGCAGTTCAGGGATCATAG

example 5 real-time fluorescent quantitative PCR detection of Gene expression Properties in wheat under Induction conditions of Puccinia

Sterilizing water source 11 wheat seeds with 75% alcohol, cleaning with ultrapure water for 4-5 times, soaking seeds for accelerating germination, sowing in a nutrition pot, culturing in an environment of 12+/-2 ℃ until wheat seedlings grow to a 1-leaf period, smearing physiological wheat seed CYR23 of the rust on leaves, and keeping moisture in darkness for 24 hours, wherein normally grown wheat is used as a reference CK. Seedling leaves were cut out at 12h,24h and 48h, respectively, after inoculation and placed in a refrigerator for use, 3 biological replicates per sample. Each of the treated cDNAs was obtained according to the method in example 4, and a fluorescent quantitative expression primer was designed based on the full-length cDNA sequence:

the upstream primer 5'-CAGTAGGGGACAGGCCGA-3' is shown as SEQ ID NO.9

The downstream primer 5'-CCGCATCTTACAAACAACATCA-3' is shown as SEQ ID NO.10

Internal reference gene primer:

an upstream primer: 5'-TGGTGTCATCAAGCCTGGTATGGT-3' as shown in SEQ ID NO.11

A downstream primer: 5'-ACTCATGGTGCATCTCAACGGACT-3' as shown in SEQ ID NO.12

The real-time fluorescent quantitative PCR reaction system is shown in Table 2.

Table 2 real-time fluorescent quantitative reaction system

The reaction procedure is: the reaction was terminated by 40 cycles of 95℃for 1min (95℃for 10sec,60℃for 20sec, and 72℃for 40 sec).

Equation (2) using relative quantification ^-ΔΔCt ) The relative expression level of the TaHPD gene was calculated.

Relative ratio=2 ^-ΔΔCt ，ΔΔCt＝(C _treat ^M -C _treat ^A )-(C _control ^M -C _control ^A )。

As shown in figure 2, the relative expression level of the TaHPD gene is up-regulated in wheat leaves after inoculation for 0-48h, and the expression level is obviously higher than that of control treatment at 24h after inoculation. The experiment proves that the TaHPD gene participates in the wheat stripe rust resistance process.

Example 6 verification of stripe rust resistance of TaHPD Gene Using BSMV-mediated Gene silencing experiments

Specific fragments of TaHPD are selected and ligated with BSMV: gamma to form recombinant vectors. Then linearizing BSMV alpha, BSMV beta, BSMV gamma and recombinant vector, BSMV alpha, BSMV gamma plasmid, BSMV PDS and recombinant plasmid BSMV TaHPD-V1, BSMV TaHPD-V2 MluI, BSMV beta plasmid SpeI. Use of riboMAX with linearized plasmid as template ^TM Large Scale RNA Production Systems-T7 in vitro transcription kit the plasmids obtained in the above reaction were transcribed in vitro. Mu.l of the in vitro transcription product was blotted and diluted 10-fold with nucleic-free water and detected by 1% agarose gel electrophoresis. Storing at-80deg.C for use.

Inoculation virus test:

(1) All in vitro transcripts were isolated using nucleic-free H ₂ Diluting O3 times, and mixing 2.5 mu l of alpha, beta, gamma or recombinant gamma vector in vitro transcription products respectively;

(2) 45 mu l of FES buffer solution is added into the mixture, and after the mixture is uniformly mixed by a micropipette, the mixture is divided into 5 parts on average;

(3) When the wheat is inoculated, a hand wears a latex glove, an index finger is dipped with a virus liquid, and a second wheat leaf with good growth state is selected to rub back and forth for 3 times from a basal part to a tip;

(4) Spraying small amount of nucleic-free H onto virus-inoculated wheat ₂ O, placing in a greenhouse at 25+/-2 ℃ for 24 hours in a dark place, and culturing in 16 hours of illumination/8 hours of dark period. Each test was inoculated with BSMV: gamma as control and BSMV: gamma-PDS as positive control.

Inoculating, sampling and phenotyping the rust bacteria:

when the plants to be inoculated with BSMV and gamma-PDS show bleaching and fading, selecting wheat with good virus symptoms, and inoculating the rust fungus CYR23 at the marked part of the fourth leaf. And respectively cutting the leaves marked and inoculated at 0, 24 and 48hpi, quick-freezing the leaves by liquid nitrogen, and preserving the leaves at-80 ℃ for later use. The reverse transcribed cDNA is used to detect the silencing efficiency of target gene and the expression level of relevant defending gene and the wheat fourth leaf cDNA inoculated with BSMV: gamma virus is used as control. Periodically observing and photographing after virus inoculation to record infection symptoms of the virus; wheat morbidity is recorded by regular observation and photographing after inoculation of the rust bacteria.

Phenotypic observations: after silencing the wheat TaHPD gene, wheat appeared more sensitive to Rhizoctonia cerealis and HAG content was also significantly reduced (see FIG. 5). The HGA is proved to be involved in the process of wheat stripe rust resistance.

EXAMPLE 7 construction of recombinant vector pCNF3-TaHPD

Primers were designed based on the complete open reading frame of the TaHPD gene:

an upstream primer:

5'-TGCTCTAGAATGCCGCCCACCCCCACC-3' as shown in SEQ ID NO.13

A downstream primer:

5'-CGGGGTACCGTGGTGGTGGTGGTGGTGTGATCCCTGAACTGCAGCAGATTG-3' as shown in SEQ ID NO.14

The PCR amplification product of example 4 was ligated with pCNF 3. Then, the ligation product was transformed into E.coli DH 5. Alpha. Competent cells (purchased from Shanghai Weidi Biotech Co., ltd.) by adding the ligation product to 50ul of freshly thawed competent cells, mixing well, ice-bathing for 30min, heat-shocking for 45s in a water bath at 42℃and immediately placing on ice for 2min. 500ul of LB liquid medium without antibiotics was added and incubated at 200rpm and 37℃for 1h. Centrifuging for 1min, removing part of the supernatant with a pipette, flicking the suspended bacteria, reserving 200ul of bacteria liquid, uniformly spreading on LB agar medium containing Kan, inverting the plate, and culturing overnight at 37 ℃. And (3) respectively placing a plurality of single colonies with normal states into LB liquid culture medium containing Kan for culturing at 37 ℃ and 200rpm, shaking for 12-16 hours until bacterial liquid is turbid, and carrying out bidirectional sequencing on 3 independent clones for later use.

And (3) re-sequencing the correct bacterial liquid by shaking, extracting plasmids, measuring the concentration after the plasmids are extracted, detecting by agarose gel electrophoresis, and selecting high-concentration and bright-banded plasmid candidates for standby. PCR was performed with the plasmid as a template and with the designed cloning primer, and the PCR procedure was as follows: the reaction was terminated at 95℃for 3min, (95℃for 30sec,55℃for 30sec,72℃for 90 sec) for 35 cycles, 72℃for 10min, and 16 ℃.

And (3) after agarose gel electrophoresis, recovering PCR products, and after concentration measurement, keeping at-20 ℃ for later use. Shaking bacterial liquid of pCNF3 expression vector, extracting plasmid, selecting high concentration and enzyme cutting test. The cleavage system is shown in Table 3.

TABLE 3 enzyme digestion system

And (3) performing enzyme digestion for 4 hours at 37 ℃, recovering the gel to obtain an enzyme digestion carrier fragment, and measuring the concentration. And recombining the target fragment and the linearization vector fragment to obtain the tobacco transient expression vector. By constructing a tobacco transient expression vector, GV3101 agrobacterium is injected into the Nicotiana benthamiana for transient expression.

And (3) transforming the constructed tobacco transient expression vector into agrobacterium competence, transferring agrobacterium to a liquid culture medium for culture until the agrobacterium is in a logarithmic growth phase, centrifugally collecting bacterial precipitate, adding a buffer solution, and re-suspending until the OD 600 value is about 0.6-0.8, and infecting wheat by an agrobacterium infiltration method. The freshly activated sclerotinia sclerotiorum 1980 was inoculated 48h after construction of the tobacco transient expression vector.

The experimental results (see fig. 6): the incidence area of the region injected with pCNF3-TaHPD after 24 hours is obviously smaller than that of the region injected with pCNF 3-eGFP. HGA content is significantly higher than that of pCNF3-eGFP in pCNF3-TaHPD overexpressing plants. This experiment demonstrates that overexpression of TaHPD can increase tobacco resistance to Sclerotinia.

The above embodiments are only for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalents may be made thereto without departing from the spirit and scope of the technical solution of the present invention, which is intended to be covered by the scope of the claims of the present invention. The technology, shape, and construction parts of the present invention, which are not described in detail, are known in the art.

Sequence listing

<110> university of southwest

<120> wheat stripe rust resistance-related metabolites, synthesis-related genes thereof and uses thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1302

<212> DNA

<213> wheat (Triticum aestivum L.)

<400> 1

atgccgccca cccccaccac ccccgcagcc accggcgccg ccgcggtgac gccggagcac 60

gcgcggccgc gccgaatggt ccgcttcaac ccgcgcagcg accgcttcca cacgctcgcc 120

ttccaccacg tcgagttctg gtgcgcggac gccgcctccg ccgccggccg cttcgccttc 180

gcgctcggcg cgccgctcgc cgccaggtcc gacctctcca cggggaactc cgtgcacgcc 240

tcccagctgc tccgctcggg caacctcgcc ttcctcttca cggcccccta cgccaacggc 300

tgcgacgccg ccaccgcctc cctgccctcc ttctccgccg acgccgcgcg ccagttctcc 360

gcggaccacg gcctcgcggt gcgctccata gcgctgcgcg tcgcggacgc tgccgaggcc 420

ttccgcgcca gcgtcgacgg gggcgcgcgc ccggccttca gccctgtgga cctcggccgc 480

ggcttcggct tcgcggaggt cgagctctac ggcgacgtcg tgctccgctt cgtcagccac 540

ccggacggca gggacgtgcc cttcttgccg gggttcgagg gcgtgagcaa cccagacgcc 600

gtggactacg gcctgacgcg gttcgaccac gtcgtcggca acgtcccgga gcttgccccc 660

gccgcggcct acgtcgccgg gttcacgggg ttccacgagt tcgccgagtt cacgacggag 720

gacgtgggca cggccgagag cgggctcaac tcgatggtgc tcgccaacaa ctcggagggc 780

gtgctgctgc cgctcaacga gccggtgcac ggcaccaagc gccggagcca gatacagacg 840

ttcctggaac accacggcgg ctcgggcgtg cagcacatcg cggtggccag cagcgacgtg 900

ctcaggacgc tcagggagat gcgtgcgcgc tccgccatgg gcggcttcga cttcctgcca 960

cccccgctgc cgaagtacta cgaaggcgtg cggcgcatcg ccggggatgt gctctcggag 1020

gcgcagatca aggaatgcca ggagctgggg gtgctcgtcg acagggacga ccaaggggtg 1080

ttgctacaaa tcttcaccaa gccagtaggg gacaggccga cgttgttcct ggagatgatc 1140

cagaggatcg ggtgcatgga gaaggacgag agaggggaag agtaccagaa gggtggctgc 1200

ggcgggttcg gcaaaggcaa cttctccgag ctgttcaagt ccattgaaga ttacgagaag 1260

tcccttgaag ccaagcaatc tgctgcagtt cagggatcat ag 1302

<210> 2

<211> 1311

<212> DNA

<213> wheat (Triticum aestivum L.)

<400> 2

atgccgccca cccccaccac cccggcagct accggcgccg ccgccgccgc cgcggtgacg 60

ccggagcatg cacggccacg tagaatggtc cgcttcaacc cgcggagcga ccgcttccac 120

acgctcgcct tccaccacgt cgagttctgg tgcgcggacg ccgcctccgc cgccggccgc 180

ttcgccttcg cgctcggcgc gccgctcgcc gccaggtccg acctctccac ggggaactcc 240

gtgcacgcct cccagctgct ccgctcgggc aacctcgcct tcctcttcac cgcgccctac 300

gcgaacggct gcgacgccgc caccgcctcc ctgccctcct tctccgccga cgccgcgcgc 360

cggttctccg cggaccacgg gctcgcagtg cgctccatag cactgcgcgt cgcagacgcc 420

gcagaggcct tccgcgccag cgtcgacgga ggcgcgcgcc cggccttcag ccccgtggac 480

ctcggccgcg gcttcggctt cgcggaggtc gagctctacg gcgacgtcgt gctccgcttc 540

gtcagtcacc cggatgacac ggacgtgccc ttcttgccgg ggttcgaggg cgtgagcaac 600

ccggatgccg tggactacgg cctgacgcgg ttcgaccacg tcgtcggcaa cgtcccggag 660

cttgcccccg ccgccgcata cgtcgccggg ttcgcggggt tccacgagtt cgccgagttc 720

acgacggagg acgtgggcac ggccgagagc gggctcaact cgatggtgct cgccaacaac 780

tccgagggcg tgctgctgcc gctcaacgag ccggtgcacg gcaccaagcg ccggagccag 840

atacagacgt tcctggaaca ccacggtggc ccgggcgtgc agcacatcgc ggtggccagc 900

agcgacgtgc tcaggacgct cagggagatg cgtgcgcgct ccgccatggg cggcttcgac 960

ttcctgccac ccccgctgcc gaagtactat gaaggcgtgc ggcgcatcgc gggggatgtg 1020

ctctcggagg cgcagatcaa ggaatgccag gagctggggg tgctcgtcga cagggacgac 1080

caaggggtgt tgctccaaat cttcaccaag ccagtggggg acaggccaac gctgttcctg 1140

gagatgatcc aaaggatcgg gtgcatggag aaggacgaga gaggggaaga gtaccagaag 1200

ggtggctgcg gcgggtttgg caaaggcaac ttctccgagc tgttcaagtc cattgaggat 1260

tatgagaaat cccttgaagc caagcaatct gctgcagttc aggcatcata g 1311

<210> 3

<211> 1311

<212> DNA

<213> wheat (Triticum aestivum L.)

<400> 3

atgccgccca cccccaccac ccccgcagcc accggcgccg gcgctgccgc cgcggtgacg 60

ccggagcacg cgcggccgcg ccgaatggtc cgcttcaacc cgcgcagcga ccgcttccac 120

acgctctcct tccaccacgt cgagttctgg tgcgcggacg ccgcctccgc cgccggccgc 180

ttcgccttcg cgctcggcgc gccgctcgcc gccaggtccg acctctccac ggggaactcc 240

gtgcacgcct cccagctgct ccgctcgggc aacctcgcct tcctcttcac cgcgccctac 300

gccaacggct gcgacgccgc caccgcctcc ctgccctcct tctccgccga cgccgcgcgc 360

cggttctccg cggaccacgg gctcgcggtg cgctccatag cgctgcgcgt cgcggacgcc 420

gccgaggcct tccgcgccag cgtcgacggg ggcgcgcgcc cggccttcag ccccgtggac 480

ctcggccgcg gcttcggctt tgcggaggtc gagctctacg gcgacgtcgt gctccgcttc 540

gtcagccatc cggacggcac ggacgtgccc ttcttgccgg ggttcgaggg cgtgagcaac 600

ccgggtgccg tggactacgg cctgacacgg tttgaccacg tcgtcggcaa cgtcccggag 660

cttgcttccg ccgccgccta cgtagccggc ttcacgggtt tccatgagtt cgccgagttc 720

acgacggagg acgtgggcac ggccgagagc gggctcaact cgatggtgct cgccaacaac 780

tcggagggcg tgctgctgcc gctcaacgag ccggtgcacg gcaccaagcg ccggagccag 840

atacagacgt tcctggaaca ccacggcggc ccgggtgtgc agcacatcgc ggtggccagc 900

agcgacgtgc tcaggacgct cagggagatg cgtgcgcgct ccgccatggg cggcttcgac 960

ttcctgccac ccccgctgcc gaagtactac gaaggcgtgc ggcgcatcgc cggggatgtg 1020

ctctcggagg cgcagatcaa ggaatgccag gagctggggg tgctcgtcga cagggacgac 1080

caaggggtgt tgctacaaat cttcacaaag ccagtggggg acaggccaac gctgttcctg 1140

gagatgatcc aaaggatcgg gtgcatggag aaggacgaga gaggggaaga gtaccagaag 1200

ggtggctgcg gcgggttcgg caaaggcaac ttctccgagc tgttcaagtc cattgaagat 1260

tacgagaagt cccttgaagc caagcaatct gctgcagttc agggatcata g 1311

<210> 4

<211> 433

<212> PRT

<213> wheat (Triticum aestivum L.)

<400> 4

Met Pro Pro Thr Pro Thr Thr Pro Ala Ala Thr Gly Ala Ala Ala Val

1 5 10 15

Thr Pro Glu His Ala Arg Pro Arg Arg Met Val Arg Phe Asn Pro Arg

20 25 30

Ser Asp Arg Phe His Thr Leu Ala Phe His His Val Glu Phe Trp Cys

35 40 45

Ala Asp Ala Ala Ser Ala Ala Gly Arg Phe Ala Phe Ala Leu Gly Ala

50 55 60

Pro Leu Ala Ala Arg Ser Asp Leu Ser Thr Gly Asn Ser Val His Ala

65 70 75 80

Ser Gln Leu Leu Arg Ser Gly Asn Leu Ala Phe Leu Phe Thr Ala Pro

85 90 95

Tyr Ala Asn Gly Cys Asp Ala Ala Thr Ala Ser Leu Pro Ser Phe Ser

100 105 110

Ala Asp Ala Ala Arg Gln Phe Ser Ala Asp His Gly Leu Ala Val Arg

115 120 125

Ser Ile Ala Leu Arg Val Ala Asp Ala Ala Glu Ala Phe Arg Ala Ser

130 135 140

Val Asp Gly Gly Ala Arg Pro Ala Phe Ser Pro Val Asp Leu Gly Arg

145 150 155 160

Gly Phe Gly Phe Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg

165 170 175

Phe Val Ser His Pro Asp Gly Arg Asp Val Pro Phe Leu Pro Gly Phe

180 185 190

Glu Gly Val Ser Asn Pro Asp Ala Val Asp Tyr Gly Leu Thr Arg Phe

195 200 205

Asp His Val Val Gly Asn Val Pro Glu Leu Ala Pro Ala Ala Ala Tyr

210 215 220

Val Ala Gly Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Thr Glu

225 230 235 240

Asp Val Gly Thr Ala Glu Ser Gly Leu Asn Ser Met Val Leu Ala Asn

245 250 255

Asn Ser Glu Gly Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr

260 265 270

Lys Arg Arg Ser Gln Ile Gln Thr Phe Leu Glu His His Gly Gly Ser

275 280 285

Gly Val Gln His Ile Ala Val Ala Ser Ser Asp Val Leu Arg Thr Leu

290 295 300

Arg Glu Met Arg Ala Arg Ser Ala Met Gly Gly Phe Asp Phe Leu Pro

305 310 315 320

Pro Pro Leu Pro Lys Tyr Tyr Glu Gly Val Arg Arg Ile Ala Gly Asp

325 330 335

Val Leu Ser Glu Ala Gln Ile Lys Glu Cys Gln Glu Leu Gly Val Leu

340 345 350

Val Asp Arg Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro

355 360 365

Val Gly Asp Arg Pro Thr Leu Phe Leu Glu Met Ile Gln Arg Ile Gly

370 375 380

Cys Met Glu Lys Asp Glu Arg Gly Glu Glu Tyr Gln Lys Gly Gly Cys

385 390 395 400

Gly Gly Phe Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu

405 410 415

Asp Tyr Glu Lys Ser Leu Glu Ala Lys Gln Ser Ala Ala Val Gln Gly

420 425 430

Ser

<210> 5

<211> 436

<212> PRT

<213> wheat (Triticum aestivum L.)

<400> 5

Met Pro Pro Thr Pro Thr Thr Pro Ala Ala Thr Gly Ala Ala Ala Ala

1 5 10 15

Ala Ala Val Thr Pro Glu His Ala Arg Pro Arg Arg Met Val Arg Phe

20 25 30

Asn Pro Arg Ser Asp Arg Phe His Thr Leu Ala Phe His His Val Glu

35 40 45

Phe Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly Arg Phe Ala Phe Ala

50 55 60

Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu Ser Thr Gly Asn Ser

65 70 75 80

Val His Ala Ser Gln Leu Leu Arg Ser Gly Asn Leu Ala Phe Leu Phe

85 90 95

Thr Ala Pro Tyr Ala Asn Gly Cys Asp Ala Ala Thr Ala Ser Leu Pro

100 105 110

Ser Phe Ser Ala Asp Ala Ala Arg Arg Phe Ser Ala Asp His Gly Leu

115 120 125

Ala Val Arg Ser Ile Ala Leu Arg Val Ala Asp Ala Ala Glu Ala Phe

130 135 140

Arg Ala Ser Val Asp Gly Gly Ala Arg Pro Ala Phe Ser Pro Val Asp

145 150 155 160

Leu Gly Arg Gly Phe Gly Phe Ala Glu Val Glu Leu Tyr Gly Asp Val

165 170 175

Val Leu Arg Phe Val Ser His Pro Asp Asp Thr Asp Val Pro Phe Leu

180 185 190

Pro Gly Phe Glu Gly Val Ser Asn Pro Asp Ala Val Asp Tyr Gly Leu

195 200 205

Thr Arg Phe Asp His Val Val Gly Asn Val Pro Glu Leu Ala Pro Ala

210 215 220

Ala Ala Tyr Val Ala Gly Phe Ala Gly Phe His Glu Phe Ala Glu Phe

225 230 235 240

Thr Thr Glu Asp Val Gly Thr Ala Glu Ser Gly Leu Asn Ser Met Val

245 250 255

Leu Ala Asn Asn Ser Glu Gly Val Leu Leu Pro Leu Asn Glu Pro Val

260 265 270

His Gly Thr Lys Arg Arg Ser Gln Ile Gln Thr Phe Leu Glu His His

275 280 285

Gly Gly Pro Gly Val Gln His Ile Ala Val Ala Ser Ser Asp Val Leu

290 295 300

Arg Thr Leu Arg Glu Met Arg Ala Arg Ser Ala Met Gly Gly Phe Asp

305 310 315 320

Phe Leu Pro Pro Pro Leu Pro Lys Tyr Tyr Glu Gly Val Arg Arg Ile

325 330 335

Ala Gly Asp Val Leu Ser Glu Ala Gln Ile Lys Glu Cys Gln Glu Leu

340 345 350

Gly Val Leu Val Asp Arg Asp Asp Gln Gly Val Leu Leu Gln Ile Phe

355 360 365

Thr Lys Pro Val Gly Asp Arg Pro Thr Leu Phe Leu Glu Met Ile Gln

370 375 380

Arg Ile Gly Cys Met Glu Lys Asp Glu Arg Gly Glu Glu Tyr Gln Lys

385 390 395 400

Gly Gly Cys Gly Gly Phe Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys

405 410 415

Ser Ile Glu Asp Tyr Glu Lys Ser Leu Glu Ala Lys Gln Ser Ala Ala

420 425 430

Val Gln Ala Ser

435

<210> 6

<211> 436

<212> PRT

<213> wheat (Triticum aestivum L.)

<400> 6

Met Pro Pro Thr Pro Thr Thr Pro Ala Ala Thr Gly Ala Gly Ala Ala

1 5 10 15

Ala Ala Val Thr Pro Glu His Ala Arg Pro Arg Arg Met Val Arg Phe

20 25 30

Asn Pro Arg Ser Asp Arg Phe His Thr Leu Ser Phe His His Val Glu

35 40 45

Phe Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly Arg Phe Ala Phe Ala

50 55 60

Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu Ser Thr Gly Asn Ser

65 70 75 80

Val His Ala Ser Gln Leu Leu Arg Ser Gly Asn Leu Ala Phe Leu Phe

85 90 95

Thr Ala Pro Tyr Ala Asn Gly Cys Asp Ala Ala Thr Ala Ser Leu Pro

100 105 110

Ser Phe Ser Ala Asp Ala Ala Arg Arg Phe Ser Ala Asp His Gly Leu

115 120 125

Ala Val Arg Ser Ile Ala Leu Arg Val Ala Asp Ala Ala Glu Ala Phe

130 135 140

Arg Ala Ser Val Asp Gly Gly Ala Arg Pro Ala Phe Ser Pro Val Asp

145 150 155 160

Leu Gly Arg Gly Phe Gly Phe Ala Glu Val Glu Leu Tyr Gly Asp Val

165 170 175

Val Leu Arg Phe Val Ser His Pro Asp Gly Thr Asp Val Pro Phe Leu

180 185 190

Pro Gly Phe Glu Gly Val Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu

195 200 205

Thr Arg Phe Asp His Val Val Gly Asn Val Pro Glu Leu Ala Ser Ala

210 215 220

Ala Ala Tyr Val Ala Gly Phe Thr Gly Phe His Glu Phe Ala Glu Phe

225 230 235 240

Thr Thr Glu Asp Val Gly Thr Ala Glu Ser Gly Leu Asn Ser Met Val

245 250 255

Leu Ala Asn Asn Ser Glu Gly Val Leu Leu Pro Leu Asn Glu Pro Val

260 265 270

His Gly Thr Lys Arg Arg Ser Gln Ile Gln Thr Phe Leu Glu His His

275 280 285

Gly Gly Pro Gly Val Gln His Ile Ala Val Ala Ser Ser Asp Val Leu

290 295 300

Arg Thr Leu Arg Glu Met Arg Ala Arg Ser Ala Met Gly Gly Phe Asp

305 310 315 320

Phe Leu Pro Pro Pro Leu Pro Lys Tyr Tyr Glu Gly Val Arg Arg Ile

325 330 335

Ala Gly Asp Val Leu Ser Glu Ala Gln Ile Lys Glu Cys Gln Glu Leu

340 345 350

Gly Val Leu Val Asp Arg Asp Asp Gln Gly Val Leu Leu Gln Ile Phe

355 360 365

Thr Lys Pro Val Gly Asp Arg Pro Thr Leu Phe Leu Glu Met Ile Gln

370 375 380

Arg Ile Gly Cys Met Glu Lys Asp Glu Arg Gly Glu Glu Tyr Gln Lys

385 390 395 400

Gly Gly Cys Gly Gly Phe Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys

405 410 415

Ser Ile Glu Asp Tyr Glu Lys Ser Leu Glu Ala Lys Gln Ser Ala Ala

420 425 430

Val Gln Gly Ser

435

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atgccgccca cccccacc 18

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

atccctgaac tgcagcagat tg 22

<210> 9

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

cagtagggga caggccga 18

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ccgcatctta caaacaacat ca 22

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

tggtgtcatc aagcctggta tggt 24

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

actcatggtg catctcaacg gact 24

<210> 13

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

tgctctagaa tgccgcccac ccccacc 27

<210> 14

<211> 51

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

cggggtaccg tggtggtggt ggtggtgtga tccctgaact gcagcagatt g 51

Claims

The application of the 2, 5-dihydroxyphenylacetic acid HGA in inhibiting the germination of wheat or corn rust spores is characterized in that the related genes for synthesizing the HGA areTaHPD，The geneTaHPDThere are three homologous copies on the 6A,6B and 6D chromosomes, the homologous copies of the geneTaHPD-6A、TaHPD-6B、TaHPD-The nucleotide sequences of the 6D are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.
The application of 2.2,5-dihydroxyphenylacetic acid HGA as wheat or corn stripe rust preventing and treating agent is characterized in that the related gene for synthesizing the HGA isTaHPD，The geneTaHPDThere are three homologous copies on the 6A,6B and 6D chromosomes, the homologous copies of the geneTaHPD-6A、TaHPD-6B、TaHPD-The nucleotide sequences of the 6D are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.
3. A method for preventing and treating wheat stripe rust disease is characterized in that 2, 5-dihydroxyphenylacetic acid HGA solution is sprayed on wheat leaves, and the concentration of the HGA solution is 1-10mmol/L.
4. The method for preventing and treating corn stripe rust disease is characterized in that 2, 5-dihydroxyphenylacetic acid HGA solution is sprayed on corn leaves, and the concentration of the HGA solution is 1-20mmol/L.