CN114181956A

CN114181956A - Wheat stripe rust resistance related metabolite, synthesis related gene and application thereof

Info

Publication number: CN114181956A
Application number: CN202210090847.8A
Authority: CN
Inventors: 杨宇衡; 刘赛斐; 马子慧; 肖牧野; 宿嘉轩; 田斌年; 方安菲; 余洋; 毕朝位
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2022-01-26
Filing date: 2022-01-26
Publication date: 2022-03-15
Anticipated expiration: 2042-01-26
Also published as: CN114181956B

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a wheat stripe rust resistance related metabolite, a synthesis related gene and application thereof. In the metabolome and transcriptome joint analysis of wheat infected by puccinia striiformis, 2, 5-dihydroxy phenylacetic acid (HGA) and a synthesis related gene TaHPD thereof are induced to be up-regulated, and the resistance of wheat and corn to rust can be improved by spraying the HGA externally, and the germination of puccinia spores of the puccinia striiformis can be inhibited. It was also demonstrated that changes in HGA content affect plant disease resistance through gene silencing and overexpression of TaHPD. The compound HGA can be processed into a control agent to realize green control of crop diseases.

Description

Wheat stripe rust resistance related metabolite, synthesis related gene and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a natural compound HGA screened in non-affinity interaction of wheat and stripe rust as well as a synthesis related gene and application thereof.

Background

Wheat is a grain crop with wide planting range, high yield and long planting history in the world. The foods such as bread, noodles, steamed bread and the like processed by wheat are popular with people and occupy the consumer market. Statistics show that the planting area of the Chinese wheat is increased from 2407.16 ten thousand hectares in 2014 to 2451.04 thousand hectares in 2017, the yield is increased from 12621.52 thousand tons in 2014 to 13434.06 thousand tons in 2017, and the wheat is in a trend of increasing year by year. It can be seen that the demand for wheat in China continues to increase, and according to the growth rate, the demand is expected to increase by 60% by year 2050. However, due to influences of climate, variety and the like, wheat is threatened by various diseases at any moment to cause yield reduction, and wheat stripe rust is a very important disease.

Wheat stripe rust is a disease caused by Puccinia striiformis f.sp.tritici, Pst, and due to the characteristics of rapid pathogenic variation, frequent variation, outbreak, prevalence, long-term property, relapse and the like of the occurrence of the disease, the frequent loss of stripe rust resistance of a main wheat variety is easily caused, the outbreak prevalence of the wheat stripe rust is caused, and the safety production of the global wheat is seriously threatened.

At present, the disease is mainly controlled chemically, but the long-term and excessive use of chemical agents causes the problems of damage to populations of beneficial microorganisms in soil, excessive heavy metals and other environmental pollution. Therefore, the method enhances the research on the rust resistance mechanism of the wheat, reasonably utilizes the rust resistance of the wheat, and has important significance for delaying germ variation and green regulation of stripe rust.

Disclosure of Invention

In view of the above, it is an object of the present invention to provide a significantly different metabolite HGA and its synthesis-related genes in wheat non-affinity interaction with stripe rust.

The purpose of the invention is realized by the following technical means:

the differential metabolite HGA and the related gene TaHPD for synthesizing the HGA are screened out through association analysis of a metabolome and a transcriptome of wheat and stripe rust non-affinity interaction, the gene TaHPD has three homologous copies on chromosomes 6A, 6B and 6D, and the nucleotide sequences of the homologous copy gene TaHPD-6A, TaHPD-6B, TaHPD-6D are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. P-hydroxyphenylpyruvate dioxygenase (HPD) is an important enzyme in the metabolism of 2, 5-dihydroxyphenylacetic acid (HGA), and TaHPD is a gene encoding p-hydroxyphenylpyruvate dioxygenase (HPD). The amino acid sequences of the coding protein HPD of the gene TaHPD-6A, TaHPD-6B, TaHPD-6D are respectively shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6.

Another object of the invention is to provide a gene silencing vector containing the related gene TaHPD of the anabolic HGA.

The invention also aims to provide a recombinant vector pCNF3-TaHPD containing a related gene TaHPD of an anabolic substance.

The fourth purpose of the invention is to provide the application of HGA in inhibiting the germination of wheat stripe rust spore and/or corn common rust spore.

The fifth purpose of the invention is to provide the application of the HGA as a wheat stripe rust and/or corn rust control agent, which provides a green control technology for wheat stripe rust and has important application prospect.

The invention aims to provide the application of a recombinant vector pCNF3-TaHPD of a TaHPD gene in improving the resistance of tobacco to sclerotinia sclerotiorum.

The seventh purpose of the invention is to provide a method for preventing or inhibiting stripe rust disease of wheat, which comprises the step of spraying HGA solution to wheat leaves, wherein the concentration of HGA in the HGA solution is 1-10 mmol/L. The HGA can improve the stripe rust resistance of wheat and can also effectively inhibit the germination of rust spores.

The invention aims to provide a method for preventing or inhibiting corn rust diseases, which is characterized in that an HGA solution is sprayed on corn leaves, and the concentration of HAG in the HGA solution is 1-20 mmol/L. The HGA can improve the anti-rust capacity of the corn and can also effectively inhibit the germination of rust spores.

Compared with the prior art, the invention has the following beneficial technical effects: the invention discloses a process of a natural compound HGA participating in the stripe rust and rust resistance of plants and a control effect of the HGA as a wheat stripe rust and corn rust control agent for the first time. (1) The wheat stripe rust resistance related metabolite HGA is disclosed for the first time; (2) obtaining a synthetic HGA related gene TaHPD and a nucleotide sequence thereof; (3) molecular biology and genetic engineering techniques are used for verifying that the HGA participates in the process of resisting rust stripe and rust of plants; (4) the exogenous spraying of HGA can improve the stripe rust resistance of wheat and the rust resistance of corn, and can also inhibit the germination of stripe rust bacteria and rust bacteria spores. The invention proves the effect of HGA as a wheat stripe rust and corn rust control agent, and realizes green wheat stripe rust and corn rust control.

Drawings

FIG. 1 is a differential metabolite trend analysis chart of example 1;

FIG. 2 is a diagram showing the analysis of the association between the metabolome and the transcriptome in example 1, a diagram showing the results of the real-time fluorescent quantitative PCR assay in example 5, and a diagram showing the measurement of the HGA content after inoculation;

FIG. 3 is a phenotype plot of exogenous spraying of HGA to wheat (a) and corn (b) in example 2;

FIG. 4 is a graph showing the results of germination effects of HGA treatment of example 3 on wheat stripe rust spores (a) and corn common rust spores (b);

FIG. 5 is the observation of the phenotype of the rust bacterium connected CYR23 after gene silencing (a) and the change of the HGA content after gene silencing (d) in example 6.

FIG. 6 is a photograph showing infection of Sclerotinia sclerotiorum with TaHPD overexpressed in example 7 (a), the diameter of lesion site after infection (b), and the change in HGA content after TaHPD overexpression (c).

Detailed Description

The invention will be described in detail below with reference to the following figures and specific examples:

the wheat Suwon11(Su11), MingXian169(MX169), corn, Nicotiana benthamiana, Ruscus striolata physiological race CYR23, CYR34, common rust of corn, Escherichia coli competent DH5 alpha, Agrobacterium competent GV3101, vector pCNF3, BSMV: gamma and the like are provided by plant fungal disease research laboratories of plant protection institute of southwest university.

The following are examples in which the fluorescent quantitative primers were designed using the NCBI database, and the remaining primers were designed from primer 5. The synthesis of test primers and the sequencing of bacterial liquid are all completed by the company of Biotechnology engineering (Shanghai).

The HGA used in the present invention was purchased from Chiloeei (TCI) Chemicals development Co., Ltd, and other reagents were commercially available.

LB medium formula/L: 10g of tryptone, 5g of yeast extract and 5g of NaCl, and 20g of agar powder is added when solid is prepared; PDA culture medium formula/L: 200g of potatoes, 20g of glucose and 20g of agar.

Example 1 metabolite analysis of Puccinia striiformis CYR23 after infestation of wheat

(1) Material treatment

Disinfecting wheat seeds from a water source 11(Suwon11) with 75% alcohol, cleaning with ultrapure water for 4-5 times, soaking the seeds for accelerating germination, sowing the seeds in a nutrition pot, culturing at 12 +/-2 ℃ until the wheat seedlings grow to the 1-leaf stage, smearing the physiological race CYR23 of the rust stripe on the leaves, keeping moisture in the dark for 24 hours, and taking the normally growing wheat as a control CK. The materials were taken 12h, 24h, and 48h after inoculation, respectively.

(2) Method for detecting metabolite by ultra-high performance liquid chromatography and tandem mass spectrometry

Detecting the metabolites of the material obtained in the step (1) by using ultra performance liquid chromatography and tandem mass spectrometry. The specific operation method comprises the following steps: s1, standard and reagent, all chemical reagents were analytically pure. The water used was double deionized ultrapure water, and the ultrapure water purification system was a Millipore product. Chemical standards were purchased from BioBioPha and Sigma-Aldrich, USA. The standards were dissolved by dimethyl sulfoxide (DMSO) or methanol as solvent and stored at-20 ℃. Working samples of the standards were diluted with 70% methanol to different gradient concentrations for mass spectrometry prior to use. And S2, extracting metabolites, taking out the biological material sample which is subjected to ultralow temperature cryopreservation and obtained in the step S1, and carrying out vacuum freeze drying on the sample. The dried sample was ground for 1.5 minutes at 30Hz using a grinder (MM 400, Retsch), 100mg of the powder was weighed and extracted overnight at 4 ℃ with 1.0ml of 70% methanol containing 0.1mg/l lidocaine as an internal standard, during which time it was vortexed three times to allow more complete extraction. After extraction, 10000g were centrifuged for 10min, the supernatant was aspirated, and the sample was filtered through a microfiltration membrane (0.22 μm pore size) and stored in a sample vial for subsequent LC-MS analysis. Quality control samples (QC) were prepared by mixing sample extracts and used to analyze the reproducibility of samples under the same treatment. During the analysis of the instrument, a QC sample is generally inserted into each 10 samples to be analyzed, so as to check the repeatability of the analysis process. S3, metabolite detection, data acquisition instrument system mainly includes Ultra Performance Liquid Chromatography (UPLC) (Shim-pack UFLC SHIMADZU CBM20A, http:// www.shimadzu.com.cn /) and Tandem mass spectrometry (MS/MS) (Applied Biosystems 4500QTRAP, http:// www.appliedbiosystems.com.cn /). The UPLC analysis conditions mainly include: a chromatographic column: waters acquisition UPLC HSS T3C 181.8 μm, 2.1mm 100 mm; mobile phase: the aqueous phase was ultrapure water (0.04% acetic acid added) and the organic phase was acetonitrile (0.04% acetic acid added); elution gradient, water: acetonitrile, 95:5V/V at 0min, 5:95V/V at 11.0min, 5:95V/V at 12.0min, 95:5V/V at 12.1min, and 95:5V/V at 15.0 min; the flow rate is 0.4 ml/min; the column temperature was 40 ℃; the amount of sample was 5. mu.l. The separated sample enters ESI-QTRAP-MS for mass spectrum analysis. In an API 4500QTRAP LC/MS system, the main parameters of the linear ion trap and the triple quadrupole rod include: electrospray ion source (ESI) temperature was 550 ℃, mass voltage was 5500V, curtain gas (CUR) was 25psi, and collisional-induced ionization (CD) parameter was set high. In the triple quadrupole (QQQ), each ion pair is scan detected based on an optimized Declustering Potential (DP) and Collision Energy (CE). The data obtained were processed with the software Analyst 1.6.1(AB SCIEX).

In the experiment, the detection result shows that the remarkably different metabolites are the most when 24 hours exist among the remarkably different metabolites after the puccinia striiformis CYR23 infects wheat, SN-glycerol-3-phosphorylcholine, orotic acid, niacinamide, nobiletin, ascorbic acid, hesperidin, salicylic acid and neohesperidin are remarkably reduced, 2-aminoadipic acid, methoxyindolacetic acid, N' -p-coumaroylagmatine, N-p-coumaroylbutylamine, L-histidine, L- (+) -arginine, L-saccharopine and 2, 5-dihydroxybenzoic acid which are remarkably increased in degree are subjected to trend analysis (shown in figure 1), and the 2, 5-dihydroxybenzoic acid (HGA) and synthesis related genes TaHPD in a wheat water source 11 are induced to be increased by puccinia stris CYR23 through association analysis of metabolic group and transcriptome (shown in figure 2), the HGA is proved to participate in the stripe rust resistance reaction of the wheat.

Example 2 anti-stripe rust experiment after spraying wheat and corn on HGA leaf surface

(1) Cultivation of materials

Disinfecting 11 wheat seeds at a water source with 75% alcohol, cleaning with ultrapure water for 4-5 times, soaking the seeds for accelerating germination, sowing in a nutrition pot, culturing in a greenhouse at 12 +/-2 ℃, illuminating for 16h, and keeping the temperature dark for 8 h. Sterilizing semen Maydis with 75% alcohol, cleaning with ultrapure water for 4-5 times, soaking seed for germination, sowing in nutrition pot, culturing at 25 + -2 deg.C in greenhouse, and illuminating for 16 hr and in dark for 8 hr.

(2) Material treatment

Respectively spraying HGA solutions with the concentrations of 2.5mmol, 5mmol and 10mmol on the leaf surfaces of the wheat, repeating each treatment for 3 times, not spraying the CK in a control group, respectively rubbing and inoculating the compatible physiological race CYR34 of the puccinia striiformis, and observing the morbidity degree of the leaf blades of the wheat after 12 days of inoculation.

HGA solutions with the concentrations of 5mmol, 10mmol and 20mmol are respectively sprayed on the leaf surfaces of the corn, each treatment is repeated for 3 times, the CK of a control group is not sprayed, then the corn is respectively rubbed and inoculated with common rust, and then the disease degree of the corn leaf is observed.

The experiment shows that the incidence degree of wheat leaves sprayed with 2.5, 5 and 10mmol/L HGA (shown in figure 3) is obviously lower than that of a control group, wherein the incidence degree of the wheat leaves sprayed with 10mmol/L HGA is the lowest. The exogenous spraying of 2.5-10mmol/L HGA on wheat is proved to reduce the incidence degree of wheat stripe rust. The morbidity degree of the corn leaves sprayed with 5, 10 and 20mmol/L of HGA is obviously lower than that of the control group, wherein the morbidity degree of the corn leaves sprayed with 20mmol/L of HGA is the lowest. The exogenous HGA spraying can be proved to reduce the occurrence of common rust of the corn.

Example 3 Effect of HGA on the germination Rate of wheat stripe rust spore and corn common rust spore

HGA solutions were prepared at concentrations of 1mmol/L, 2mmol/L, 5mmol/L and 10mmol/L, respectively. And (3) taking a clean glass slide, adding a drop of HGA solution with different concentrations, adding a drop of distilled water into the control group CK, picking a small amount of rust streak rust spores by using a dissecting needle, respectively placing the rust spores into the solution with different concentrations and the distilled water, and adjusting the concentration of the spores under a macroscopic microscope to obtain 40-60 spores per visual field. The slide glass was placed in a petri dish lined with absorbent paper and then cultured in a 12 ℃. + -. 2 ℃ incubator. After 24h, the mixture is taken out for observation, each treatment is repeated for 3 times, the experimental method for inhibiting the corn rust spores is the same as the above, and the culture temperature is 20 +/-2 ℃.

The experimental result shows (see figure 4), in the inhibition experiment of the wheat stripe rust spore, the HGA with the concentration of 1, 2,5 and 10mmol/L can inhibit the spore germination, wherein, the HGA with the concentration of 10mmol/L has the best inhibition effect on the stripe rust spore, the spore germination can be completely inhibited, and the germ tube generated by the summer spore can be deformed in the low concentration (1-5mmol/L) state. In the spore inhibition experiment of the rust fungus of corn, HGA with the concentration of 1-10mmol/L can cause spore malformation and inhibit the elongation of a germ tube. The experiment proves that 1-10mmol/L HGA can effectively inhibit the germination of wheat stripe rust and corn rust spores.

EXAMPLE 4 obtaining of TaHPD Gene

(1) Extraction of total RNA and reverse transcription thereof

Wheat leaves were subjected to extraction of total RNA from wheat seedlings using a total RNA extraction kit (purchased from Tiangen Biochemical technologies, Ltd.), and then subjected to reverse transcription of RNA into cDNA using a reverse transcription kit (purchased from Thermo Scientific Co., Ltd.), in the following reaction system. First Strand cDNA Synthesis was performed using 1. mu.g of totalRNA according to the Thermo Scientific RevertAID First Strand cDNA Synthesis Kit (Thermo) Kit instructions, adding the following components to the PCR tube of nuclear-free: total RNA 1. mu.g 10 XDaseI Buffer 1. mu.L DNase I1. mu.L nucleic-free ddH2O up to 10. mu.L, after mixing, incubating in a PCR instrument at 37 ℃ for 30min, incubating at 65 ℃ for 5min to inactivate the enzyme, immediately inserting into ice for cooling, and continuing to add the following components to the system: oligo (dT)18 (0.5. mu.g/. mu.L) 1. mu.L of nucleic-free ddH2O 1. mu.L was mixed well, incubated at 65 ℃ for 5min, cooled on ice for 2min, and added with the following components: 5 × Reaction Buffer 4 μ L Ribollock RNase Inhibitor (20U/. mu.L) 1 μ L10 mM dNTP Mix 2 μ L RevertAId M-MuL V RT (200U/. mu.L) 1 μ L after mixing, in the PCR instrument at 45 degrees C after 1h incubation, 70 degrees C incubation for 5min to inactivate the enzyme, the product placed in-20 ℃ storage for use.

(2) And (3) amplification and recovery of a full-length sequence of the TaHPD gene.

An upstream primer: 5'-ATGCCGCCCACCCCCACC-3', as shown in SEQ ID NO. 7;

a downstream primer: 5'-ATCCCTGAACTGCAGCAGATTG-3', as shown in SEQ ID NO. 8;

and (2) performing PCR amplification on the TaHPD gene by taking the reaction product cDNA obtained in the step (1) as a template of PCR reaction, wherein the reaction system is shown in Table 1.

TABLE 1 Gene amplification reaction System

The PCR amplification reaction program is as follows: 95 ℃ for 3min, (95 ℃ for 30sec, 55 ℃ for 30sec, 72 ℃ for 90sec)35 cycles, 72 ℃ for 10min, 16 ℃ to stop the reaction.

And (3) carrying out agarose gel electrophoresis detection on the PCR product, recovering the gel with the target band, sequencing by a biological engineering (Shanghai) corporation, wherein the gene TaHPD has three homologous copies on 6A, 6B and 6D chromosomes, and the nucleotide sequences of the homologous copy gene TaHPD-6A, TaHPD-6B, TaHPD-6D are respectively shown as SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO. 11. The amino acid sequences of the protein HPD coded by the gene TaHPD-6A, TaHPD-6B, TaHPD-6D are respectively shown in SEQ ID NO.12, SEQ ID NO.13 and SEQ ID NO.14, and the HPD is an important enzyme in the HGA metabolic process.

The nucleotide sequence of TaHPD-6A is as follows:

ATGCCGCCCACCCCCACCACCCCCGCAGCCACCGGCGCCGCCGCGGTGACGCCGGAGCACGCGCGGCCGCGCCGAATGGTCCGCTTCAACCCGCGCAGCGACCGCTTCCACACGCTCGCCTTCCACCACGTCGAGTTCTGGTGCGCGGACGCCGCCTCCGCCGCCGGCCGCTTCGCCTTCGCGCTCGGCGCGCCGCTCGCCGCCAGGTCCGACCTCTCCACGGGGAACTCCGTGCACGCCTCCCAGCTGCTCCGCTCGGGCAACCTCGCCTTCCTCTTCACGGCCCCCTACGCCAACGGCTGCGACGCCGCCACCGCCTCCCTGCCCTCCTTCTCCGCCGACGCCGCGCGCCAGTTCTCCGCGGACCACGGCCTCGCGGTGCGCTCCATAGCGCTGCGCGTCGCGGACGCTGCCGAGGCCTTCCGCGCCAGCGTCGACGGGGGCGCGCGCCCGGCCTTCAGCCCTGTGGACCTCGGCCGCGGCTTCGGCTTCGCGGAGGTCGAGCTCTACGGCGACGTCGTGCTCCGCTTCGTCAGCCACCCGGACGGCAGGGACGTGCCCTTCTTGCCGGGGTTCGAGGGCGTGAGCAACCCAGACGCCGTGGACTACGGCCTGACGCGGTTCGACCACGTCGTCGGCAACGTCCCGGAGCTTGCCCCCGCCGCGGCCTACGTCGCCGGGTTCACGGGGTTCCACGAGTTCGCCGAGTTCACGACGGAGGACGTGGGCACGGCCGAGAGCGGGCTCAACTCGATGGTGCTCGCCAACAACTCGGAGGGCGTGCTGCTGCCGCTCAACGAGCCGGTGCACGGCACCAAGCGCCGGAGCCAGATACAGACGTTCCTGGAACACCACGGCGGCTCGGGCGTGCAGCACATCGCGGTGGCCAGCAGCGACGTGCTCAGGACGCTCAGGGAGATGCGTGCGCGCTCCGCCATGGGCGGCTTCGACTTCCTGCCACCCCCGCTGCCGAAGTACTACGAAGGCGTGCGGCGCATCGCCGGGGATGTGCTCTCGGAGGCGCAGATCAAGGAATGCCAGGAGCTGGGGGTGCTCGTCGACAGGGACGACCAAGGGGTGTTGCTACAAATCTTCACCAAGCCAGTAGGGGACAGGCCGACGTTGTTCCTGGAGATGATCCAGAGGATCGGGTGCATGGAGAAGGACGAGAGAGGGGAAGAGTACCAGAAGGGTGGCTGCGGCGGGTTCGGCAAAGGCAACTTCTCCGAGCTGTTCAAGTCCATTGAAGATTACGAGAAGTCCCTTGAAGCCAAGCAATCTGCTGCAGTTCAGGGATCATAG

the nucleotide sequence of TaHPD-6B is as follows:

ATGCCGCCCACCCCCACCACCCCGGCAGCTACCGGCGCCGCCGCCGCCGCCGCGGTGACGCCGGAGCATGCACGGCCACGTAGAATGGTCCGCTTCAACCCGCGGAGCGACCGCTTCCACACGCTCGCCTTCCACCACGTCGAGTTCTGGTGCGCGGACGCCGCCTCCGCCGCCGGCCGCTTCGCCTTCGCGCTCGGCGCGCCGCTCGCCGCCAGGTCCGACCTCTCCACGGGGAACTCCGTGCACGCCTCCCAGCTGCTCCGCTCGGGCAACCTCGCCTTCCTCTTCACCGCGCCCTACGCGAACGGCTGCGACGCCGCCACCGCCTCCCTGCCCTCCTTCTCCGCCGACGCCGCGCGCCGGTTCTCCGCGGACCACGGGCTCGCAGTGCGCTCCATAGCACTGCGCGTCGCAGACGCCGCAGAGGCCTTCCGCGCCAGCGTCGACGGAGGCGCGCGCCCGGCCTTCAGCCCCGTGGACCTCGGCCGCGGCTTCGGCTTCGCGGAGGTCGAGCTCTACGGCGACGTCGTGCTCCGCTTCGTCAGTCACCCGGATGACACGGACGTGCCCTTCTTGCCGGGGTTCGAGGGCGTGAGCAACCCGGATGCCGTGGACTACGGCCTGACGCGGTTCGACCACGTCGTCGGCAACGTCCCGGAGCTTGCCCCCGCCGCCGCATACGTCGCCGGGTTCGCGGGGTTCCACGAGTTCGCCGAGTTCACGACGGAGGACGTGGGCACGGCCGAGAGCGGGCTCAACTCGATGGTGCTCGCCAACAACTCCGAGGGCGTGCTGCTGCCGCTCAACGAGCCGGTGCACGGCACCAAGCGCCGGAGCCAGATACAGACGTTCCTGGAACACCACGGTGGCCCGGGCGTGCAGCACATCGCGGTGGCCAGCAGCGACGTGCTCAGGACGCTCAGGGAGATGCGTGCGCGCTCCGCCATGGGCGGCTTCGACTTCCTGCCACCCCCGCTGCCGAAGTACTATGAAGGCGTGCGGCGCATCGCGGGGGATGTGCTCTCGGAGGCGCAGATCAAGGAATGCCAGGAGCTGGGGGTGCTCGTCGACAGGGACGACCAAGGGGTGTTGCTCCAAATCTTCACCAAGCCAGTGGGGGACAGGCCAACGCTGTTCCTGGAGATGATCCAAAGGATCGGGTGCATGGAGAAGGACGAGAGAGGGGAAGAGTACCAGAAGGGTGGCTGCGGCGGGTTTGGCAAAGGCAACTTCTCCGAGCTGTTCAAGTCCATTGAGGATTATGAGAAATCCCTTGAAGCCAAGCAATCTGCTGCAGTTCAGGCATCATAG

the nucleotide sequence of TaHPD-6D is as follows:

ATGCCGCCCACCCCCACCACCCCCGCAGCCACCGGCGCCGGCGCTGCCGCCGCGGTGACGCCGGAGCACGCGCGGCCGCGCCGAATGGTCCGCTTCAACCCGCGCAGCGACCGCTTCCACACGCTCTCCTTCCACCACGTCGAGTTCTGGTGCGCGGACGCCGCCTCCGCCGCCGGCCGCTTCGCCTTCGCGCTCGGCGCGCCGCTCGCCGCCAGGTCCGACCTCTCCACGGGGAACTCCGTGCACGCCTCCCAGCTGCTCCGCTCGGGCAACCTCGCCTTCCTCTTCACCGCGCCCTACGCCAACGGCTGCGACGCCGCCACCGCCTCCCTGCCCTCCTTCTCCGCCGACGCCGCGCGCCGGTTCTCCGCGGACCACGGGCTCGCGGTGCGCTCCATAGCGCTGCGCGTCGCGGACGCCGCCGAGGCCTTCCGCGCCAGCGTCGACGGGGGCGCGCGCCCGGCCTTCAGCCCCGTGGACCTCGGCCGCGGCTTCGGCTTTGCGGAGGTCGAGCTCTACGGCGACGTCGTGCTCCGCTTCGTCAGCCATCCGGACGGCACGGACGTGCCCTTCTTGCCGGGGTTCGAGGGCGTGAGCAACCCGGGTGCCGTGGACTACGGCCTGACACGGTTTGACCACGTCGTCGGCAACGTCCCGGAGCTTGCTTCCGCCGCCGCCTACGTAGCCGGCTTCACGGGTTTCCATGAGTTCGCCGAGTTCACGACGGAGGACGTGGGCACGGCCGAGAGCGGGCTCAACTCGATGGTGCTCGCCAACAACTCGGAGGGCGTGCTGCTGCCGCTCAACGAGCCGGTGCACGGCACCAAGCGCCGGAGCCAGATACAGACGTTCCTGGAACACCACGGCGGCCCGGGTGTGCAGCACATCGCGGTGGCCAGCAGCGACGTGCTCAGGACGCTCAGGGAGATGCGTGCGCGCTCCGCCATGGGCGGCTTCGACTTCCTGCCACCCCCGCTGCCGAAGTACTACGAAGGCGTGCGGCGCATCGCCGGGGATGTGCTCTCGGAGGCGCAGATCAAGGAATGCCAGGAGCTGGGGGTGCTCGTCGACAGGGACGACCAAGGGGTGTTGCTACAAATCTTCACAAAGCCAGTGGGGGACAGGCCAACGCTGTTCCTGGAGATGATCCAAAGGATCGGGTGCATGGAGAAGGACGAGAGAGGGGAAGAGTACCAGAAGGGTGGCTGCGGCGGGTTCGGCAAAGGCAACTTCTCCGAGCTGTTCAAGTCCATTGAAGATTACGAGAAGTCCCTTGAAGCCAAGCAATCTGCTGCAGTTCAGGGATCATAG

example 5 real-time fluorescent quantitative PCR detection of Gene expression characteristics in wheat under Ruscus Acetobacter Induction conditions

Disinfecting 11 wheat seeds from a water source by using 75% alcohol, cleaning the wheat seeds for 4-5 times by using ultrapure water, soaking the wheat seeds for accelerating germination, sowing the wheat seeds in a nutrition pot, culturing the wheat seeds in an environment with the temperature of 12 +/-2 ℃ until the wheat seedlings grow to the 1-leaf stage, smearing the physiological race CYR23 of the rust streak on leaves, and keeping moisture in the dark for 24 hours, wherein the normally growing wheat is used as a control CK. At 12h, 24h and 48h post inoculation, respectively, the seedling leaves were cut and placed in a refrigerator for use, with 3 biological replicates per sample. Each treated cDNA was obtained according to the method in example 4, and a fluorescent quantitative expression primer was designed based on the full-length cDNA sequence:

upstream primer 5'-CAGTAGGGGACAGGCCGA-3' as shown in SEQ ID NO.9

A downstream primer 5'-CCGCATCTTACAAACAACATCA-3' as shown in SEQ ID NO.10

Internal reference gene primers:

an upstream primer: 5'-TGGTGTCATCAAGCCTGGTATGGT-3', shown in SEQ ID NO.11

A downstream primer: 5'-ACTCATGGTGCATCTCAACGGACT-3', shown in SEQ ID NO.12

Real-time fluorescent quantitative PCR reaction system is shown in Table 2.

TABLE 2 real-time fluorescent quantitative reaction System

The reaction procedure is as follows: the reaction was terminated after 40 cycles of 95 ℃ for 1min, (95 ℃ for 10sec, 60 ℃ for 20sec, and 72 ℃ for 40 sec).

Using the formula of relative quantitation (2)^-ΔΔCt) Calculating the relative expression amount of the TaHPD gene.

Relative ratio of 2^-ΔΔCt，ΔΔCt＝(C_treat ^M-C_treat ^A)-(C_control ^M-C_control ^A)。

As shown in the attached figure 2, the relative expression quantity of the TaHPD gene is up-regulated in 0-48h of inoculated wheat leaves, and is obviously higher than that of control treatment in 24h after inoculation. The experiment proves that the TaHPD gene participates in the process of wheat stripe rust resistance.

Example 6 confirmation of the stripe rust resistance of the TaHPD Gene Using BSMV-mediated Gene silencing experiments

Specific fragments of TaHPD were selected and ligated with BSMV γ to form recombinant vectors. Then, the plasmid of BSMV alpha, the plasmid of BSMV gamma, the plasmid of BSMV PDS and the recombinant plasmid of BSMV TaHPD-V1 are linearized, the MluI is used for the plasmid of BSMV TaHPD-V2, and the Spe I is used for the plasmid of BSMV beta. Using Ribo MAX with linearized plasmid as template^TMThe Large Scale RNA Production Systems-T7 in vitro transcription kit was used to perform in vitro transcription of the plasmids obtained in the above reactions. 0.5. mu.l of the in vitro transcript was diluted 10-fold with nucleose-free water and detected by 1% agarose gel electrophoresis. Storing at-80 deg.C for use.

Inoculation of virus test:

(1) all in vitro transcripts were purified using nucleic-free H₂Diluting by 3 times, and mixing 2.5 mul of alpha, beta, gamma or recombined gamma vector in vitro transcription products respectively in equal quantity;

(2) adding 45 μ l FES buffer solution, mixing with micro-pipette, and dividing into 5 parts;

(3) wearing latex gloves by hand during virus inoculation, dipping the forefinger with virus liquid, selecting a second wheat leaf with good growth state, and rubbing back and forth for 3 times from the base to the tip;

(4) spraying small amount of nucleic-free H onto wheat inoculated with virus₂And O, placing in a greenhouse at the temperature of 25 +/-2 ℃ for keeping the humidity for 24h in a dark place, and culturing in a 16h light/8 h dark period. Each test was inoculated with BSMV gamma as a control and BSMV gamma-PDS as a positive control.

Rust streak inoculation, sampling and phenotypic observation:

when the plant inoculated with BSMV, gamma-PDS, is bleached and faded, wheat with good virus symptoms is selected, and the marked part of the fourth leaf is inoculated with yellow rust CYR 23. The leaves marked and inoculated are cut at 0, 24 and 48hpi respectively, and are frozen by liquid nitrogen and stored at-80 ℃ for later use. The reverse transcription cDNA is used to detect the silencing efficiency of target gene and the expression level of relevant defense gene, and the fourth leaf cDNA of wheat inoculated with BSMV-gamma virus is used as control. After inoculation of the virus, regularly observing and photographing to record infection symptoms of the virus; and (5) after the rust streaks are inoculated, regularly observing and photographing to record the disease condition of the wheat.

Phenotypic observations: after the TaHPD gene of the wheat is silenced, the wheat is more sensitive to stripe rust and the HAG content is obviously reduced (see figure 5). The HGA is proved to be involved in the process of the stripe rust resistance of the wheat.

EXAMPLE 7 construction of recombinant vector pCNF3-TaHPD

Designing primers based on the complete open reading frame of the TaHPD gene:

an upstream primer:

5'-TGCTCTAGAATGCCGCCCACCCCCACC-3' as shown in SEQ ID NO.13

A downstream primer:

5'-CGGGGTACCGTGGTGGTGGTGGTGGTGTGATCCCTGAACTGCAGCAGATTG-3' as shown in SEQ ID NO.14

The PCR amplification product of example 4 was ligated with pCNF 3. The ligation product was then transformed into E.coli DH5 alpha competent (purchased from Shanghai Weidi Biotech Co., Ltd.), the ligation product was added to 50ul of the just thawed competence, mixed well, ice-cooled for 30min, heat-shocked in a water bath at 42 ℃ for 45s, and immediately placed on ice for 2 min. 500ul of LB liquid medium containing no antibiotics was added thereto, and cultured at 37 ℃ for 1 hour at 200 rpm. Centrifuging for 1min, removing part of supernatant with a pipette, flicking suspended thallus, keeping 200ul of bacterial liquid, spreading on LB agar medium containing Kan, inverting the plate, and culturing at 37 deg.C overnight. And (3) selecting a plurality of normal single colonies, respectively putting the single colonies into an LB liquid culture medium containing Kan for culture, shaking the single colonies at 37 ℃ and 200rpm for 12-16 h until the bacterial liquid is turbid, performing bidirectional sequencing on 3 independent clones, and storing the single colonies for later use.

And (3) re-shaking the bacterium solution with correct sequencing, extracting plasmids, performing concentration determination and agarose gel electrophoresis detection after the plasmids are extracted, and selecting plasmid candidates with high concentration and bright bands for later use. Carrying out PCR with the plasmid as a template and a designed cloning primer, wherein the PCR program is as follows: 95 ℃ for 3min, (95 ℃ for 30sec, 55 ℃ for 30sec, 72 ℃ for 90sec)35 cycles, 72 ℃ for 10min, 16 ℃ to stop the reaction.

The PCR product was recovered after agarose gel electrophoresis and the concentration was determined and kept at-20 ℃ until use. And shaking the bacterial liquid of the pCNF3 expression vector, upgrading the particles, and selecting high-concentration bacteria for enzyme digestion test. The cleavage system is shown in Table 3.

TABLE 3 enzyme digestion System

Enzyme digestion is carried out for 4h at 37 ℃, the gel is recovered to obtain the enzyme digestion carrier fragment, and the concentration is measured. And recombining the target segment and the linearized vector segment to obtain the tobacco transient expression vector. By constructing a tobacco transient expression vector, the GV3101 agrobacterium is injected into Nicotiana benthamiana for transient expression.

Transforming the constructed tobacco transient expression vector into an agrobacterium-mediated state, transferring agrobacterium to a liquid culture medium for culture to an exponential phase, centrifugally collecting a thallus precipitate, adding a buffer solution, and suspending until the OD 600 value is about 0.6-0.8, wherein the wheat is infected by an agrobacterium infiltration method. 48h after construction of the tobacco transient expression vector, the newly activated sclerotinia sclerotiorum 1980 was inoculated.

The results of this experiment (see FIG. 6): the incidence area of the pCNF3-TaHPD region injected 24h later was significantly smaller than that of the pCNF3-eGFP region. The content of HGA in pCNF3-TaHPD over-expression plants is significantly higher than that of pCNF 3-eGFP. The experiment shows that the TaHPD is over-expressed to improve the resistance of the tobacco to the sclerotinia sclerotiorum.

Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the spirit and scope of the invention as defined in the appended claims. The techniques, shapes, and configurations not described in detail in the present invention are all known techniques.

Sequence listing

<110> university of southwest

<120> wheat stripe rust resistance related metabolite, synthesis related gene and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1302

<212> DNA

<213> wheat (Triticum aestivum L.)

<400> 1

atgccgccca cccccaccac ccccgcagcc accggcgccg ccgcggtgac gccggagcac 60

gcgcggccgc gccgaatggt ccgcttcaac ccgcgcagcg accgcttcca cacgctcgcc 120

ttccaccacg tcgagttctg gtgcgcggac gccgcctccg ccgccggccg cttcgccttc 180

gcgctcggcg cgccgctcgc cgccaggtcc gacctctcca cggggaactc cgtgcacgcc 240

tcccagctgc tccgctcggg caacctcgcc ttcctcttca cggcccccta cgccaacggc 300

tgcgacgccg ccaccgcctc cctgccctcc ttctccgccg acgccgcgcg ccagttctcc 360

gcggaccacg gcctcgcggt gcgctccata gcgctgcgcg tcgcggacgc tgccgaggcc 420

ttccgcgcca gcgtcgacgg gggcgcgcgc ccggccttca gccctgtgga cctcggccgc 480

ggcttcggct tcgcggaggt cgagctctac ggcgacgtcg tgctccgctt cgtcagccac 540

ccggacggca gggacgtgcc cttcttgccg gggttcgagg gcgtgagcaa cccagacgcc 600

gtggactacg gcctgacgcg gttcgaccac gtcgtcggca acgtcccgga gcttgccccc 660

gccgcggcct acgtcgccgg gttcacgggg ttccacgagt tcgccgagtt cacgacggag 720

gacgtgggca cggccgagag cgggctcaac tcgatggtgc tcgccaacaa ctcggagggc 780

gtgctgctgc cgctcaacga gccggtgcac ggcaccaagc gccggagcca gatacagacg 840

ttcctggaac accacggcgg ctcgggcgtg cagcacatcg cggtggccag cagcgacgtg 900

ctcaggacgc tcagggagat gcgtgcgcgc tccgccatgg gcggcttcga cttcctgcca 960

cccccgctgc cgaagtacta cgaaggcgtg cggcgcatcg ccggggatgt gctctcggag 1020

gcgcagatca aggaatgcca ggagctgggg gtgctcgtcg acagggacga ccaaggggtg 1080

ttgctacaaa tcttcaccaa gccagtaggg gacaggccga cgttgttcct ggagatgatc 1140

cagaggatcg ggtgcatgga gaaggacgag agaggggaag agtaccagaa gggtggctgc 1200

ggcgggttcg gcaaaggcaa cttctccgag ctgttcaagt ccattgaaga ttacgagaag 1260

tcccttgaag ccaagcaatc tgctgcagtt cagggatcat ag 1302

<210> 2

<211> 1311

<212> DNA

<213> wheat (Triticum aestivum L.)

<400> 2

atgccgccca cccccaccac cccggcagct accggcgccg ccgccgccgc cgcggtgacg 60

ccggagcatg cacggccacg tagaatggtc cgcttcaacc cgcggagcga ccgcttccac 120

acgctcgcct tccaccacgt cgagttctgg tgcgcggacg ccgcctccgc cgccggccgc 180

ttcgccttcg cgctcggcgc gccgctcgcc gccaggtccg acctctccac ggggaactcc 240

gtgcacgcct cccagctgct ccgctcgggc aacctcgcct tcctcttcac cgcgccctac 300

gcgaacggct gcgacgccgc caccgcctcc ctgccctcct tctccgccga cgccgcgcgc 360

cggttctccg cggaccacgg gctcgcagtg cgctccatag cactgcgcgt cgcagacgcc 420

gcagaggcct tccgcgccag cgtcgacgga ggcgcgcgcc cggccttcag ccccgtggac 480

ctcggccgcg gcttcggctt cgcggaggtc gagctctacg gcgacgtcgt gctccgcttc 540

gtcagtcacc cggatgacac ggacgtgccc ttcttgccgg ggttcgaggg cgtgagcaac 600

ccggatgccg tggactacgg cctgacgcgg ttcgaccacg tcgtcggcaa cgtcccggag 660

cttgcccccg ccgccgcata cgtcgccggg ttcgcggggt tccacgagtt cgccgagttc 720

acgacggagg acgtgggcac ggccgagagc gggctcaact cgatggtgct cgccaacaac 780

tccgagggcg tgctgctgcc gctcaacgag ccggtgcacg gcaccaagcg ccggagccag 840

atacagacgt tcctggaaca ccacggtggc ccgggcgtgc agcacatcgc ggtggccagc 900

agcgacgtgc tcaggacgct cagggagatg cgtgcgcgct ccgccatggg cggcttcgac 960

ttcctgccac ccccgctgcc gaagtactat gaaggcgtgc ggcgcatcgc gggggatgtg 1020

ctctcggagg cgcagatcaa ggaatgccag gagctggggg tgctcgtcga cagggacgac 1080

caaggggtgt tgctccaaat cttcaccaag ccagtggggg acaggccaac gctgttcctg 1140

gagatgatcc aaaggatcgg gtgcatggag aaggacgaga gaggggaaga gtaccagaag 1200

ggtggctgcg gcgggtttgg caaaggcaac ttctccgagc tgttcaagtc cattgaggat 1260

tatgagaaat cccttgaagc caagcaatct gctgcagttc aggcatcata g 1311

<210> 3

<211> 1311

<212> DNA

<213> wheat (Triticum aestivum L.)

<400> 3

atgccgccca cccccaccac ccccgcagcc accggcgccg gcgctgccgc cgcggtgacg 60

ccggagcacg cgcggccgcg ccgaatggtc cgcttcaacc cgcgcagcga ccgcttccac 120

acgctctcct tccaccacgt cgagttctgg tgcgcggacg ccgcctccgc cgccggccgc 180

ttcgccttcg cgctcggcgc gccgctcgcc gccaggtccg acctctccac ggggaactcc 240

gtgcacgcct cccagctgct ccgctcgggc aacctcgcct tcctcttcac cgcgccctac 300

gccaacggct gcgacgccgc caccgcctcc ctgccctcct tctccgccga cgccgcgcgc 360

cggttctccg cggaccacgg gctcgcggtg cgctccatag cgctgcgcgt cgcggacgcc 420

gccgaggcct tccgcgccag cgtcgacggg ggcgcgcgcc cggccttcag ccccgtggac 480

ctcggccgcg gcttcggctt tgcggaggtc gagctctacg gcgacgtcgt gctccgcttc 540

gtcagccatc cggacggcac ggacgtgccc ttcttgccgg ggttcgaggg cgtgagcaac 600

ccgggtgccg tggactacgg cctgacacgg tttgaccacg tcgtcggcaa cgtcccggag 660

cttgcttccg ccgccgccta cgtagccggc ttcacgggtt tccatgagtt cgccgagttc 720

acgacggagg acgtgggcac ggccgagagc gggctcaact cgatggtgct cgccaacaac 780

tcggagggcg tgctgctgcc gctcaacgag ccggtgcacg gcaccaagcg ccggagccag 840

atacagacgt tcctggaaca ccacggcggc ccgggtgtgc agcacatcgc ggtggccagc 900

agcgacgtgc tcaggacgct cagggagatg cgtgcgcgct ccgccatggg cggcttcgac 960

ttcctgccac ccccgctgcc gaagtactac gaaggcgtgc ggcgcatcgc cggggatgtg 1020

ctctcggagg cgcagatcaa ggaatgccag gagctggggg tgctcgtcga cagggacgac 1080

caaggggtgt tgctacaaat cttcacaaag ccagtggggg acaggccaac gctgttcctg 1140

gagatgatcc aaaggatcgg gtgcatggag aaggacgaga gaggggaaga gtaccagaag 1200

ggtggctgcg gcgggttcgg caaaggcaac ttctccgagc tgttcaagtc cattgaagat 1260

tacgagaagt cccttgaagc caagcaatct gctgcagttc agggatcata g 1311

<210> 4

<211> 433

<212> PRT

<213> wheat (Triticum aestivum L.)

<400> 4

Met Pro Pro Thr Pro Thr Thr Pro Ala Ala Thr Gly Ala Ala Ala Val

1 5 10 15

Thr Pro Glu His Ala Arg Pro Arg Arg Met Val Arg Phe Asn Pro Arg

20 25 30

Ser Asp Arg Phe His Thr Leu Ala Phe His His Val Glu Phe Trp Cys

35 40 45

Ala Asp Ala Ala Ser Ala Ala Gly Arg Phe Ala Phe Ala Leu Gly Ala

50 55 60

Pro Leu Ala Ala Arg Ser Asp Leu Ser Thr Gly Asn Ser Val His Ala

65 70 75 80

Ser Gln Leu Leu Arg Ser Gly Asn Leu Ala Phe Leu Phe Thr Ala Pro

85 90 95

Tyr Ala Asn Gly Cys Asp Ala Ala Thr Ala Ser Leu Pro Ser Phe Ser

100 105 110

Ala Asp Ala Ala Arg Gln Phe Ser Ala Asp His Gly Leu Ala Val Arg

115 120 125

Ser Ile Ala Leu Arg Val Ala Asp Ala Ala Glu Ala Phe Arg Ala Ser

130 135 140

Val Asp Gly Gly Ala Arg Pro Ala Phe Ser Pro Val Asp Leu Gly Arg

145 150 155 160

Gly Phe Gly Phe Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg

165 170 175

Phe Val Ser His Pro Asp Gly Arg Asp Val Pro Phe Leu Pro Gly Phe

180 185 190

Glu Gly Val Ser Asn Pro Asp Ala Val Asp Tyr Gly Leu Thr Arg Phe

195 200 205

Asp His Val Val Gly Asn Val Pro Glu Leu Ala Pro Ala Ala Ala Tyr

210 215 220

Val Ala Gly Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Thr Glu

225 230 235 240

Asp Val Gly Thr Ala Glu Ser Gly Leu Asn Ser Met Val Leu Ala Asn

245 250 255

Asn Ser Glu Gly Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr

260 265 270

Lys Arg Arg Ser Gln Ile Gln Thr Phe Leu Glu His His Gly Gly Ser

275 280 285

Gly Val Gln His Ile Ala Val Ala Ser Ser Asp Val Leu Arg Thr Leu

290 295 300

Arg Glu Met Arg Ala Arg Ser Ala Met Gly Gly Phe Asp Phe Leu Pro

305 310 315 320

Pro Pro Leu Pro Lys Tyr Tyr Glu Gly Val Arg Arg Ile Ala Gly Asp

325 330 335

Val Leu Ser Glu Ala Gln Ile Lys Glu Cys Gln Glu Leu Gly Val Leu

340 345 350

Val Asp Arg Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro

355 360 365

Val Gly Asp Arg Pro Thr Leu Phe Leu Glu Met Ile Gln Arg Ile Gly

370 375 380

Cys Met Glu Lys Asp Glu Arg Gly Glu Glu Tyr Gln Lys Gly Gly Cys

385 390 395 400

Gly Gly Phe Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu

405 410 415

Asp Tyr Glu Lys Ser Leu Glu Ala Lys Gln Ser Ala Ala Val Gln Gly

420 425 430

Ser

<210> 5

<211> 436

<212> PRT

<213> wheat (Triticum aestivum L.)

<400> 5

Met Pro Pro Thr Pro Thr Thr Pro Ala Ala Thr Gly Ala Ala Ala Ala

1 5 10 15

Ala Ala Val Thr Pro Glu His Ala Arg Pro Arg Arg Met Val Arg Phe

20 25 30

Asn Pro Arg Ser Asp Arg Phe His Thr Leu Ala Phe His His Val Glu

35 40 45

Phe Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly Arg Phe Ala Phe Ala

50 55 60

Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu Ser Thr Gly Asn Ser

65 70 75 80

Val His Ala Ser Gln Leu Leu Arg Ser Gly Asn Leu Ala Phe Leu Phe

85 90 95

Thr Ala Pro Tyr Ala Asn Gly Cys Asp Ala Ala Thr Ala Ser Leu Pro

100 105 110

Ser Phe Ser Ala Asp Ala Ala Arg Arg Phe Ser Ala Asp His Gly Leu

115 120 125

Ala Val Arg Ser Ile Ala Leu Arg Val Ala Asp Ala Ala Glu Ala Phe

130 135 140

Arg Ala Ser Val Asp Gly Gly Ala Arg Pro Ala Phe Ser Pro Val Asp

145 150 155 160

Leu Gly Arg Gly Phe Gly Phe Ala Glu Val Glu Leu Tyr Gly Asp Val

165 170 175

Val Leu Arg Phe Val Ser His Pro Asp Asp Thr Asp Val Pro Phe Leu

180 185 190

Pro Gly Phe Glu Gly Val Ser Asn Pro Asp Ala Val Asp Tyr Gly Leu

195 200 205

Thr Arg Phe Asp His Val Val Gly Asn Val Pro Glu Leu Ala Pro Ala

210 215 220

Ala Ala Tyr Val Ala Gly Phe Ala Gly Phe His Glu Phe Ala Glu Phe

225 230 235 240

Thr Thr Glu Asp Val Gly Thr Ala Glu Ser Gly Leu Asn Ser Met Val

245 250 255

Leu Ala Asn Asn Ser Glu Gly Val Leu Leu Pro Leu Asn Glu Pro Val

260 265 270

His Gly Thr Lys Arg Arg Ser Gln Ile Gln Thr Phe Leu Glu His His

275 280 285

Gly Gly Pro Gly Val Gln His Ile Ala Val Ala Ser Ser Asp Val Leu

290 295 300

Arg Thr Leu Arg Glu Met Arg Ala Arg Ser Ala Met Gly Gly Phe Asp

305 310 315 320

Phe Leu Pro Pro Pro Leu Pro Lys Tyr Tyr Glu Gly Val Arg Arg Ile

325 330 335

Ala Gly Asp Val Leu Ser Glu Ala Gln Ile Lys Glu Cys Gln Glu Leu

340 345 350

Gly Val Leu Val Asp Arg Asp Asp Gln Gly Val Leu Leu Gln Ile Phe

355 360 365

Thr Lys Pro Val Gly Asp Arg Pro Thr Leu Phe Leu Glu Met Ile Gln

370 375 380

Arg Ile Gly Cys Met Glu Lys Asp Glu Arg Gly Glu Glu Tyr Gln Lys

385 390 395 400

Gly Gly Cys Gly Gly Phe Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys

405 410 415

Ser Ile Glu Asp Tyr Glu Lys Ser Leu Glu Ala Lys Gln Ser Ala Ala

420 425 430

Val Gln Ala Ser

435

<210> 6

<211> 436

<212> PRT

<213> wheat (Triticum aestivum L.)

<400> 6

Met Pro Pro Thr Pro Thr Thr Pro Ala Ala Thr Gly Ala Gly Ala Ala

1 5 10 15

Ala Ala Val Thr Pro Glu His Ala Arg Pro Arg Arg Met Val Arg Phe

20 25 30

Asn Pro Arg Ser Asp Arg Phe His Thr Leu Ser Phe His His Val Glu

35 40 45

Phe Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly Arg Phe Ala Phe Ala

50 55 60

Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu Ser Thr Gly Asn Ser

65 70 75 80

Val His Ala Ser Gln Leu Leu Arg Ser Gly Asn Leu Ala Phe Leu Phe

85 90 95

Thr Ala Pro Tyr Ala Asn Gly Cys Asp Ala Ala Thr Ala Ser Leu Pro

100 105 110

Ser Phe Ser Ala Asp Ala Ala Arg Arg Phe Ser Ala Asp His Gly Leu

115 120 125

Ala Val Arg Ser Ile Ala Leu Arg Val Ala Asp Ala Ala Glu Ala Phe

130 135 140

Arg Ala Ser Val Asp Gly Gly Ala Arg Pro Ala Phe Ser Pro Val Asp

145 150 155 160

Leu Gly Arg Gly Phe Gly Phe Ala Glu Val Glu Leu Tyr Gly Asp Val

165 170 175

Val Leu Arg Phe Val Ser His Pro Asp Gly Thr Asp Val Pro Phe Leu

180 185 190

Pro Gly Phe Glu Gly Val Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu

195 200 205

Thr Arg Phe Asp His Val Val Gly Asn Val Pro Glu Leu Ala Ser Ala

210 215 220

Ala Ala Tyr Val Ala Gly Phe Thr Gly Phe His Glu Phe Ala Glu Phe

225 230 235 240

Thr Thr Glu Asp Val Gly Thr Ala Glu Ser Gly Leu Asn Ser Met Val

245 250 255

Leu Ala Asn Asn Ser Glu Gly Val Leu Leu Pro Leu Asn Glu Pro Val

260 265 270

His Gly Thr Lys Arg Arg Ser Gln Ile Gln Thr Phe Leu Glu His His

275 280 285

Gly Gly Pro Gly Val Gln His Ile Ala Val Ala Ser Ser Asp Val Leu

290 295 300

Arg Thr Leu Arg Glu Met Arg Ala Arg Ser Ala Met Gly Gly Phe Asp

305 310 315 320

Phe Leu Pro Pro Pro Leu Pro Lys Tyr Tyr Glu Gly Val Arg Arg Ile

325 330 335

Ala Gly Asp Val Leu Ser Glu Ala Gln Ile Lys Glu Cys Gln Glu Leu

340 345 350

Gly Val Leu Val Asp Arg Asp Asp Gln Gly Val Leu Leu Gln Ile Phe

355 360 365

Thr Lys Pro Val Gly Asp Arg Pro Thr Leu Phe Leu Glu Met Ile Gln

370 375 380

Arg Ile Gly Cys Met Glu Lys Asp Glu Arg Gly Glu Glu Tyr Gln Lys

385 390 395 400

Gly Gly Cys Gly Gly Phe Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys

405 410 415

Ser Ile Glu Asp Tyr Glu Lys Ser Leu Glu Ala Lys Gln Ser Ala Ala

420 425 430

Val Gln Gly Ser

435

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgccgccca cccccacc 18

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atccctgaac tgcagcagat tg 22

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cagtagggga caggccga 18

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ccgcatctta caaacaacat ca 22

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tggtgtcatc aagcctggta tggt 24

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

actcatggtg catctcaacg gact 24

<210> 13

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tgctctagaa tgccgcccac ccccacc 27

<210> 14

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cggggtaccg tggtggtggt ggtggtgtga tccctgaact gcagcagatt g 51

Claims

1. The wheat stripe rust resistance related metabolite HGA is characterized in that a related gene for synthesizing the HGA is TaHPD, the gene TaHPD has three homologous copies on 6A, 6B and 6D chromosomes, and nucleotide sequences of the homologous copy gene TaHPD-6A, TaHPD-6B, TaHPD-6D are respectively shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No. 3.

2. The wheat stripe rust resistance-related metabolite HGA according to claim 1, wherein the amino acid sequence of the gene TaHPD-6A, TaHPD-6B, TaHPD-6D encoding protein HPD is shown as SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 respectively, and the HPD is an enzyme important in the HGA metabolic process.

3. A gene silencing vector comprising the gene TaHPD of claim 1.

4. A recombinant vector pCNF3-TaHPD comprising the gene TaHPD according to claim 1.

5. Use of an HGA according to claim 1 for inhibiting germination of rust spores of wheat and/or common rust spores of corn.

6. Use of an HGA according to claim 1 as a control agent for wheat stripe rust and/or corn rust.

7. The use of the recombinant vector pCNF3-TaHPD of claim 4 for regulating the resistance of tobacco to Sclerotinia sclerotiorum.

8. The method for preventing and treating the wheat stripe rust disease is characterized in that the HGA solution of claim 1 is sprayed on wheat leaves, and the concentration of the HGA solution is 1-10 mmol/L.

9. The method for preventing and controlling the rust disease of the corn is characterized in that the HGA solution of claim 1 is sprayed on the corn leaves, and the concentration of the HGA solution is 1-20 mmol/L.