CN114150048A

CN114150048A - System, method and establishment of method for IgA nephropathy detection

Info

Publication number: CN114150048A
Application number: CN202111257672.7A
Authority: CN
Inventors: 蔡广研; 陈香美; 段智宇
Original assignee: Chinese PLA General Hospital
Current assignee: Chinese PLA General Hospital
Priority date: 2014-04-10
Filing date: 2014-04-10
Publication date: 2022-03-08
Anticipated expiration: 2034-04-10
Also published as: CN114015764B; CN114150049A; CN114015764A; CN104975075A; CN114150049B; CN114015765A; CN104975075B; CN114150048B; CN114150050B; CN114150050A; CN114015765B

Abstract

The invention discloses a system, a method and a method for detecting IgA nephropathy, wherein the establishment method comprises the following steps: s10, collecting urine of IgA nephropathy patients, non-IgA nephropathy patients and healthy people; s20, detecting the expression quantity of miRNA in urine; s30, use 2^‑ΔΔctComparing the expression amount of the miRNA by a relative quantification method; s40, carrying out ROC curve analysis on the expression quantity of the miRNA. The detection sample of the invention is urine, but not kidney tissue, the most obvious advantage is the characteristic of non-invasive detection, and the detection has no obvious contraindication, so the invention can be suitable for the detection of all patients.

Description

System, method and establishment of method for IgA nephropathy detection

The invention relates to a divisional application of an invention patent application with application number 201410143612.6, wherein the application date of the invention patent application is 2014, 04 and 10, and the invention is named as establishment of a system, a method and a method for detecting IgA nephropathy.

Technical Field

The invention relates to the technical field of medical diagnosis, in particular to a system, a method and establishment of the method for detecting IgA nephropathy.

Background

At present, the main detection method for diagnosing IgA nephropathy is kidney biopsy, which is characterized in that IgA mass-like or particle-like deposition is carried out on a mesangial area, a patient is in a prone position during kidney biopsy, a needle is inserted into the back of the patient under the guidance of ultrasound through a puncture needle, kidney tissues are rapidly taken out, and the change condition of a kidney is observed under an optical microscope or an electron microscope after a series of fixation and staining so as to diagnose the type of the kidney disease and judge prognosis, but the kidney biopsy has at least the following technical defects:

1. renal biopsy is a traumatic examination and is not recommended in cases where the urine is routinely normal in early patients. When the condition of a patient is aggravated and the kidney pathology needs to be re-evaluated, multiple times of puncture not only aggravates kidney injury, but also risks of complications such as bleeding and infection, and the repeated operation is difficult.

2. Renal biopsy has many contraindications. Such as absolute contraindication, bleeding tendency, severe hypertension, psychosis or uncooperative patients, isolated kidney, and small kidney; the relative contraindication is that the kidney infection is active (such as active pyelonephritis, renal tuberculosis, renal abscess), renal tumor or renal aneurysm, polycystic kidney, excessive obesity, chronic renal failure, severe ascites, heart failure, pregnancy, etc. Therefore, not every patient with renal disease is eligible for a renal biopsy.

3. Renal biopsy also has a number of complications. The most common diseases include hematuria, perirenal abscess, lumbago and waist discomfort, fever, arteriovenous fistula and the like.

4. Renal biopsy takes longer from the preparation of the puncture to the obtaining of the pathological result, the preparation steps are more, and the reaction is slower. Because of invasive examination, the patient needs to stop the anticoagulant before operation, which is not favorable for the patient with cardiovascular disease who needs to use the anticoagulant for a long time, and the patient needs to lie in bed absolutely for 24 hours after operation and cannot get out of bed. The time from puncturing the kidney tissue to fixing, paraffin embedding and immunohistochemical staining until finally observing under a microscope to obtain a pathological result generally needs 5-7 days, and the conditions of untimely diagnosis, misdiagnosis or missed diagnosis are frequently caused by the rapidly-progressing nephropathy such as the rapidly-progressive glomerulonephritis.

Therefore, the diagnostic techniques for IgA nephropathy are currently in need of further improvement.

Disclosure of Invention

The invention aims to establish a method for detecting IgA nephropathy, and aims to solve the technical problems of large body trauma, long detection time, small application range and complex detection steps in the prior art.

Another object of the present invention is to provide a method for detecting IgA nephropathy, which is characterized by a short detection time, a wide application range, and a simple detection procedure, and is applicable to the detection of IgA nephropathy.

It is still another object of the present invention to provide a system for IgA nephropathy detection, which is suitable for an inorganic body wound, and which has a short detection time, a wide application range, and a simple detection procedure.

The invention provides a method for detecting IgA nephropathy, which comprises the following steps:

s10, collecting urine of IgA nephropathy patients, non-IgA nephropathy patients and healthy people;

s20, detecting the expression quantity of miRNA in urine;

s30, use 2^-ΔΔctComparing the expression amount of the miRNA by a relative quantification method;

s40, carrying out ROC curve analysis on the expression quantity of the miRNA.

Optionally, the miRNA is at least one of miRNA-25, miRNA-144 and miRNA-486.

Optionally, the detecting of the expression level of miRNA-25, miRNA-144, and miRNA-486 is performed by at least one method selected from the group consisting of fluorescent quantitative PCR, Taqman probe, and LightCycle probe.

Optionally, the fluorescent quantitative PCR is SYBR Green fluorescent quantitative PCR.

Alternatively, the primers for MiRNA-25 are: CAUUGCACUUGUCUCGGUCUGA, respectively;

and/or, the primers of the MiRNA-144 are: UACAGUAUAGAUGAUGUACU, respectively;

and/or, the primers of MiRNA-486 are: UCCUGUACUGAGCUGCCCCGAG are provided.

Optionally, the primer further comprising housekeeping gene is: AAAGCAGGCUUUAAAGGAACCU are provided.

Optionally, the critical value of miRNA-25 is 0.058;

and/or the cutoff value of miRNA-144 is 0.007;

and/or, the cutoff value for miRNA-486 is 0.025.

It is another object of the present invention to propose a method for IgA nephropathy detection, which is established according to the above method, comprising the steps of:

collecting urine;

detecting the expression level of at least one of miRNA-25, miRNA-144 and miRNA-486 in the urine;

and judging whether the expression level of miRNA-25, miRNA-144 or miRNA-486 is higher than the critical value of each miRNA-25, miRNA-144 or miRNA-486.

It is a further object of the present invention to propose a system for IgA nephropathy detection using the method for IgA nephropathy detection described above, comprising:

a urine collection device to collect urine;

and the miRNA detection device is used for detecting the expression quantity of the miRNA in the urine.

According to the establishment of the method for detecting IgA nephropathy of the present invention, at least one of the following positive technical effects can be achieved:

1. a method for detecting IgA nephropathy can be established efficiently.

2. Since the sample to be tested is urine, not kidney tissue, the most obvious advantage of the present invention is the non-invasive feature, which can be repeatedly or continuously taken and tested according to the disease condition. In addition, the urine which needs to be left and taken does not bring any damage and risk to the patient, and is very safe and reliable.

3. The kit has no obvious contraindication in detection, and can be suitable for detection of all patients.

4. The method for the light quantitative PCR, the Taqman probe and the LightCycle probe is a common technical means and has the advantages of accurate detection, safety, reliability, simplicity and feasibility, general medical personnel, such as primary medical personnel in villages, towns and communities, can completely master the method after being trained for about 1 week, greatly shortens the training period, and effectively solves the problem that the existing renal tissue biopsy has strict limitation on hospitals and medical personnel, so that the invention has wider application space and great popularization value.

5. Compared with the cost of 3000 yuan for the existing renal tissue biopsy, one set of the kit used by the invention only needs 5700 yuan and can be repeatedly used for 50 times, thereby greatly reducing the diagnosis cost of patients.

6. The period from the preparation of patient admission to the final diagnosis report of the existing renal tissue biopsy is about 1 week, but the invention can give results within 24 hours without influencing the work, study and life of the patient, thereby not only greatly shortening the waiting time of the patient, but also striving for the precious time of timely symptomatic treatment for the patient, and effectively preventing the occurrence of misdiagnosis or missed diagnosis.

7. The urine of the patient is simple and easy to obtain and easy to store, and is also suitable for being used when a large number of patients are screened in remote areas.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a schematic flow chart of a method for establishing an IgA nephropathy detection method according to an embodiment of the present invention;

FIG. 2 is a graph showing the comparison of the expression levels of MiRNA-25 between IgA nephropathy patients and healthy subject control groups in examples of the present invention, wherein the abscissa represents the group, 1 represents the healthy subject control group, 2 represents the IgA nephropathy patient group, and the ordinate represents the relative expression levels of MiRNA-25;

FIG. 3 is a graph showing the comparison of the expression levels of MiRNA-144 between IgA nephropathy patients and healthy subject control groups in examples of the present invention, wherein the abscissa represents the group, 1 represents the healthy subject control group, 2 represents the IgA nephropathy patient group, and the ordinate represents the relative expression levels of MiRNA-144;

FIG. 4 is a graph showing the comparison of the expression levels of MiRNA-486 in IgA nephropathy patients and healthy subject control groups in examples of the present invention, wherein the abscissa represents the group, 1 represents the healthy subject control group, 2 represents the IgA nephropathy patient group, and the ordinate represents the relative expression levels of MiRNA-486;

FIG. 5 is a graph showing the comparison of the expression levels of MiRNA-25 between an IgA nephropathy patient and a control group of a nephropathy patient not involved in IgA nephropathy in an example of the present invention, wherein the abscissa represents a group, 1 represents the group of IgA nephropathy patients, 2 represents the control group of nephropathy patient not involved in IgA nephropathy, and the ordinate represents the relative expression levels of MiRNA-25;

FIG. 6 is a graph showing the comparison of the expression levels of MiRNA-144 between an IgA nephropathy patient and a non-IgA nephropathy patient control group, wherein the abscissa shows the relative expression level of MiRNA-25, 1 shows the IgA nephropathy patient group, 2 shows the non-IgA nephropathy patient control group, and the ordinate shows the relative expression level of MiRNA-25;

FIG. 7 is a graph showing the comparison of the expression levels of MiRNA-486 in IgA nephropathy patients and in non-IgA nephropathy patient control groups in examples of the present invention, wherein the abscissa shows the relative expression levels of MiRNA-25, 1 shows the IgA nephropathy patients, 2 shows the non-IgA nephropathy patient control groups, and the ordinate shows the relative expression levels of MiRNA-25;

FIG. 8 is a diagram showing ROC curve analysis of the expression levels of miRNAs according to an embodiment of the present invention, in which the abscissa is specificity and the ordinate is sensitivity, 1 is MiRNA-25, 2 is MiRNA-144, 3 is MiRNA-486, and 4 is a standard reference curve;

FIG. 9 is a ROC curve analysis diagram of miRNA expression levels according to the present invention, wherein the abscissa is specificity and the ordinate is sensitivity, 1 is a combination of the above 3 MiRNA indicators, and 2 is a standard reference curve.

Detailed Description

The invention will be described in detail hereinafter with reference to the accompanying drawings in conjunction with embodiments. It should be noted that the embodiments and features in the embodiments may be combined with each other in the present application without conflict, and the embodiments are exemplary and are only used for explaining the present invention, and are not to be construed as limiting the present invention.

In the present invention, unless otherwise specified, the terms used are understood as follows:

(1) renal biopsy: generally, the renal puncture is an operation in which a puncture needle penetrates a kidney at the back of a patient under the guidance of ultrasound, a part of kidney tissue is taken out, and the lesion of the kidney tissue is observed under an optical microscope or an electron microscope. Because the kidney diseases are of various types, the etiology and pathogenesis are complex, the clinical manifestations of many kidney diseases are not completely consistent with the histological changes of the kidney, and in order to clarify the etiology and pathology of the diseases, the specific disease types suffered by patients need to be further diagnosed, and at this time, renal biopsy is needed.

(2) Micro rna (mirna): the RNA is an endogenous non-coding RNA with a regulation function found in eukaryotes, and the size of the RNA is about 20-25 nucleotides. Mature miRNAs are produced from a long primary transcript by a series of nuclease cleavage processes, which are then assembled into an RNA-induced silencing complex that recognizes a target mRNA by base-complementary pairing and directs the silencing complex to either degrade the target mRNA or repress translation of the target mRNA depending on the degree of complementarity.

(3) SYBR Green fluorescent quantitative PCR: SYBR Green fluorescent quantitative PCR is a dye with Green excitation wavelength which is combined with the minor groove region of double helix of all double-stranded DNA (double-stranded DNA in human and most biological cells), and SYBR Green I emits weak fluorescence in a free state, but the fluorescence is greatly enhanced once combined with the double-stranded DNA. Therefore, the fluorescence signal intensity of SYBR Green I is related to the quantity of double-stranded DNA, the initial concentration of the double-stranded DNA in a detected sample can be calculated according to the fluorescence signal intensity measured by a quantitative PCR instrument, and the copy number of a target gene cannot be calculated, so that the method is a relatively quantitative method.

(4)2^-ΔΔctRelative quantification method: is to analyze genes in real-time quantitative PCR experimentsA simple method for calculating the relative expression level of a target gene from the expression level (CT value) of a housekeeping gene. That is, the relative expression level of the target gene is 2 — (CT value of the target gene — CT value of housekeeping gene).

(5) Baseline (Baseline): it means that the fluorescence signal does not change much in the first few cycles of the PCR amplification reaction, and is close to a straight line, and the straight line is the baseline.

(6) Ct value: is an important concept in the fluorescent quantitative PCR technology, C represents Cycle, t represents threshold, and the specific meaning is the number of cycles that the fluorescent signal in each reaction tube passes when reaching a set threshold. The relation research of the CT value and the initial template shows that the CT value of each template has a linear relation with the logarithm of the initial copy number of the template, and the larger the initial copy number is, the smaller the CT value is.

(7) Urinary sediment: the urine is centrifuged by a centrifuge to precipitate substances, and most of the substances are kidney inherent cells and urothelial cells.

(8) Housekeeping genes: also known as reference genes, are highly conserved genes that are constantly expressed in all cells in an organism and are expressed at all times to maintain essential vital activities of the cells. Housekeeping genes are not only expressed constantly in various tissues, but also expressed stably in various conditions (i.e., the expression level is relatively stable), and are generally not affected by the external environment and the added drugs, and thus are often used as internal references in PCR.

(9) Sensitivity: it is how many times there is no missed diagnosis (false negative) when diagnosing the disease, and the sensitivity is true positive/(true positive + false negative) × 100%.

(10) Specificity: this index indicates how many patients do not have a chance to misdiagnose a disease (false positive), and the specificity is true negative/(true negative + false positive) × 100%.

(11) ROC curve: also known as receiver operator characteristic curve (ROC curve), originally used for evaluating radar performance, also known as receiver operating characteristic curve, is a curve drawn according to a series of different two classification modes (critical values or decision thresholds) with true positive rate (sensitivity) as ordinate and false positive rate (specificity) as abscissa. The main medical applications are: selecting the best disease diagnosis model and abandoning the next best model; the optimal threshold value is set (critical) in the same model.

(12) MiRNA chip: the miRNA substance (probe) is fixed on a chip and combined with the miRNA in the sample in a hybridization mode to identify whether the miRNA is expressed or not and the expression level is high or low. And the miRNA chip adopts a large-scale microarray technology, and one chip contains thousands of probes, so that the screening speed and the screening quantity are greatly improved. Is the first choice method for rapidly and comprehensively comparing miRNA difference between samples.

(13) Parallel (parallel) experiments: that is, if only one of the tests is positive, the test is diagnosed as positive. Its advantages are high sensitivity and low rate of missed diagnosis; but at the same time, the specificity is reduced and the misdiagnosis rate is increased.

An embodiment of the present invention provides a method for establishing an IgA nephropathy detection method, as shown in fig. 1, comprising the steps of:

s10, collecting urine of IgA nephropathy patients, non-IgA nephropathy patients and healthy people.

In this step, three groups of urine were collected from IgA nephropathy patients, non-IgA nephropathy patients, and healthy subjects. Herein, a renal disease patient of non-IgA nephropathy means a renal disease patient who suffers from nephropathy but not IgA nephropathy.

According to an embodiment of the present invention, the kind of urine and the collection time are not particularly limited. For example, according to an embodiment of the present invention, it is preferred to collect morning urine. Because the sample detected by the invention is urine, not kidney tissue, the invention has no trauma to the organism of a patient, and can be repeatedly or continuously taken and tested according to the change of disease conditions. In addition, no obvious contraindication exists during detection, the kit can be suitable for detection of all patients, any damage and risk to the patients cannot be caused by the required urine retention, and the kit is very safe and reliable.

S20, detecting the expression quantity of miRNA in urine.

In this step, the expression level of miRNA in the urine collected in S10 is detected.

The inventor of the invention discovers in research that the expression quantity of miRNA can be changed in the process of the IgA nephropathy, so that early noninvasive early warning of IgA nephropathy can be realized by detecting the expression quantity of miRNAs. The inventor compares the expression profiles of miRNA in the urine of IgA nephropathy and healthy people by using miRNA chips, primarily screens more than 100 different genes, and further screens 3 IgA nephropathy specific miRNA: miRNA-25, miRNA-144, and miRNA-486, the inventors have also found that when 3 mirnas in the urine of the observed subject: when the expression levels of miRNA-25, miRNA-144, and miRNA-486 exceed a certain level, IgA nephropathy is caused.

Therefore, preferably, 3 mirnas are detected in urine: the expression levels of miRNA-25, miRNA-144 and miRNA-486 can quickly and accurately indicate the existence of IgA nephropathy, and help doctors to safely and reliably discover IgA nephropathy patients at early stage without renal biopsy. In addition, the condition of IgA nephropathy patients can be evaluated in a non-invasive manner at any time, the medication of the patients can be adjusted, the symptomatic treatment can be carried out, and the prognosis of the patients can be improved, so that the burden of the country, the society and the family can be relieved.

According to an embodiment of the present invention, the method of detecting the expression amounts of miRNA-25, miRNA-144, and miRNA-486 is not particularly limited, and for example, the detection is performed by a method selected from the group consisting of fluorescent quantitative PCR, Taqman probe, and LightCycle probe.

According to the embodiment of the invention, preferably, an SYBR Green fluorescent quantitative PCR method is selected, the method is simple and easy to operate, the result is reliable and accurate, the patient does not need to make special preparation, the urine is left, all the results can be given within 24 hours, and compared with the time of 5-7 days of the traditional kidney biopsy, the method is very quick and convenient, and the clinical application is wider.

According to the embodiment of the present invention, preferably, the primers of MiRNA-25 are: CAUUGCACUUGUCUCGGUCUGA, respectively;

and/or, the primers of the MiRNA-144 are: UACAGUAUAGAUGAUGUACU, respectively;

and/or, the primers of MiRNA-486 are: UCCUGUACUGAGCUGCCCCGAG are provided.

S30, use 2^-ΔΔctAnd comparing the expression amount of the miRNA by a relative quantification method.

In this step, the expression levels of mirnas detected in S20 are comparatively analyzed to determine whether or not the difference in the expression levels of mirnas in IgA nephropathy patients is significant as compared with a healthy subject control group and a renal disease patient control group other than IgA nephropathy patients.

The present invention utilizes 2^-ΔΔctThe relative quantification method can quantitatively analyze the relative expression level of the target gene, and can calculate the relative expression level of the target gene through the expression level (CT value) of the housekeeping gene, and the method comprises the following specific steps:

relative expression level of the target Gene 2^{- (Gene of interest CT value-housekeeping gene CT value)}，

Thus, it was confirmed whether or not the expression amounts of miRNA-25, miRNA-144, and miRNA-486 were significantly different between the control group of healthy subjects and the control group of renal disease patients having non-IgA nephropathy.

According to the embodiment of the present invention, preferably, the primer further comprising the U6-25 housekeeping gene is: AAAGCAGGCUUUAAAGGAACCU are provided.

S40, carrying out ROC curve analysis on the expression quantity of the miRNA.

In this step, ROC curve analysis is performed on the expression level of miRNA in S20 to determine a critical value of the expression level of miRNA that warns of IgA nephropathy.

According to the embodiment of the invention, when the expression level of miRNA-25 is higher than 0.058 (critical value), the sensitivity of the early warning IgA nephropathy is 81.3%, and the specificity is 100%;

and/or when the expression level of miRNA-144 is higher than 0.007 (critical value), the sensitivity of the early warning IgA nephropathy is 80% and the specificity is 100%;

and/or when the expression level of miRNA-486 is higher than 0.025 (critical value), the sensitivity of the early warning IgA nephropathy is 93.8%, and the specificity is 90.9%.

According to an embodiment of the present invention, it is preferred that when three mirnas: when the three combined indexes of the miRNA-25, the miRNA-144 and the miRNA-486 expression levels are detected together, when one of the three combined indexes is higher than the respective critical value, the IgA nephropathy can be pre-warned, the pre-warned sensitivity can be further improved to 89.9% through combination, and the pre-warned specificity is 100%.

It is specifically noted that the three mirnas of the present invention: the critical values of miRNA-25, miRNA-144 and miRNA-486 are deduced and proved by a great deal of clinical observation and experiments with a great deal of hard labor of the inventor.

Compared with other methods for observing index judgment standards, the ROC curve is used in the invention, so that the ROC curve has the advantages of simple and intuitive method, capability of analyzing the accuracy of the detection method through graphic observation, capability of accurately reflecting the relation between the sensitivity and the specificity of the detection method, no influence of the group morbidity on the evaluation method and the like. The optimal cutoff value is the point closest to the top left ROC curve, which is the best threshold with the least number of errors and the least total number of false positives and false negatives. The sensitivity and specificity corresponding to the optimal critical value are the sensitivity and specificity of the experimental method. Among the three indexes, miR-25 and miR-144 have good specificity which is 100 percent, but the sensitivity is not high. miR-486 has low specificity (90.9%) and good sensitivity (93.8%). The inventor creatively adopts a combined detection test, when one of the three indexes is increased and is higher than a critical value, the IgA nephropathy can be early warned, the sensitivity can be improved, and the missed diagnosis rate can be reduced. Through combined detection, the early warning sensitivity is improved to 89.9%, and the early warning specificity is still 100%, namely the probability of no missed diagnosis is 89.9% when the IgA nephropathy is early warned, the misdiagnosis rate is 0%, and the patient can be accurately judged to be the IgA nephropathy as long as the early warning detection shows that the patient is the IgA nephropathy. Although the invention has 10.1 percent of missed diagnosis opportunities, the detection method of the invention is simple to implement and has no wound, thereby greatly expanding the range of applicable people and being capable of repeatedly detecting for many times, and effectively making up the defect.

According to the establishment of the method for detecting IgA nephropathy in the embodiment of the present invention, at least one of the following positive technical effects can be achieved:

1. a method for detecting IgA nephropathy can be established efficiently.

An embodiment of the present invention further provides a method for IgA nephropathy detection, the method being established according to the method described above, comprising the steps of:

collecting urine;

It will be understood by those skilled in the art that the features and effects described above with respect to the establishment of a method for the detection of IgA nephropathy are, of course, also applicable to the method for the detection of IgA nephropathy and will not be described in detail herein.

According to the embodiment of the invention, the method for detecting the miRNA expression amount is not particularly limited, for example, according to the embodiment of the invention, preferably, the detection method is SYBR Green fluorescent quantitative PCR, the method is simple and easy to operate, the result is reliable and accurate, a patient does not need to make special preparation, only urine is reserved, all the results can be given within 24 hours, and compared with the detection time of 5-7 days of traditional kidney biopsy, the method is very quick and convenient, and the clinical application is wider.

Embodiments of the present invention also provide a system for IgA nephropathy detection using the method for IgA nephropathy detection described above, comprising:

a urine collection device to collect urine;

It will be understood by those skilled in the art that the features and effects described above with respect to the method for IgA nephropathy detection are of course also applicable to the system for IgA nephropathy detection and will not be described in detail herein.

To further illustrate the technical solution of the present invention in detail, the following description of the present invention is provided with specific examples in conjunction with fig. 1 to 9, and it should be noted that these examples are only for illustrative purposes and should not be construed as limiting the present invention in any way. In addition, in the following examples, if not specifically mentioned, all the equipment and materials used are commercially available.

Example 1

1. The main materials are as follows:

1) miRcute miRNAcDNA first strand synthesis kit: model KR201, manufactured by TIANGEN corporation, comprising: the primers for MiRNA-25 were: CAUUGCACUUGUCUCGGUCUGA, MiRNA-144, the primers are: UACAGUAUAGAUGAUGUACU, MiRNA-486 the primers were: UCCUGUACUGAGCUGCCCCGAG, the primers of the U6-25 housekeeping gene are: AAAGCAGGCUUUAAAGGAACCU are provided.

2) TRIzol: (Carlsbad, C), manufactured by life technologies, Inc.

3) Primer:

the primers for MiRNA-25 were: CAUUGCACUUGUCUCGGUCUGA, respectively;

the primers for MiRNA-144 were: UACAGUAUAGAUGAUGUACU, respectively;

primers for MiRNA-486 were: UCCUGUACUGAGCUGCCCCGAG, respectively; and

the primers for the U6-25 housekeeping gene are: AAAGCAGGCUUUAAAGGAACCU are provided.

4) IgA nephropathy patients: IgA nephropathy patients are treated before or after renal puncture for 1 week or more (without complications such as significant bleeding).

2. The main equipment is as follows:

1) PRISM 7500Real Time PCR System: manufactured by Applied Biosystems.

2) SPSS software: SPSS 13.0.

3. The main operation steps are as follows:

1) collecting, storing and recording urinary sediments:

three groups of 50-100 ml morning urine of IgA nephropathy patients, non-IgA nephropathy patients (membranous nephropathy, mesangial proliferative nephritis, minimal disease nephropathy, focal segmental glomerulosclerosis and membranous proliferative glomerulonephritis) and healthy people are collected by using sterile centrifuge tubes respectively, 1-2 tubes of each group are placed into an ice box or stored at 4 ℃.

2) Sample treatment of urinary sediment and extraction of total RNA:

centrifuging morning urine at 4 deg.C and 3000g for 30min, pouring out supernatant, adding 1ml PBS into urine sediment, mixing, adding into 1.5ml EP tube, centrifuging at 4 deg.C and 13000g for 10 min. The supernatant was removed again and the urinary sediment was retained.

3) Extracting total RNA in urinary sediment by a TRIzol method:

adding 1ml TRIzol, mixing, incubating at 4 deg.C for 5min, adding 200ul chloroform, shaking, mixing, incubating at 4 deg.C for 5min, and centrifuging at 12000rpm for 10min at 4 deg.C;

carefully taking out the EP tube, wherein the liquid in the visible tube is divided into 3 layers, the first layer is an upper layer of clear liquid, namely an RNA layer, the middle layer is a white protein layer, the lowest layer is a red DNA layer, the upper layer of clear liquid is transferred into a new EP tube, the total volume of the transfer is recorded, isopropanol with the same volume is added, the mixture is inverted and mixed up and down, and the mixture is incubated for 10min at 4 ℃;

centrifuging at 4 deg.C and 12000rpm for 15min to obtain total RNA as small amount of white precipitate at the bottom of the tube, pouring out supernatant, and immediately adding 1ml of 75% alcohol (prepared with water without RNase);

centrifuging at 4 deg.C and 12000rpm for 5min, removing supernatant, and adding 1ml 75% ethanol again;

centrifuging at 4 deg.C and 12000rpm for 5min, pouring out supernatant, centrifuging at 4 deg.C and 12000rpm for 1min, sucking residual supernatant with gun head, sucking, opening EP tube cover, standing at room temperature for 15min, and air drying residual alcohol;

adding 32ul of RNase-free water, standing at 4 deg.C for 30min to dissolve RNA in water completely; 2ul of RNA solution was taken and RNA concentration was measured by NANODROP 2000 c.

4) Sample cDNA synthesis:

reverse transcription of total RNA into double-stranded cDNA using miRcute miRNA cDNA first strand synthesis kit:

fixing the Total RNA mass of the sample to be 500ng (Total system is 500ng), and calculating the volume of the added RNA solution (Total RNA) according to the measured concentration;

preparing a new 0.5ml EP tube without RNAm enzyme, sequentially adding 2ul 10 XPoC (A) Polymerase Buffer, 4ul 5 XPTP Solution, and 0.4ul E.coli Poly (A), calculating the volume of RNA Solution, and adding RNase-Free ddH₂O makes the total volume up to 20 ul;

after short-time centrifugation, reacting for 60min at 37 ℃ to obtain a reaction solution of Poly (A);

a new 0.5ml EP tube without RNase was prepared, and RNase-Free d was added to the tube in orderdH₂O11.5 ul, Poly (A) reaction solution 2ul, 10 XTR Primer (10 uM) 2ul, 10 XTR Buffer 2ul, Super Pure dNTP (2.5mM each)1ul, RNase (40U/ul)1ul, and Quant Rtase 0.5ul, to obtain a double-stranded cDNA solution with a total volume of 20 ul.

5) Detecting the expression level of miRNA:

the detection of the expression level of the gene to be detected in the synthesized cDNA is based on SYBR Green fluorescent quantitative PCR technology.

The reaction system is configured as follows: 2 × miRcute mirnapurix 10ul, 50 × ROX Reference Dye 1.6ul, Reverse Primer 0.4ul, ddH₂O5.6 ul, specific primer 0.4ul, cDNA solution 2ul generated in the previous step.

The reaction was carried out in the PRISM 7500Real Time PCR System under the following conditions: 1 × (1 cycle) -94 ℃, 2min (initial template denaturation); then 35-45 × (35 to 45 cycles) -94 ℃, 20sec (template denaturation during PCR cycles) and 60 ℃, 34sec (annealing, extension). Each indicator for each sample was provided with 2 secondary wells (i.e. all conditions were unchanged and 2 more replicates were performed). The housekeeping gene (U6) is used in the reaction to amplify with the sample to be tested simultaneously, thereby determining the expression level of the target gene in the sample.

6)2^-ΔΔctComparing the expression level of miRNA by a relative quantification method:

using SPSS software, adopt 2^-ΔΔctComparing the expression levels of miRNA-25, miRNA-144, and miRNA-486 by a relative quantitation method, i.e., 2^{- [ (CT value of objective Gene of Experimental group-CT value of housekeeping Gene of Experimental group) - (CT value of objective Gene of control group-CT value of housekeeping Gene of control group)]}，2^-ΔΔctExpressing the expression of the target gene of the experimental group relative to the target gene of the control group by the following specific operations:

the expression levels of miRNA-25, miRNA-144, and miRNA-486 were compared between IgA nephropathy patients and healthy control groups, as shown in FIGS. 2 to 4.

The expression levels of miRNA-25, miRNA-144, and miRNA-486 were compared between IgA nephropathy patients and non-IgA nephropathy patient control groups, respectively, as shown in FIGS. 5 to 7.

From the above figures 2 to 7, it is clear that the relative expression amounts of miRNA-25, miRNA-144, and miRNA-486 in IgA nephropathy patients are significantly higher than those in healthy patients and non-IgA nephropathy patients, and the difference is significant. Therefore, the IgA nephropathy can be pre-warned by detecting the expression amount of miRNA-25, miRNA-144 and miRNA-486 in urine.

FIG. 2 shows the expression level of miR-25 in a healthy subject control group (group 1) (2)^-ΔΔctRelative quantification method) is 0.0272152 + -0.0145227, the expression level of miR-25 in IgA nephropathy group (group 2) is 0.239375 + -0.3035597, the expression level of miR-25 in IgA nephropathy group is significantly higher than that in healthy control group, and p is less than 0.001.

FIG. 3 shows that the miR-144 expression level in the healthy subject control group (group 1) is 0.002196 + -0.002328, the IgA nephropathy group (group 2) is 0.124129 + -0.246618, the miR-144 expression level in the IgA nephropathy group is significantly higher than that in the healthy subject control group, and p is less than 0.001.

FIG. 4 shows that the expression level of miR-486 in the healthy subject control group (group 1) is 0.012846 + -0.011028, that in the IgA nephropathy group (group 2) is 0.272673 + -0.527395, that in the IgA nephropathy group miR-486, the expression level is significantly higher than that in the healthy subject control group, and that p is less than 0.001.

FIG. 5 shows that the expression level of miR-25 in the IgA nephropathy group (group 1) is 0.239375 + -0.3035597, while that in the control group (group 2) of patients with renal disease other than IgA nephropathy is 0.064979 + -0.051222, and that the expression level of miR-25 in the IgA nephropathy group is significantly higher than that in the control group of patients with renal disease other than IgA nephropathy, and p is less than 0.001.

Fig. 6 shows that the expression level of miR-144 in the IgA nephropathy group (group 1) was 0.124129 ± 0.246618, whereas the expression level of miR-144 in the non-IgA nephropathy patient control group (group 2) was 0.029361 ± 0.062052, and the expression level of miR-144 in the IgA nephropathy group was significantly higher than that in the non-IgA nephropathy patient control group, and p was 0.003.

FIG. 7 shows that the expression level of miR-486 in the IgA nephropathy group (group 1) was 0.272673 + -0.527395, whereas that in the control group of renal disease patients other than IgA nephropathy (group 2) was 0.050362 + -0.058641, and that the expression level of miR-486 in the IgA nephropathy group was significantly higher than that in the control group of renal disease patients other than IgA nephropathy, and p was < 0.001.

As can be seen from figures 2-7, the expression quantities of miR-25, miR-144 and miR-486 in the IgA nephropathy group are obviously higher than those of a healthy patient control group and a non-IgA nephropathy patient control group, the increase of the expression quantities is strongly related to IgA nephropathy early warning, and the increase can be used as an IgA nephropathy specific early warning index.

7) ROC curve analysis of miRNA expression level:

by using SPSS software, three indexes of miRNA-25, miRNA-144 and miRNA-486 are combined to perform ROC curve analysis on the early warning value of IgA nephropathy, and the results are shown in FIG. 8 and the following table 1.

TABLE 1 statistical table of ROC curve analysis of miRNA expression

As can be seen from fig. 8 and table 1:

when the expression level of miRNA-25 is higher than 0.058 (critical value), the sensitivity of the early warning IgA nephropathy is 81.3%, and the specificity is 100%;

The AUC (area under the curve) can evaluate the accuracy of the early warning, namely the larger the AUC is, the higher the accuracy of the early warning is. The area value under the ROC curve is between 1.0 and 0.5, and the accuracy is good when the area value is more than 0.9. The area values under the ROC curve of the invention are all above 0.9, which shows that the invention has good accuracy and high reliability.

The 95% CI means a 95% confidence interval for AUC, i.e. a 95% likelihood that AUC falls within this range, indicating that the accuracy of the present invention is very reliable.

The P value is the probability for judging error, and is generally considered to be less than 0.05, i.e. a small probability event, which is almost impossible to occur in a test, and can be considered to be correct. The P values of the invention are all less than 0.0001, namely the invention warns that the patient is IgA nephropathy, and the probability that the patient is not (makes mistakes) IgA nephropathy is less than 0.01%, which is almost impossible, and shows that the invention has very high judgment accuracy.

The invention also relates to the three miRNAs: the results of ROC curve analysis of the combined indices of expression levels of miRNA-25, miRNA-144, and miRNA-486 are shown in FIG. 9 and Table 2 below.

TABLE 2 ROC Curve analysis statistical Table of combined indexes of miRNA expression

As can be seen from fig. 9 and table 2:

when three mirnas: when the three combined indexes of the miRNA-25, the miRNA-144 and the miRNA-486 expression levels are detected together, when one of the three combined indexes is higher than the respective critical value, the IgA nephropathy can be pre-warned, the pre-warned sensitivity can be further improved to 89.9% through combination, and the pre-warned specificity is 100%. Therefore, the invention can provide a very accurate detection method for early warning of IgA nephropathy.

As can be seen from FIGS. 2 to 4, when the urinary sediment miRNA is detected by the fluorescent quantitative PCR, the expression levels of the miRNA-25, the miRNA-144 and the miRNA-486 of the IgA nephropathy patient are obviously higher than those of a healthy person control group, p is less than 0.001, and the difference has obvious statistical significance.

As can be seen from FIGS. 5 to 7, when urinary sediment miRNA is detected by fluorescent quantitative PCR, the expression levels of miRNA-25, miRNA-144 and miRNA-486 of IgA nephropathy patients are significantly higher than those of non-IgA nephropathy patients in a control group (membranous nephropathy, mesangial proliferative nephritis, minimal change nephropathy, focal segmental glomerulosclerosis and membranous proliferative glomerulonephritis), p is less than 0.001, and the difference has significant statistical significance.

FIGS. 2 to 7 show that the expression levels of miRNA-25, miRNA-144, and miRNA-486 in urinary sediment in IgA nephropathy-specific miRNAs are significantly higher than those in the control group of healthy subjects and the control group of renal disease patients having non-IgA nephropathy.

In order to find out the critical values (or threshold values) of three indexes for early warning of IgA nephropathy and the corresponding sensitivity and specificity, the expression amounts of the three miRNAs are substituted into the ROC curve analysis, and FIG. 8 and Table 1 can be obtained. As can be seen from FIG. 8 and Table 1, the above three indexes have good sensitivity and specificity when the IgA nephropathy is pre-warned independently, wherein the sensitivity of miRNA-25 is 81.3%, and the specificity is 100%; the sensitivity of miRNA-144 is 80% and the specificity is 100%; the sensitivity of miRNA-486 was 93.8% and the specificity was 90.9%. And the early warning accuracy is higher (AUC > 0.9).

Because the specificity (100%) of miRNA-25 and miRNA-144 for early warning IgA nephropathy is very good and the sensitivity is relatively poor, in order to improve the sensitivity of the early warning IgA nephropathy and improve the early warning efficiency, the parallel test (combined detection) is carried out, namely, when one of the three indexes is higher than the critical value of each index, the IgA nephropathy can be early warned. As can be seen from fig. 9 and table 2, the sensitivity of the early warning can be further improved to 89.9% by jointly detecting the three indicators, and the specificity of the early warning is still 100%. Therefore, the invention can provide a very accurate detection method for early warning of IgA nephropathy.

Example 2

To further examine the utility and accuracy of the present invention, the inventors randomly sampled 10 renal disease patients who were newly admitted to the hospital and did not undergo renal biopsy (i.e., will do), and 10 healthy persons who were sex-matched and age-matched, and randomly numbered them, followed by the examination according to the technical scheme of example 1, and warned 6 IgA renal disease patients. After one week of kidney biopsy, the number of IgA nephropathy patients was 6, which was completely consistent with the early warning results of the present invention, while the differences in the expression levels of the above miRNAs between 4 other non-IgA nephropathy patients (membranous nephropathy 2, minimal disease nephropathy 1, focal segmental glomerulosclerosis 1) and 10 healthy patients were not statistically significant. Therefore, the practicability and the accuracy of the method are further shown to be high.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A kit for IgA nephropathy detection, comprising:

and the miRNA primer is used for detecting the miRNA-144 expression level in urine of IgA nephropathy patients, non-IgA nephropathy patients and healthy people.

2. The kit for the detection of IgA nephropathy according to claim 1, wherein the detection of the expression level of miRNA-144 is performed by at least one method selected from the group consisting of quantitative fluorescent PCR, Taqman probe, and LightCycle probe.

3. The kit for IgA nephropathy detection according to claim 2, wherein the fluorescent quantitative PCR is SYBR Green fluorescent quantitative PCR.

4. The kit for IgA nephropathy detection according to claim 3,

the primers of the MiRNA-144 are as follows: UACAGUAUAGAUGAUGUACU are provided.

5. The kit for IgA nephropathy detection according to claim 4, further comprising a housekeeping gene primer comprising: AAAGCAGGCUUUAAAGGAACCU are provided.

6. The kit for IgA nephropathy detection according to claim 5,

the cut-off value of the miRNA-144 is 0.007.