CN114150050B

CN114150050B - System, method and method establishment for IgA nephropathy detection

Info

Publication number: CN114150050B
Application number: CN202111257687.3A
Authority: CN
Inventors: 蔡广研; 陈香美; 段智宇
Original assignee: Chinese PLA General Hospital
Current assignee: Chinese PLA General Hospital
Priority date: 2014-04-10
Filing date: 2014-04-10
Publication date: 2023-07-07
Anticipated expiration: 2034-04-10
Also published as: CN114150049A; CN114015765B; CN104975075A; CN114015764B; CN114150048B; CN114015764A; CN114150050A; CN114150049B; CN114015765A; CN114150048A; CN104975075B

Abstract

The invention discloses a system, a method and establishment of a method for IgA nephropathy detection, wherein the establishment method comprises the following steps: s10, collecting IgA nephropathyUrine from patients, non-IgA kidney disease patients, and healthy subjects; s20, detecting the expression quantity of miRNA in urine; s30, utilization 2 ^‑ΔΔct Comparing the expression level of the miRNA by a relative quantification method; s40, performing ROC curve analysis on the expression quantity of the miRNA. The detection sample provided by the invention is urine, but not kidney tissue, has the most obvious advantage of non-invasive detection, and can be suitable for detection of all patients because no obvious contraindications exist during detection.

Description

System, method and method establishment for IgA nephropathy detection

The present application is a divisional application of the invention patent application with application number 201410143612.6, the application date of which is 10 th 2014, and the invention is entitled "a system, a method and establishment of a method for IgA nephropathy detection".

Technical Field

The invention relates to the technical field of medical diagnosis, in particular to a system, a method and establishment of the method for IgA nephropathy detection.

Background

At present, the main detection method for IgA nephropathy diagnosis is kidney biopsy, which is characterized in that IgA mass-like or particle-like deposition is carried out on a glomerular membrane area, a patient takes a prone position during kidney biopsy, a puncture needle is inserted into the back of the patient under the guidance of ultrasound, kidney tissues are rapidly taken out, and after a series of fixation and staining, kidney change conditions are observed under an optical microscope or an electron microscope so as to diagnose the type of nephropathy and judge prognosis, but the kidney biopsy has at least the following technical defects:

1. renal biopsy is a invasive test, which is not recommended in the case of normal routine urine in early patients. When the patient suffers from serious illness and needs to re-evaluate kidney pathology, the kidney injury is aggravated by repeated puncture, and complications such as hemorrhage and infection are also complicated, so that the repeated puncture is difficult to be performed.

2. There are many contraindications for kidney biopsy. Such as absolute contraindications, obvious bleeding tendency, severe hypertension, psychotic or uncoordinated person, isolated kidney, small kidney, etc.; the contraindications are that kidney infection is active (such as active pyelonephritis, renal tuberculosis, and renal abscess), renal tumor or renal aneurysm, polycystic kidney, excessive obesity, chronic renal failure, severe ascites, heart failure, and pregnancy. Thus, not every kidney patient is suitable for taking a kidney biopsy.

3. There are also a number of complications with renal biopsy. Most commonly, such as hematuria, perirenal abscess, lumbago, lumbar discomfort, fever, arteriovenous fistula, etc.

4. The time spent for the kidney biopsy from the preparation of puncture to the obtaining of pathological results is longer, the preparation steps are more, and the reaction is slower. Because of the invasive examination, patients need to deactivate anticoagulants before surgery, which is disadvantageous for patients with cardiovascular diseases who have to use anticoagulants for a long period of time, and patients must lie on bed 24 hours after surgery and are absolutely bedridden and must not get out of bed to walk. The time from puncturing kidney tissue to fixing, paraffin embedding and immunohistochemical staining is generally 5-7 days until the pathological result is observed under a microscope, and the condition of untimely diagnosis, misdiagnosis or missed diagnosis often occurs when kidney diseases such as rapid-progressive glomerulonephritis and the like are frequently diagnosed.

Therefore, the current diagnostic technique for IgA nephropathy is still further improved.

Disclosure of Invention

The invention aims to establish a detection method for IgA nephropathy, and aims to solve the technical problems of large injury to a body, long detection time, small application range and complex detection steps in the detection in the prior art.

Another object of the present invention is to provide a method for IgA nephropathy detection, which aims to provide a method for IgA nephropathy detection which is inorganic, short in detection time, wide in application range and simple in detection steps.

It is still another object of the present invention to provide a system for IgA nephropathy detection, aiming at providing a system suitable for an IgA nephropathy detection method which is inorganic body trauma, short in detection time, wide in application range and simple in detection steps.

The invention provides establishment of a detection method for IgA nephropathy, which comprises the following steps:

s10, collecting urine of IgA nephropathy patients, non-IgA nephropathy patients and healthy persons;

s20, detecting the expression quantity of miRNA in urine;

s30, utilization 2 ^-ΔΔct Comparing the expression level of the miRNA by a relative quantification method;

s40, performing ROC curve analysis on the expression quantity of the miRNA.

Optionally, the miRNA is at least one of miRNA-25, miRNA-144 and miRNA-486.

Alternatively, the detection of the expression amounts of miRNA-25, miRNA-144 and miRNA-486 is performed by at least one method selected from the group consisting of fluorescent quantitative PCR, taqman probe and LightCycle probe.

Optionally, the fluorescent quantitative PCR is SYBR Green fluorescent quantitative PCR.

Alternatively, the primer of MiRNA-25 is: CAUUGCACUUGUCUCGGUCUGA;

and/or, the primer of MiRNA-144 is: UACAGUAUAGAUGAUGUACU;

and/or, the primer of MiRNA-486 is: UCCUGUACUGAGCUGCCCCGAG.

Optionally, the primers further comprising housekeeping genes are: AAAGCAGGCUUUAAAGGAACCU.

Alternatively, the threshold for miRNA-25 is 0.058;

and/or, the threshold value of miRNA-144 is 0.007;

and/or, the threshold for miRNA-486 is 0.025.

It is another object of the present invention to provide a method for IgA nephropathy detection, which is established according to the above-described method, comprising the steps of:

collecting urine;

detecting the expression level of at least one of miRNA-25, miRNA-144 and miRNA-486 in urine;

judging whether the expression quantity of miRNA-25, miRNA-144 or miRNA-486 is higher than the respective critical value.

It is a further object of the present invention to propose a system for IgA nephropathy detection, which is detected using the method for IgA nephropathy detection described above, which comprises:

a urine collection device to collect urine;

miRNA detection device to detect the expression level of miRNA in urine.

According to the establishment of the detection method for IgA nephropathy of the present invention, at least one of the following positive technical effects can be achieved:

1. a method for IgA nephropathy detection can be effectively established.

2. Since the sample to be tested is urine, but not kidney tissue, the invention has the most obvious advantage of having a non-invasive feature, and can be repeatedly or continuously taken and tested according to the change of the disease condition. In addition, the urine to be taken can not bring any damage and risk to the patient, and is very safe and reliable.

3. Because no obvious contraindication exists in detection, the method can be suitable for detection of all patients.

4. As the methods of the light quantitative PCR, the Taqman probe and the LightCycle probe are common technical means, and have the advantages of accurate detection, safety, reliability, simplicity, practicability and the like, general medical staff, such as basic medical staff in villages and towns and communities, can completely master the method through training for about 1 week, the training period is greatly shortened, and the problem that the requirements of the existing kidney tissue biopsy on hospitals and medical staff are strictly limited is effectively solved, so that the invention has wider application space and huge popularization value.

5. Compared with the cost of 3000 yuan of the existing kidney tissue biopsy, the kit used in the invention only needs about 5700 yuan and can be repeatedly used for 50 times, thereby greatly reducing the diagnosis cost of patients.

6. The period from the preparation of the patient admission to the final giving of the diagnosis report of the existing kidney tissue biopsy is about 1 week, and the invention can give the result within 24 hours without affecting the work, study and life of the patient, thereby not only greatly shortening the waiting time of the patient, but also striving for the precious time of timely symptomatic treatment for the patient, and effectively preventing the occurrence of misdiagnosis or missed diagnosis.

7. Because the urine of the patient is simple and easy to obtain and easy to store, the urine is also suitable for the use in the remote area for screening the patient in a large amount.

Drawings

The foregoing and/or additional aspects and advantages of the invention will become apparent and may be better understood from the following description of embodiments taken in conjunction with the accompanying drawings in which:

FIG. 1 is a schematic flow chart of a method for establishing an IgA nephropathy detection method according to an embodiment of the present invention;

FIG. 2 is a graph showing the relative amounts of MiRNA-25 expressed in IgA nephropathy patients and healthy subject control groups according to an embodiment of the present invention, wherein the graph shows the group on the abscissa, 1 is the healthy subject control group, 2 is the IgA nephropathy patients, and the relative amounts of MiRNA-25 on the ordinate;

FIG. 3 is a graph showing the relative amounts of MiRNA-144 expressed between IgA nephropathy patients and healthy subject control groups according to an embodiment of the present invention, wherein the abscissa indicates the group, 1 indicates the healthy subject control group, 2 indicates the IgA nephropathy patients, and the ordinate indicates the relative amounts of MiRNA-144;

FIG. 4 is a graph showing the relative amounts of MiRNA-486 expressed in IgA nephropathy patients and healthy subject control groups according to an embodiment of the present invention, wherein the graph shows the group on the abscissa, 1 is the healthy subject control group, 2 is the IgA nephropathy patient group, and the relative amounts of MiRNA-486 expressed on the ordinate;

FIG. 5 is a graph showing the relative amounts of MiRNA-25 expressed in IgA nephropathy patients and non-IgA nephropathy patients in comparison with each other, wherein the graph shows the group on the abscissa, 1 is IgA nephropathy patients, 2 is non-IgA nephropathy patients, and the ordinate shows the relative amounts of MiRNA-25;

FIG. 6 is a graph showing the comparative expression level of MiRNA-144 in IgA nephropathy patients and non-IgA nephropathy patients in the control group according to the present invention, wherein the group is indicated by the abscissa, the group is indicated by 1, the control group is indicated by 2, and the relative expression level of MiRNA-25 is indicated by the ordinate;

FIG. 7 is a graph showing the relative expression levels of MiRNA-486 between IgA nephropathy patients and non-IgA nephropathy patient control groups in which the abscissa indicates the group, 1 indicates the IgA nephropathy patient group, 2 indicates the non-IgA nephropathy patient control group, and the ordinate indicates the relative expression levels of MiRNA-25;

FIG. 8 is an ROC curve analysis chart of miRNA expression amount in the embodiment of the invention, in which the abscissa is specificity, the ordinate is sensitivity, 1 is MiRNA-25,2 is MiRNA-144,3 is MiRNA-486,4 is a standard reference curve;

FIG. 9 is an analysis chart of ROC curve of miRNA expression amount in the embodiment of the present invention, in which the abscissa is specificity, the ordinate is sensitivity, 1 is a standard reference curve in combination with the above 3 MiRNA indexes, and 2 is a standard reference curve.

Detailed Description

The invention will be described in detail hereinafter with reference to the drawings in conjunction with embodiments. It should be noted that, in the case of no conflict, the embodiments and features in the embodiments may be combined with each other, and in addition, the embodiments are exemplary only for explaining the present invention and not to be construed as limiting the present invention.

In the present invention, unless otherwise specified, the terms used are understood as follows:

(1) Renal biopsy: the term "kidney puncture" is generally used to refer to an operation in which a puncture needle penetrates the kidney at the back of a patient under the guidance of ultrasound, a part of kidney tissue is removed, and the pathological condition of the kidney tissue is observed under an optical microscope or an electron microscope. Because of the wide variety of kidney diseases and complex etiology and pathogenesis, the clinical manifestations of many kidney diseases are not completely consistent with the histological changes of the kidneys, and in order to clarify the etiology and pathology of the diseases, the specific disease types of patients are further diagnosed, and then kidney puncture biopsy is needed.

(2) MicroRNA (miRNA): is an endogenous non-coding RNA with regulatory function found in eukaryotes, and has a size of about 20-25 nucleotides. Mature miRNAs are produced from longer primary transcripts by a series of nuclease cleavage processes, then assembled into RNA-induced silencing complexes, recognizing target mRNA by base-complementary pairing, and directing the silencing complex to degrade the target mRNA or repress translation of the target mRNA depending on the degree of complementarity.

(3) SYBR Green fluorescent quantitative PCR: SYBR Green fluorescent quantitative PCR is a dye with Green excitation wavelength that binds to all double-stranded DNA (double-stranded DNA in human and most biological cells) double-stranded minor groove regions, and in the free state, SYBR Green I emits weak fluorescence, but once bound to double-stranded DNA, fluorescence is greatly enhanced. Therefore, the fluorescence signal intensity of SYBR Green I is related to the number of double-stranded DNA, and the initial concentration of double-stranded DNA in the sample to be measured can be calculated based on the fluorescence signal intensity measured by the quantitative PCR instrument, and the copy number of the target gene cannot be calculated, so that the method is a relatively quantitative method.

(4)2 ^-ΔΔct Relative quantification method: the method is a simple method for analyzing the relative change of gene expression in a real-time quantitative PCR experiment, and the method can calculate the relative expression quantity of a target gene through the expression quantity (CT value) of a housekeeping gene. Namely, the relative expression level of the target gene=2 ^{- (target gene CT value-housekeeping gene CT value)} 。

(5) Baseline (Baseline): it means that the fluorescence signal does not change much during the first few cycles of the PCR amplification reaction, approaching a straight line, which is the baseline.

(6) Ct value: is an important concept in the fluorescent quantitative PCR technology, C represents Cycle, t represents threshold, and the specific meaning is the number of cycles undergone by the fluorescent signal in each reaction tube when reaching a set threshold. The relation study of the CT value and the initial template shows that the CT value of each template has a linear relation with the logarithm of the initial copy number of the template, and the more the initial copy number is, the smaller the CT value is.

(7) Urinary sediment: refers to the substances precipitated after urine is centrifuged by a centrifuge, and most of the substances are kidney indigenous cells and urothelial cells.

(8) Housekeeping genes: also called reference genes, refers to highly conserved genes that are constantly expressed in all cells in an organism and are expressed at all times required to maintain basic vital activities of the cells. Housekeeping genes are not only expressed constantly in various tissues, but also expressed stably in various conditions (i.e., the expression level is relatively stable), and are generally not affected by the external environment and the addition of drugs, and therefore are often used as internal references in PCR.

(9) Sensitivity: meaning how much there is a chance that it will not leak diagnosis (false negative) at the time of diagnosing the disease, sensitivity = true positive/(true positive + false negative) ×100%.

(10) Specificity: this means how much there is a chance of not misdiagnosing (false positive) the index is when diagnosing a disease, and specificity=true negative/(true negative+false positive) ×100%.

(11) ROC curve: also known as a subject operating profile (receiver operator characteristic curve, ROC curve), which was originally used to evaluate radar performance, is a profile plotted on the ordinate with true positive rate (sensitivity) and false positive rate (specificity) on the abscissa, according to a range of different classification schemes (thresholds or decision thresholds). The medicine is mainly used for: selecting an optimal disease diagnosis model and discarding a suboptimal model; an optimal threshold is set in the same model.

(12) MiRNA chip: and fixing a miRNA detection substance (probe) on a chip, and combining the miRNA detection substance with miRNA in a sample in a hybridization mode to identify whether the miRNA is expressed or not and whether the miRNA is expressed or not. And the miRNA chip adopts a large-scale microarray technology, and one chip contains thousands of probes, so that the screening speed and quantity are greatly improved. Is the first choice method for rapidly and comprehensively comparing miRNA differences among samples.

(13) Parallel (parallel) experiments: that is, only one test among several tests is positive, and the test is diagnosed as positive. Its advantages are high sensitivity and low missing diagnosis rate; but at the same time the specificity is reduced and the misdiagnosis rate is increased.

An embodiment of the present invention provides for the establishment of a method for IgA nephropathy detection, as shown in FIG. 1, comprising the steps of:

s10, collecting urine of IgA nephropathy patients, non-IgA nephropathy patients and healthy persons.

In this step, three urine groups were collected from IgA nephropathy patients, non-IgA nephropathy patients, and healthy subjects, respectively. A renal patient with non-IgA nephropathy herein refers to a renal patient with kidney disease but not IgA kidney disease.

According to the embodiment of the invention, the kind and the collection time of urine are not particularly limited. For example, in accordance with an embodiment of the present invention, it is preferable to collect morning urine. Because the sample detected by the invention is urine, but not kidney tissue, the invention has no wound on the organism of a patient, and can be repeatedly or continuously reserved and tested according to the change of the disease condition. In addition, no obvious contraindication exists during detection, the device can be suitable for detection of all patients, and the required urine can not bring any damage and risk to the patients, so that the device is safe and reliable.

S20, detecting the expression quantity of miRNA in urine.

In this step, the expression level of miRNA in urine collected in S10 is detected.

The inventor of the invention discovers in the research that IgA nephropathy can cause the change of the expression quantity of miRNA in the pathogenesis process, so that the early noninvasive early warning of IgA nephropathy can be realized by detecting the expression quantity of miRNAs. The inventor compares the expression profile of miRNA in urine of IgA nephropathy and healthy people by using miRNA chip, and initially screens out more than 100 differential genes, and further screens out 3 IgA nephropathy specific miRNA: miRNA-25, miRNA-144, and miRNA-486, the inventors also found that when 3 mirnas are in the urine of the observed: miRNA-25, miRNA-144 and miRNA-486 are expressed in amounts exceeding a certain level, and therefore IgA nephropathy is caused.

Thus, it is preferred to detect 3 mirnas in urine: the expression amounts of miRNA-25, miRNA-144 and miRNA-486 can rapidly and accurately prompt the existence of IgA nephropathy, and help doctors to find IgA nephropathy patients in a safe and reliable early stage under the condition of no kidney biopsy. In addition, the disease condition of IgA nephropathy patients can be evaluated in a non-invasive way at any time, the medication of the patients is adjusted, symptomatic treatment is carried out, and the prognosis of the patients is improved, so that the national, social and family burdens are reduced.

According to an embodiment of the present invention, the methods for detecting the expression amounts of miRNA-25, miRNA-144 and miRNA-486 are not particularly limited, and are detected by a method selected from the group consisting of fluorescent quantitative PCR, taqman probe and LightCycle probe, for example.

According to the embodiment of the invention, the SYBR Green fluorescence quantitative PCR method is preferably selected, the method is simple and easy to operate, the result is reliable and accurate, a patient does not need to make special preparation, urine is left, all results can be given within 24 hours, and compared with the traditional kidney biopsy time of 5-7 days, the method is fast and convenient, and the clinical application is wider.

According to an embodiment of the invention, the primer of MiRNA-25 is preferably: CAUUGCACUUGUCUCGGUCUGA;

and/or, the primer of MiRNA-144 is: UACAGUAUAGAUGAUGUACU;

and/or, the primer of MiRNA-486 is: UCCUGUACUGAGCUGCCCCGAG.

S30, utilization 2 ^-ΔΔct Comparing the expression amount of the miRNA by a relative quantification method.

In this step, the expression amount of the miRNA detected in S20 was subjected to comparative analysis to determine whether the expression amount of the miRNA in IgA-type nephropathy patients is significantly different from that in the healthy person control group and the non-IgA-type nephropathy kidney disease patient control group.

The invention utilizes 2 ^-ΔΔct The relative expression amount of the target gene can be quantitatively analyzed by a relative quantitative method, which can calculate the relative expression amount of the target gene by the expression amount (CT value) of the housekeeping gene, specifically as follows:

thus, it was determined whether or not the expression amounts of miRNA-25, miRNA-144 and miRNA-486 in IgA nephropathy patients were significantly different from those in healthy person control groups and those in non-IgA nephropathy patients.

According to an embodiment of the present invention, preferably, primers further comprising U6-25 housekeeping genes are: AAAGCAGGCUUUAAAGGAACCU.

S40, performing ROC curve analysis on the expression quantity of the miRNA.

In this step, ROC curve analysis is performed on the expression amount of miRNA in S20 to determine a critical value of miRNA expression amount for early warning IgA nephropathy.

According to the embodiment of the invention, when the expression level of miRNA-25 is higher than 0.058 (critical value), the sensitivity of early warning IgA nephropathy is 81.3% and the specificity is 100%;

and/or, when the expression level of miRNA-144 is higher than 0.007 (critical value), the sensitivity of early warning IgA nephropathy is 80% and the specificity is 100%;

and/or, when the expression level of miRNA-486 is higher than 0.025 (critical value), the sensitivity of early warning IgA nephropathy is 93.8% and the specificity is 90.9%.

According to an embodiment of the present invention, preferably, when three mirnas: when three combined indexes of miRNA-25, miRNA-144 and miRNA-486 expression levels are detected together, igA nephropathy can be early warned when one of the three combined indexes is higher than the respective critical value, and the early warning sensitivity can be further improved to 89.9% by combining, and the early warning specificity is 100%.

It should be noted that the three mirnas of the present invention: the critical values of miRNA-25, miRNA-144 and miRNA-486 are deduced and proved by a large number of clinical observations and experiments with great effort by the inventor.

The ROC curve is used in the invention, because the ROC has the advantages of simple and visual method, accuracy of the detection method through graphic observation and analysis, accurate reflection of the relation between the sensitivity and the specificity of the detection method, no influence of the group morbidity on the evaluation method, and the like compared with other methods for judging the standard by observing indexes. The optimal threshold is the point closest to the upper left corner ROC curve, which is the best threshold with the least error, and the least total number of false positives and false negatives. The sensitivity and specificity corresponding to the optimal critical value are the sensitivity and specificity of the experimental method. In the three indexes of the invention, the specificity of miR-25 and miR-144 is very good, both are 100%, but the sensitivity is not high. The miR-486 has low specificity (90.9%) and better sensitivity (93.8%). The inventor creatively adopts a joint detection test, and when one index of the three indexes is increased, igA nephropathy can be early warned when the index is higher than a critical value, so that the sensitivity can be improved, and the missed diagnosis rate can be reduced. Through combined detection, the sensitivity of early warning is improved to 89.9%, the specificity of early warning is still 100%, namely the probability of no missed diagnosis is 89.9% and the misdiagnosis rate is 0% when the early warning detection shows that the patient is IgA nephropathy, and the patient can be accurately judged to be IgA nephropathy. Although the invention has 10.1% missed diagnosis opportunity, the detection method of the invention is simple and noninvasive to implement, can greatly expand the applicable crowd range, and can repeatedly detect for a plurality of times, thereby effectively compensating for the defect.

According to the establishment of the IgA nephropathy detection method according to the embodiment of the invention, at least one of the following positive technical effects can be achieved:

1. a method for IgA nephropathy detection can be effectively established.

Embodiments of the present invention also provide a method for IgA nephropathy detection, the method being established according to the method described above, comprising the steps of:

collecting urine;

Those skilled in the art will appreciate that the features and effects described above in relation to the establishment of a method for IgA nephropathy detection are of course also applicable to the method for IgA nephropathy detection and will not be described in detail here.

According to the embodiment of the invention, the method for detecting the miRNA expression level is not particularly limited, for example, according to the embodiment of the invention, the SYBR Green fluorescence quantitative PCR is preferably used as the detection method, the method is simple and easy to operate, the result is reliable and accurate, the patient does not need to make special preparation, urine is left, all the results can be given within 24 hours, and compared with the detection time of 5-7 days of the traditional kidney biopsy, the method is quite rapid and convenient and has wider clinical application.

Embodiments of the present invention also provide a system for IgA nephropathy detection detected using the method for IgA nephropathy detection described above, the system comprising:

a urine collection device to collect urine;

miRNA detection device to detect the expression level of miRNA in urine.

Those skilled in the art will appreciate that the features and effects described above with respect to the method for IgA nephropathy detection are of course also applicable to the system for IgA nephropathy detection and will not be described in detail here.

For further elaboration of the technical solutions of the present invention, reference is made to the accompanying figures 1 to 9, which are given below by way of specific examples for illustration purposes only and are not to be construed as limiting the invention in any way. In addition, in the following examples, the equipment and materials used are commercially available unless otherwise specified.

Example 1

1. The main materials are as follows:

1) miRcute miRNAcDNA first Strand Synthesis kit: model KR201, manufactured by tengen corporation, comprising: the primer of MiRNA-25 is: the primers of CAUUGCACUUGUCUCGGUCUGA, miRNA-144 are: the primers of UACAGUAUAGAUGAUGUACU, miRNA-486 are: UCCUGUACUGAGCUGCCCCGAG the primers of the U6-25 housekeeping gene are:

AAAGCAGGCUUUAAAGGAACCU。

2) TRIzol: (Carlsbad, C), manufactured by life technologies.

3) Primer:

the primer of MiRNA-25 is: CAUUGCACUUGUCUCGGUCUGA;

the primer of MiRNA-144 is: UACAGUAUAGAUGAUGUACU;

the primer of MiRNA-486 is: UCCUGUACUGAGCUGCCCCGAG; and

the primers for the U6-25 housekeeping gene are: AAAGCAGGCUUUAAAGGAACCU.

4) IgA nephropathy patient: igA nephropathy patients are pre-renal or post-renal for more than 1 week (without complications such as obvious bleeding).

2. The main equipment comprises:

1) PRISM 7500Real Time PCR System: applied Biosystems company.

2) SPSS software: SPSS 13.0.

3. The main operation steps are as follows:

1) Collection, storage and recording of urinary sediment:

three groups of 50-100 ml of morning sickness of a healthy person, 1-2 tubes of each group, were collected by a sterile centrifuge tube, and were stored in an ice box or at 4 ℃.

2) Sample treatment of urinary sediment and extraction of total RNA:

the morning urine is put into a centrifuge for centrifugation at 4 ℃ and 3000g for 30min, the urine supernatant after centrifugation is poured off, the urine sediment is added into 1ml PBS for uniform mixing, the mixture is added into a 1.5ml EP tube, and the EP tube is centrifuged at 4 ℃ and 13000g for 10min. The supernatant was removed again, and urinary sediment was retained.

3) Extracting total RNA in urinary sediment by TRIzol method:

adding 1ml TRIzol, mixing, incubating at 4deg.C for 5min, adding 200ul chloroform, shaking, mixing, incubating at 4deg.C for 5min, centrifuging at 12000rpm for 10min;

carefully taking out the EP tube, wherein the liquid in the tube is divided into 3 layers, the first layer is an upper clear liquid layer, namely an RNA layer, the middle layer is a white protein layer, the lowest layer is a red DNA layer, transferring the upper clear liquid layer into a new EP tube, recording the total transferred volume, adding equal volume of isopropanol, mixing the materials upside down, and incubating at 4 ℃ for 10min;

centrifuging at 12000rpm at 4deg.C for 15min, wherein a small amount of white precipitate is found at the bottom of the tube, which is total RNA, pouring out supernatant, and immediately adding 1ml 75% alcohol (prepared by RNase-free water);

centrifuging at 12000rpm for 5min at 4deg.C, pouring out supernatant, and adding 1ml of 75% alcohol again;

centrifuging at 4deg.C for 5min at 12000rpm, removing supernatant, centrifuging at 12000rpm for 1min at 4deg.C for a short time, sucking the rest supernatant with gun head, cleaning, opening EP tube cover, standing at room temperature for 15min, and air drying the rest alcohol;

adding 32ul of RNase-free water, and standing at 4deg.C for 30min to dissolve RNA completely in water; 2ul of RNA solution was taken and RNA concentration was measured at NANODROP 2000 c.

4) Sample cDNA synthesis:

the total RNA was reverse transcribed into double stranded cDNA using the miRcute miRNA cDNA first strand synthesis kit:

fixing the Total RNA mass of the sample to 500ng (Total system 500 ng), and calculating the volume of the added RNA solution (Total RNA) according to the measured concentration;

preparation of a new RNAm enzyme-Free 0.5ml EP tube, sequentially adding 2ul of 10 XPoly (A) Polymerase Buffer, 4ul of 5 XrATP Solution, 0.4ul E.coli Poly (A), calculated RNA Solution volume, adding RNase-Free ddH ₂ O makes the total volume up to 20ul;

after short centrifugation, reacting for 60min at 37 ℃ to obtain a Poly (A) reaction solution;

preparation of a New RNAm enzyme-Free 0.5ml EP tube, followed by addition of RNase-Free ddH ₂ O11.5 ul, poly (A) reaction solution 2ul,10 xRT Primer (10. Mu.M) 2ul,10 xRT Buffer 2ul,Super Pure dNTP (2.5 mM each) 1ul, and Rnase (40U/ul) 1ul,Quant Rtase 0.5ul, to obtain a double-stranded cDNA solution with a total volume of 20 ul.

5) Detecting the expression quantity of miRNA:

the detection of the expression level of the gene to be detected in the synthesized cDNA is based on SYBR Green fluorescence quantitative PCR technology.

The reaction system was configured as follows: 2X miRcute miRNAPremix 10ul, 50X ROX Reference Dye 1.6ul,Reverse Primer 0.4ul,ddH ₂ O5.6 ul, specific primer 0.4ul, cDNA solution generated in the previous step 2ul.

The reaction was carried out in PRISM 7500Real Time PCR System under the following reaction conditions: 1× (1 cycle) -94 ℃,2min (initial template denaturation); then 35-45× (35 to 45 cycles) -94 ℃,20sec (template denaturation in PCR cycles) and 60 ℃,34sec (annealing, extension). Each index for each sample was provided with 2 secondary wells (i.e., all conditions were unchanged, 2 replicates were performed). In the reaction, a housekeeping gene (U6) and a sample to be detected are amplified simultaneously, so that the expression level of a target gene in the sample is determined.

6)2 ^-ΔΔct Comparing the expression level of miRNA by a relative quantification method:

with SPSS software, use 2 ^-ΔΔct Comparing the expression levels of miRNA-25, miRNA-144 and miRNA-486 by relative quantification method, namely 2 ^{- [ (CT value of target gene of experimental group-CT value of housekeeping gene of experimental group) - (CT value of target gene of control group-CT value of housekeeping gene of control group)]} ，2 ^-ΔΔct The expression of the target gene of the experimental group is expressed as multiple of the target gene of the control group, and the specific operation is as follows:

the expression amounts of miRNA-25, miRNA-144 and miRNA-486 were compared between IgA nephropathy patients and healthy subject control groups, respectively, as shown in FIGS. 2 to 4.

The expression amounts of miRNA-25, miRNA-144 and miRNA-486 were compared between the IgA nephropathy patient and the non-IgA nephropathy patient control group, respectively, as shown in FIGS. 5 to 7.

From the above-described FIGS. 2 to 7, it is apparent that the relative expression amounts of miRNA-25, miRNA-144 and miRNA-486 in IgA nephropathy patients were significantly higher than those in the healthy person control group and those in the non-IgA nephropathy kidney disease patient control group, and the differences were significant. Therefore, igA nephropathy can be early warned by detecting the expression amounts of miRNA-25, miRNA-144 and miRNA-486 in urine.

FIG. 2 shows the expression level of miR-25 in healthy subject control group (group 1) (2) ^-ΔΔct Relative quantification method) is 0.0272152 +/-0.0145227, the expression level of miR-25 in the IgA nephropathy group (group 2) is 0.239375 +/-0.3035597, the expression level of miR-25 in the IgA nephropathy group is obviously higher than that in the healthy person control group, and p is less than 0.001.

FIG. 3 shows that the expression level of miR-144 in the healthy subject control group (group 1) is 0.002196 + -0.002328, the expression level of miR-144 in the IgA nephropathy group (group 2) is 0.124129 + -0.246618, and the expression level of miR-144 in the IgA nephropathy group is significantly higher than that in the healthy subject control group, and p is less than 0.001.

FIG. 4 shows that the expression level of miR-486 in the healthy subject control group (group 1) is 0.012846 + -0.011028, the expression level of miR-486 in the IgA nephropathy group (group 2) is 0.272673 + -0.527395, and the expression level of miR-486 in the IgA nephropathy group is significantly higher than that in the healthy subject control group, and p is less than 0.001.

In FIG. 5, the expression level of miR-25 in the IgA nephropathy group (group 1) is 0.239375 + -0.3035597, whereas the expression level of miR-25 in the IgA nephropathy group (group 2) is 0.064979 + -0.051222, which is significantly higher than that in the IgA nephropathy group (group 2), and p < 0.001.

Fig. 6 shows that the expression level of miR-144 in IgA nephropathy group (group 1) was 0.124129 ± 0.246618, whereas that in non-IgA nephropathy group (group 2) was 0.029361 ±0.062052, and that in IgA nephropathy group miR-144 was significantly higher than that in non-IgA nephropathy group, p=0.003.

FIG. 7 shows that the expression level of miR-486 in IgA nephropathy group (group 1) is 0.272673 + -0.527395, whereas that in non-IgA nephropathy patient control group (group 2) is 0.050362 + -0.058641, and that in IgA nephropathy group miR-486 is significantly higher than in non-IgA nephropathy patient control group, p < 0.001.

As shown in fig. 2-7, the expression levels of three indexes of the IgA nephropathy group miR-25, miR-144 and miR-486 are obviously higher than that of a healthy person control group and a non-IgA nephropathy patient control group, and the elevation of the three indexes is strongly correlated with IgA nephropathy early warning and can be used as an IgA nephropathy specific early warning index.

7) ROC curve analysis of miRNA expression:

and (3) using SPSS software to jointly perform three indexes of miRNA-25, miRNA-144 and miRNA-486 into ROC curve analysis of the early warning value of IgA nephropathy, wherein the results are shown in FIG. 8 and the following table 1.

TABLE 1 ROC Curve analysis statistics of miRNA expression level

As can be seen from fig. 8 and table 1:

when the expression level of miRNA-25 is higher than 0.058 (critical value), the sensitivity of early warning IgA nephropathy is 81.3% and the specificity is 100%;

The accuracy of the early warning can be evaluated by the AUC (area under the curve), namely, the greater the AUC is, the higher the accuracy of the early warning is. The area value under the ROC curve is between 1.0 and 0.5, and the accuracy is good when the area value is above 0.9. The area values under the ROC curve of the invention are all above 0.9, which shows that the invention has good accuracy and high reliability.

95% CI means the 95% confidence interval for AUC, i.e., the likelihood that AUC falls within this range is 95%, indicating that the accuracy of the invention is very reliable.

The P value is the probability for judging an error, and is generally considered to be less than 0.05, namely a small probability event, which is almost impossible to occur in one test, and the judgment can be considered to be correct. The P values of the invention are all less than 0.0001, namely the invention pre-warns the patient of IgA nephropathy, and the probability that the patient is not (mistakes) IgA nephropathy is less than 0.01% in practice, which is almost impossible, thus the judgment accuracy of the invention is very high.

The invention also provides three miRNAs: the ROC curve analysis was performed on the combined index of the expression amounts of miRNA-25, miRNA-144 and miRNA-486, and the results are shown in FIG. 9 and Table 2 below.

TABLE 2 ROC Curve analysis statistics of joint index of miRNA expression level

As can be seen from fig. 9 and table 2:

when three mirnas: when three combined indexes of miRNA-25, miRNA-144 and miRNA-486 expression levels are detected together, igA nephropathy can be early warned when one of the three combined indexes is higher than the respective critical value, and the early warning sensitivity can be further improved to 89.9% by combining, and the early warning specificity is 100%. Therefore, the invention can provide a very accurate detection method for early warning IgA nephropathy.

As can be seen from fig. 2-4, when urinary sediment miRNA is detected by fluorescent quantitative PCR, the expression levels of miRNA-25, miRNA-144 and miRNA-486 of IgA nephropathy patients are significantly higher than those of healthy person control group, p < 0.001, and the difference has significant statistical significance.

From FIGS. 5 to 7, it is understood that, when urinary sediment miRNA is detected by fluorescent quantitative PCR, the expression levels of miRNA-25, miRNA-144 and miRNA-486 of IgA nephropathy patients are significantly higher than those of non-IgA nephropathy patients (membranous nephropathy, mesangial proliferative nephritis, minuscule nephropathy, focal segmental glomerulosclerosis and mesangial proliferative glomerulonephritis), p < 0.001, and the difference is significant in statistical significance.

Figures 2-7 show that the expression levels of IgA kidney disease groups miRNA-25, miRNA-144 and miRNA-486 in urinary sediment are not only significantly higher than in healthy controls, but also significantly higher than in non-IgA kidney disease patient controls, and are IgA kidney disease specific miRNAs.

In order to find the critical values (or thresholds) of the three index early warning IgA nephropathy and the corresponding sensitivity and specificity, the expression amounts of the three miRNAs are brought into ROC curve analysis, and thus, the FIG. 8 and the Table 1 can be obtained. As can be seen from FIG. 8 and Table 1, the three indexes have better sensitivity and specificity when each index singly warns IgA nephropathy, wherein the sensitivity of miRNA-25 is 81.3%, and the specificity is 100%; the sensitivity of miRNA-144 is 80 percent and the specificity is 100 percent; the sensitivity of miRNA-486 was 93.8% and the specificity was 90.9%. And the early warning accuracy is higher (AUC > 0.9).

Since miRNA-25 and miRNA-144 are found to have very good specificity (100%) and relatively poor sensitivity, in order to improve the sensitivity of the invention for early warning IgA nephropathy and the early warning efficiency, the invention performs parallel experiments (joint detection), namely when one of the three indexes is higher than the respective critical value, the IgA nephropathy can be early warned. From fig. 9 and table 2, it can be seen that the sensitivity of the early warning can be further improved to 89.9% by jointly detecting the three indexes, and the specificity of the early warning is still 100%. Therefore, the invention can provide a very accurate detection method for early warning IgA nephropathy.

Example 2

To further examine the practicability and accuracy of the present invention, the inventors randomly extracted 10 persons of renal patients newly admitted to the hospital without performing renal biopsy (to be done soon), and 10 persons of healthy persons with gender and age matching, randomly numbered, detected with reference to the technical scheme of example 1, and early warned 6 persons of IgA renal patients. After one week, the results of the kidney tissue biopsy are 6 IgA nephropathy patients, which are completely consistent with the early warning results of the invention, and the difference of the expression level of the miRNAs of other 4 non-IgA nephropathy patients (membranous nephropathy 2, micro-lesion nephropathy 1 and focal segmental glomerulosclerosis 1) and 10 healthy people has no obvious statistical significance. Therefore, the invention is further proved to have strong practicability and high accuracy.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

The application of a primer of miRNA in the preparation of a kit for detecting IgA nephropathy,

the primer of miRNA is used for detecting the expression quantity of miRNA in urine of IgA nephropathy patients, non-IgA nephropathy patients and healthy people, and the miRNA is as follows: miRNA-144 and miRNA-486.
2. The use according to claim 1, wherein the detection of the expression levels of miRNA-144 and miRNA-486 is performed by at least one method selected from the group consisting of fluorescent quantitative PCR, taqman probes and LightCycle probes.
3. The use according to claim 2, wherein the fluorescent quantitative PCR is SYBR Green fluorescent quantitative PCR.
4. The use according to claim 3, characterized in that,

the miRNA-144 is as follows: UACAGUAUAGAUGAUGUACU; and

the miRNA-486 is as follows: UCCUGUACUGAGCUGCCCCGAG.
5. The use according to claim 4, wherein the kit further comprises primers for housekeeping genes: AAAGCAGGCUUUAAAGGAACCU.
6. The use according to claim 5, characterized in that,

the critical value of the miRNA-144 is 0.007; and

the threshold for miRNA-486 was 0.025.