CN102892897A - Compositions and methods for microrna expression profiling of lung cancer - Google Patents

Compositions and methods for microrna expression profiling of lung cancer Download PDF

Info

Publication number
CN102892897A
CN102892897A CN2010800647971A CN201080064797A CN102892897A CN 102892897 A CN102892897 A CN 102892897A CN 2010800647971 A CN2010800647971 A CN 2010800647971A CN 201080064797 A CN201080064797 A CN 201080064797A CN 102892897 A CN102892897 A CN 102892897A
Authority
CN
China
Prior art keywords
mir
hsa
expression
nucleic acid
lung cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2010800647971A
Other languages
Chinese (zh)
Other versions
CN102892897B (en
Inventor
李健
吴莹
卢韶华
朱虹光
黄威
任一萍
李兆勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHANGHAI LABWAY CLINICAL LABORATORY Co.,Ltd.
Original Assignee
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University filed Critical Fudan University
Priority to CN201080064797.1A priority Critical patent/CN102892897B/en
Priority claimed from PCT/CN2010/080237 external-priority patent/WO2011076143A1/en
Publication of CN102892897A publication Critical patent/CN102892897A/en
Application granted granted Critical
Publication of CN102892897B publication Critical patent/CN102892897B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides diagnostic kits comprising a plurality of nucleic acid molecules encoding microRNA sequences for identifying one or more mammalian target cells exhibiting or having a predisposition to develop lung cancer. The nucleic acid molecules encoding microRNA sequences are differentially expressed in target cells and in control cells. The invention further provides methods for identifying mammalian target cells exhibiting or having a predisposition to develop lung cancer using said microRNAs, and methods and pharmaceutical compositions for preventing or treating lung cancer.

Description

The composition and the method that are used for the micro-RNA expression spectrum analysis of lung cancer
Invention field
The present invention relates to composition and method, particularly gland cancer lung cancer (adenocarcinoma lung cancer), prognosis of squamous cell lung cancer (squamous cell lung cancer) and small cell lung cancer (small cell lung cancer) for microRNA (microRNA) expression pattern analysis of lung cancer (lung cancer).
Background of invention
Lung cancer remains one of modal reason that causes the cancer associated death in the world wide.1,400,000 routine new cases were arranged in 2009 according to estimation, the average year rate of growth is 2.51% (Frost﹠amp; Sullivan estimates), and most patient who was diagnosed as lung cancer in 2009 will die from lung cancer (Higgins, M.J.et al. (2009) Expert Rev Anticancer Ther 9,1365-1378).Although modus operandi and associated treatment means have obtained certain progress in recent decades, the America and Europe, the overall five year survival rate of each phase patient only about 15%.
Lung cancer is divided into small cell lung cancer (small cell lung cancer (SCLC)) and nonsmall-cell lung cancer (non-small cell lung cancer (NSCLC)).Nonsmall-cell lung cancer is main histological type, accounts for more than 80%, comprises gland cancer and squamous cell carcinoma.Smoking is the most important risk factor of lung cancer, accounts for the about 80% of global male sex's case, 50% of women's case.
Therapeutic modality for the lung cancer different subtype is also different.Operation is the therapeutic modality of early stage NSCLC, and total five year survival rate is 40%.But be in middle and advanced stage when most of patient makes a definite diagnosis, this part patient's first-line treatment has been confined to the multiple medicines chemotherapy, estimated that survival time also only is below 8 months.Recently the development of targeted therapy requires NSCLC is carried out more accurate Subtypes.Angiogenesis inhibitor in the squamous cell carcinoma patient, very easily cause side reaction (Lebanoy, D. (2009) J Clin Oncol 27,2030-2037).Small cell lung cancer is the highest Lung Cancer Types of mortality ratio, and mortality ratio is up to more than 90%.Although often can be observed high initial reaction rate, Limited-stage patient's the median survival time rate is about 20 months.The treatment of small cell lung cancer is generally chemotherapy or chemicotherapy combination, and does not select operative treatment.
Each is unusual except the treatment means taked for the patients with lung cancer of different subtype different pathogeny, and the deviation on judging between the viewer and the shortage of specific criteria test have limited and current the patient is classified accurately and selects suitable treatment.Following treatment to single patients with lung cancer is selected to depend on concrete tumour and host characteristics.Therefore seeking special molecular marked compound, to distinguish different lung cancer hypotypes very necessary.
Many diagnostic tests are owing to only based on single molecular marked compound, affected result's reliability and accuracy.In addition, single labelled thing often can not specifically predict latent period, tumour progression phase etc.Therefore, be necessary that still molecular marked compound and the test method of seeking other overcome these limitations.
A kind of solution to this problem can be based on minor adjustment RNA molecule, microRNA (miRNA) particularly, they are little non-coding RNAs of the endogenous expression of a class evolution conservative, and size is 20-25 Nucleotide (nt), can mediate the expression of said target mrna.Since they before about 10 years, be found just to be considered to that critical function is arranged in cell development, differentiation, proliferation and apoptosis (Bartel, D.P. (2004) Cell 116,281-297, Ambros, V. (2004) Nature 431,350-355; He, L.et al. (2004) Nat Rev Genet 5,522-531).In addition, as tumor marker, miRNA is better than mRNA, because of its external more stable, in vivo the transformation period longer (Lu, J.et al., (2005) Nature435,834-838; Lim, L.P.et al., (2005) Nature 433,769-773).
MiRNA is from the primary transcription deposits yields, and primary transcript is processed as stem-ring structure precursor (pre-miRNA) by RNase III Drosha.After transporte to cells matter, another kind is called the ring of the RNase III cutting pre-miRNA hair clip of Dicer and lacks double-stranded (ds) RNA to form, and wherein a chain mixes in the miRNA-protein (miRNP) as ripe miRNA.MiRNA instructs miRNP to arrive their said target mrna, and they bring into play function (Bartel, D.P. (2004) Cell 23,281-292 at this; He, L.and Hannon, G.J. (2004) Nat.Rev.Genet.5,522-531).
According to the complementary degree between miRNA and its target, miRNA can instruct different regulate processes.With the highly complementary said target mrna of miRNA by disturbing (RNAi) identical mechanism by special cutting with RNA.Therefore, in this case, the function of miRNA is as short interfering rna (siRNA).Guided with the lower said target mrna of miRNA complementarity and to enter cell degradation approach or being translated property and check and do not affect the mRNA level.But the mechanism of translation how miRNA checks their said target mrna still has arguement.
High-throughout miRNA quantitative technique is such as the miRNA microarray, measure based on the TaqMan miRNA of real-time RT-PCR, for the total miRNA express spectra in the full genome of research tumour provides strong instrument.Obtainable available data shows that the dysregulation (dysregulation) that miRNA expresses may be relevant with generation and/or the development of some types of cancer.For example, shown two kinds of miRNA, miR-15 and miR-16-1 are positioned on the genetic loci of disappearance in the chronic lymphatic leukemia (CLL), and find that two kinds of miRNA genes are lacked or reduce in about 70% CLL patient.In addition, in the colorectum tumorigenesis, observe the downward modulation of miR-143 and miR-145, and the expression of miRNA let-7 often reduces (Michael, M.Z.et al. (2003) Mol.Cancer Res.1,882-891 in lung cancer; Mayr, C.et al. (2007) Science 315,1576-1579).In fact, cancer in expressing based on miRNA is relevant change and miRNA be usually located at the observation supposition miRNA of the genome area that participates in cancer may be both as cancer suppressor gene also as oncogene (Esquela-Kerscher, A.and Slack, F.J (2006) Nat.Rev.Cancer 6,259-269; Calin, G.A.and Croce, C.M. (2007) J.Clin.Invest.117,2059-2066; Blenkiron, C.and Miska, E.A. (2007) Hum.Mol.Genet.16, R106-R113).The discovery of miRNA unconventionality expression spectrum in human cancer points out it to be expected to become effective diagnosis and prognosis marker.
The miRNA expression pattern analysis in the Human Lung Cancer (Johnson, S.M.et al. (2005) Cell 120,635-647 have been reported in some researchs; Liang, Y.et al. (2008) BMC Med Genomics 1,61; Kumar, M.S.et al. (2008) Proc Natl Acad Sci USA 105,3903-3908; Miko, E.et al. (2009) Exp Lung Res 35,646-664; Xie, Y et al. (2009) Lung CancerMay 13; Lebanony, D.et al. (2009) J Clin Oncol 27,2030-2037; Kauppinen, S.et al. (2009) Clin Cancer Res 15,1177-1183; Mascaux, C.et al. (2009) Eur Respir J33,352-359).Similarly, these researchs all show with non-malignant lung tissue to be compared, and specificity miRNA is unconventionality expression in malignant tissue.Some miRNA relevant (Yu, S.L.et al. (2008) Cancer Cell 13,48-57 with prognosis are also found in research; Raponi, M.et al (2009) Cancer Res 69,5776-5783).Therefore, this miRNA can provide the understanding about the cell processes that relates to vicious transformation and progress.
Therefore, still need (one group) diagnostic marker, particularly the cell that dissimilar lung cancer are inclined to occurs so that can identify fast, reliably and cheaply and/or treat demonstration or have in " expression characteristic (expression signature) " or " molecule footprint (molecular footprint) " form.In addition, need also to continue corresponding method to identify and to treat the target cell of showing this cancer phenotype.
Goal of the invention and summary of the invention
The purpose of this invention is to provide by determining that the multiple nucleic acids molecule diagnoses and/or treat lung cancer and/or the novel method of the tendency of this illness occurs, every kind of described nucleic acid molecule encoding microRNA (miRNA) sequence, wherein compare with the normal healthy controls cell, one or more of described multiple nucleic acids molecule be differential expression in the target cell of analyzing, and the nucleic acid molecule of wherein said one or more differential expression represents the expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has lung cancer or have the lung cancer occurence tendency.
More specifically, the purpose of this invention is to provide expression of nucleic acid feature and/or composition, for the identification of showing or having one or more Mammals target cell that the lung cancer tendency occurs and/or distinguish dissimilar lung cancer.Dissimilar squamous cell carcinoma, gland cancer lung cancer and the small cell lung cancers of comprising of lung cancer.
In addition, the purpose of this invention is to provide corresponding method, with for the identification of showing or having the dissimilar lung cancer of one or more Mammals target cell, difference that the lung cancer tendency occurs and be used for prevention or treat this illness.
These and other purpose will become clear from following description, and they are realized by the theme of independent claim.Certain preferred embodiments of the present invention is limited by the theme of dependent claims.
In first aspect, the present invention relates to for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell of developing the lung cancer tendency, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule be differential expression in target cell and in one or more control cells, and the nucleic acid molecule of wherein said one or more differential expression represents the expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has lung cancer or have development lung cancer tendency.
The expression of nucleic acid feature that this paper limits can comprise at least 82 kinds of nucleic acid molecule, preferably at least 13 kinds of nucleic acid molecule, particularly preferably at least 7 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In preferred embodiments, described expression of nucleic acid feature comprises coding hsa-miR-183, hsa-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, has-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-218, hsa-miR-139-5p, has-miR-130b, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR-187 *, hsa-miR-30b, hsa-miR-93, hsa-miR-145 *, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-625, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-98, hsa-miR-1, hsa-miR-106b, hsa-miR-150 *, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b *, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, has-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-100, hsa-miR-223, has-miR-196b, hsa-miR-196a, hsa-miR-1226 *, hsa-miR-424, hsa-miR-21 *, hsa-miR-572, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *Hsa-miR-301b, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-224, has-miR-125a-3p, hsa-miR-9, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, has-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150, has-miR-205, hsa-miR-192, the nucleic acid molecule of hsa-miR-215 and hsa-miR-106a.
Particularly preferably, compare with described one or more control cells, has-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR-425, hsa-miR-182, has-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR-98, hsa-miR-106b, has-miR-25, hsa-miR-200b encode in described one or more target cell *, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-196b, hsa-miR-196a, hsa-miR-424, hsa-miR-21 *, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *, hsa-miR-301b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205, has-miR-192, hsa-miR-215, hsa-miR-106a the expression of any one or multiple nucleic acids molecule raised and coding hsa-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-218, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, has-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-1226 *, hsa-miR-572, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, has-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p, hsa-miR-195, hsa-miR-142-5p and hsa-miR-150 the down-regulated expression of arbitrary or multiple nucleic acids molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-183, hsa-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, has-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p and hsa-miR-218 nucleic acid molecule.
Particularly preferably, compare with described one or more control cells, the expression of any one or multiple nucleic acids molecule of hsa-miR-183, hsa-miR-96 and hsa-miR-200c of encoding in described one or more target cell is raised, and coding hsa-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR-338-3p and hsa-miR-218 the down-regulated expression of arbitrary or multiple nucleic acids molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-183, hsa-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145 and hsa-miR-140-3p any one or more nucleic acid molecule.
Particularly preferably, compare the up-regulated of hsa-miR-183 in described one or more target cell, and encode hsa-miR-451, hsa-miR-126, hsa-miR-126 with described one or more control cells *, hsa-miR-30a, hsa-miR-145 and hsa-miR-140-3p the down-regulated expression of any one or more nucleic acid molecule.
In second aspect, the present invention relates to for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell of developing the nonsmall-cell lung cancer tendency, described nonsmall-cell lung cancer comprises squamous cell carcinoma and gland cancer lung cancer.Described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, this expression of nucleic acid feature is the indication that has nonsmall-cell lung cancer or the nonsmall-cell lung cancer occurence tendency is arranged, and comprises squamous cell carcinoma and gland cancer lung cancer.
The expression of nucleic acid feature that this paper limits can comprise at least 70 kinds of nucleic acid molecule, preferably at least 14 kinds of nucleic acid molecule, particularly preferably at least 9 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In preferred embodiments, described expression of nucleic acid feature comprises coding hsa-miR-183, hsa-miR-451, has-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, has-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-139-5p, hsa-miR-5 338-3p, hsa-miR-130b, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, has-miR-182, hsa-miR-187 *, hsa-miR-30b, hsa-miR-93, hsa-miR-145 *, hsa-miR-429, has-miR-498, hsa-miR-200a, hsa-miR-625, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-98, hsa-miR-1, hsa-miR-150 *, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, has-miR-200b *, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-135b, has-miR-100, hsa-miR-424, hsa-miR-21 *, hsa-miR-30a *Hsa-miR-494, hsa-miR-193b, has-miR-99a, hsa-miR-335, hsa-miR-106b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, hsa-miR-29c, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150, hsa-miR-205, any one or more nucleic acid molecule of hsa-miR-192 and hsa-miR-215.
Particularly preferably, compare with described one or more control cells, hsa-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR-98, hsa-miR-25, hsa-miR-200b encode in described one or more target cell *, hsa-miR-135b, hsa-miR-424, hsa-miR-21 *, hsa-miR-494, hsa-miR-193b, hsa-miR-106b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa-miR-192, hsa-miR-215 arbitrary or multiple nucleic acids developed by molecule raise and coding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, has-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p and hsa-miR-139-5p, hsa-miR-338-3p, hsa-miR-144 *, hsa-miR-133b, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-30a *, hsa-miR-99a, hsa-miR-335, has-miR-140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 the down-regulated expression of arbitrary or multiple nucleic acids molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-183, hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p and has-miR-139-5p any one or more nucleic acid molecule.
Particularly preferably, compare with described one or more control cells, in described one or more target cell, encode any one or more nucleic acid molecule up-regulated of hsa-miR-183, hsa-miR-96, hsa-miR-200c, and coding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p and hsa-miR-139-5p the down-regulated expression of any one or more nucleic acid molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-183, hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p any one or more nucleic acid molecule.
Particularly preferably, compare the up-regulated of hsa-miR-183 in described one or more target cell, and encode hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 with described one or more control cells *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p the down-regulated expression of any one or more nucleic acid molecule.
In the third aspect, the present invention relates to for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell of developing gland cancer lung cancer tendency, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has gland cancer lung cancer or gland cancer lung cancer development tendency is arranged.
The expression of nucleic acid feature that this paper limits can comprise at least 57 kinds of nucleic acid molecule, preferably at least 13 kinds of nucleic acid molecule, particularly preferably at least 5 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In preferred embodiments, described expression of nucleic acid feature comprises coding hsa-miR-96, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-21, hsa-miR-183, hsa-miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-130b, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR-187 *, hsa-miR-30b, has-miR-145 *, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-134, hsa-miR-638, hsa-miR-200b *, hsa-miR-1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-424, hsa-miR-21 *, hsa-miR-99a, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a *, hsa-miR-375, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-224, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-141 and hsa-miR-192 any one or more nucleic acid molecule.
Particularly preferably, compare with described one or more control cells, hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625, hsa-miR-130b, hsa-miR-425, hsa-miR-182, has-miR-429, hsa-miR-200a, hsa-miR-200b encode in described one or more target cell *, hsa-miR-424, hsa-miR-21 *, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a *, hsa-miR-375, hsa-miR-224, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-141, hsa-miR-192 any one or more nucleic acid molecule up-regulated, and coding hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, has-miR-134, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-99a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-195 the down-regulated expression of any one or more nucleic acid molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-96, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-21, hsa-miR-183, hsa-miR-144, has-miR-451, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a and hsa-miR-625 any one or more nucleic acid molecule.
Particularly preferably, compare with described one or more control cells, in described one or more target cell, encode on the arbitrary or multiple nucleic acids developed by molecule of hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625, and coding hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451 the down-regulated expression of any one or more nucleic acid molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-96, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218 any one or more nucleic acid molecule.
Particularly preferably, compare the up-regulated of hsa-miR-96 in described one or more target cell, and coding hsa-miR-126, hsa-miR-126 with described one or more control cells *, hsa-miR-30a, hsa-miR-218 the down-regulated expression of any one or more nucleic acid molecule.
In fourth aspect, the present invention relates to for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell of developing the prognosis of squamous cell lung cancer tendency, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has prognosis of squamous cell lung cancer or the prognosis of squamous cell lung cancer development tendency is arranged.
The expression of nucleic acid feature that this paper limits can comprise at least 112 kinds of nucleic acid molecule, preferably at least 16 kinds of nucleic acid molecule, particularly preferably at least 9 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In preferred embodiments, described expression of nucleic acid feature comprises coding hsa-miR-144, hsa-miR-451, has-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-93, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-143, hsa-miR-103, hsa-miR-183, hsa-miR-96, hsa-miR-139-5p, hsa-miR-130b, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, hsa-miR-182, hsa-miR-187 *, hsa-miR-145 *, hsa-miR-429, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-98, hsa-miR-1, hsa-miR-106b, hsa-miR-150 *, hsa-miR-25, hsa-miR-134, has-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, hsa-miR-1226 *, hsa-miR-424, hsa-miR-21 *, hsa-miR-572, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *, hsa-miR-301b, has-miR-29c *Hsa-miR-494, hsa-miR-193b, hsa-miR-375, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-151-3p, hsa-miR-149, hsa-miR-768-5p, hsa-miR-181a, hsa-miR-20a, has-miR-181c, hsa-miR-29a, hsa-miR-29b, hsa-miR-505, hsa-miR-939, hsa-miR-769-5p, hsa-miR-30c, hsa-miR-590-5p, hsa-miR-590-5p, hsa-miR-671-5p, hsa-miR-625, has-miR-652, hsa-miR-139-3p, hsa-miR-28-5p, hsa-miR-623, hsa-miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-335, hsa-miR-125a-5p, hsa-miR-551b, hsa-let-7d *, hsa-miR-31 *, hsa-miR-362-5p, hsa-miR-181a *, hsa-miR-940, hsa-miR-30b *, hsa-miR-601, has-miR-20b, hsa-miR-202, hsa-miR-101, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, has-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150 and hsa-miR-205 any one or more nucleic acid molecule.
Particularly preferably, compare with described one or more control cells, hsa-miR-200c, hsa-miR-93, hsa-miR-103, hsa-miR-183, hsa-miR-96, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-98, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, has-miR-424, hsa-miR-21 encode in described one or more target cell *, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *, hsa-miR-301b, has-miR-494, hsa-miR-193b, hsa-miR-151-3p, hsa-miR-149, hsa-miR-20a, hsa-miR-505, hsa-miR-769-5p, hsa-miR-590-5p, hsa-miR-590-5p, hsa-miR-625, hsa-miR-28-5p, has-miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-31 *, hsa-miR-362-5p, hsa-miR-20b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, has-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205 arbitrary or multiple nucleic acids developed by molecule raise and coding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-5miR-497, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-143, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, hsa-miR-187 *, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, has-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-1226 *, hsa-miR-572, hsa-miR-29c *, hsa-miR-375, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-181a, hsa-miR-181c, hsa-miR-29a, hsa-miR-29b, hsa-miR-939, hsa-miR-30c, hsa-miR-671-5p, hsa-miR-652, hsa-miR-139-3p, has-miR-623, hsa-miR-335, hsa-miR-125a-5p, hsa-miR-551b, hsa-let-7d *, hsa-miR-181a *, hsa-miR-940, hsa-miR-30b *, hsa-miR-601, hsa-miR-202, hsa-miR-101, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 the down-regulated expression of any one or more nucleic acid molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, has-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-93, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-143 and hsa-miR-103 any one or more nucleic acid molecule.
Particularly preferably, compare with described one or more control cells, in described one or more target cell, encode any one or more nucleic acid molecule up-regulated of hsa-miR-200c, hsa-miR-93, hsa-miR-103, and coding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, has-miR-143 the down-regulated expression of any one or more nucleic acid molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises any one or more nucleic acid molecule of coding hsa-miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, has-miR-145 and hsa-miR-140-3p.
Particularly preferably, compare with described one or more control cells, the up-regulated of hsa-miR-200c in described one or more target cell, and the down-regulated expression of any one or more nucleic acid molecule of coding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p.
Aspect the 5th, the present invention relates to for the identification of the diagnostic kit that represents or have the molecule marker of one or more Mammals target cell of developing the small cell lung cancer tendency, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has small cell lung cancer or the small cell lung cancer development tendency is arranged.
The expression of nucleic acid feature that this paper limits can comprise at least 116 kinds of nucleic acid molecule, preferably at least 16 kinds of nucleic acid molecule, particularly preferably at least 11 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In preferred embodiments, described expression of nucleic acid feature comprises coding hsa-miR-96, hsa-miR-144, has-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa-miR-375, has-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-451, hsa-miR-130b, hsa-miR-454, has-miR-30a, hsa-miR-17, hsa-miR-183, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-98, hsa-miR-1, hsa-miR-150 *, has-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b *, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-152, hsa-miR-301a, hsa-miR-100, hsa-miR-223, has-miR-196b, hsa-miR-1226 *, hsa-miR-572, hsa-miR-18b, hsa-miR-9 *, hsa-miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a *, hsa-miR-26a, hsa-miR-574-3p, has-miR-768-5p, hsa-miR-29a, hsa-miR-29b, hsa-miR-505, hsa-miR-939, hsa-miR-769-5p, hsa-miR-625, hsa-miR-139-3p, hsa-miR-19a, hsa-miR-551b, hsa-miR-362-5p, has-miR-181a *, hsa-miR-940, hsa-miR-601, hsa-miR-20b, hsa-miR-23a, hsa-miR-27a, has-miR-199a-5p, hsa-let-7i, hsa-miR-19b, hsa-miR-20a *, hsa-miR-17 *, hsa-miR-22, has-miR-340 *, hsa-miR-214, hsa-miR-592, hsa-miR-335 *, hsa-miR-29c *, hsa-miR-421, hsa-miR-886-3p, hsa-miR-16-2 *, hsa-miR-135a, hsa-miR-183 *, hsa-miR-7-1 *, has-miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR-95, hsa-miR-564, hsa-miR-636, has-miR-34b *, hsa-miR-18a, hsa-miR-126, hsa-miR-126 *, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p, has-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-128 and hsa-miR-106a any one or more nucleic acid molecule.
Particularly preferably, compare with described one or more control cells, hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR-454, hsa-miR-17, hsa-miR-183, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-200a, hsa-miR-98, hsa-miR-200b encode in described one or more target cell *, hsa-miR-301a, hsa-miR-196b, hsa-miR-505, hsa-miR-769-5p, hsa-miR-625, hsa-miR-19a, hsa-miR-362-5p, hsa-miR-20b, hsa-let-7i, has-miR-19b, hsa-miR-20a *, hsa-miR-17 *, hsa-miR-340 *, hsa-miR-592, hsa-miR-335 *, hsa-miR-421, hsa-miR-16-2 *, hsa-miR-135a, hsa-miR-183 *, hsa-miR-7-1 *, hsa-miR-95, hsa-miR-18a, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-128 and hsa-miR-106a arbitrary or multiple nucleic acids developed by molecule raise and coding hsa-miR-144, hsa-miR-145, hsa-miR-451, hsa-miR-30a, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, has-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-152, hsa-miR-100, hsa-miR-223, hsa-miR-1226 *, hsa-miR-572, hsa-miR-18b, hsa-miR-9 *, hsa-miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a *, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-29a, hsa-miR-29b, hsa-miR-939, hsa-miR-139-3p, hsa-miR-551b, hsa-miR-181a *, hsa-miR-940, hsa-miR-601, hsa-miR-23a, hsa-miR-27a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-214, hsa-miR-29c *, hsa-miR-886-3p, hsa-miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR-564, hsa-miR-636, hsa-miR-34b *, hsa-miR-126, hsa-5miR-126 *, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p the down-regulated expression of arbitrary or multiple nucleic acids molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises the arbitrary or multiple nucleic acids molecule of coding hsa-miR-96, hsa-miR-144, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-451, hsa-miR-130b, hsa-miR-454, hsa-miR-30a, hsa-miR-17.
Particularly preferably, compare with described one or more control cells, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR-454, hsa-miR-17 of encoding in described one or more target cell raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-144, hsa-miR-145, hsa-miR-451, hsa-miR-30a.
In a more preferred embodiment, described expression of nucleic acid feature comprises the arbitrary or multiple nucleic acids molecule of coding hsa-miR-96, hsa-miR-144, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa-miR-375, hsa-miR-103, hsa-miR-20a and hsa-miR-107.
Particularly preferably, compare with described one or more control cells, encode in described one or more target cell the arbitrary of hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a and hsa-miR-107 or multiple nucleic acids developed by molecule raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-144, hsa-miR-145.
Aspect the 6th, the present invention relates to the diagnostic kit for the molecule marker of difference nonsmall-cell lung cancer and small cell lung cancer, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has nonsmall-cell lung cancer or small cell lung cancer.
The expression of nucleic acid feature that this paper limits can comprise at least 17 kinds of nucleic acid molecule, preferably at least 8 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-375, hsa-miR-335, hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-592, hsa-miR-135a, hsa-miR-24, hsa-miR-454, hsa-miR-301a, hsa-miR-199b-5p, hsa-miR-9, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-335 *, hsa-miR-152 and hsa-miR-216b arbitrary or multiple nucleic acids molecule.
Particularly preferably, compare with described one or more control cells, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-135a, hsa-miR-199b-5p, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-152 of encoding in described one or more target cell raises, and coding hsa-miR-375, hsa-miR-335, hsa-miR-592, hsa-miR-24, hsa-miR-454, hsa-miR-301a, hsa-miR-9, has-miR-335 *, hsa-miR-216b the down-regulated expression of arbitrary or multiple nucleic acids molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises the arbitrary or multiple nucleic acids molecule of coding hsa-miR-375, hsa-miR-335, hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-592, hsa-miR-135a and hsa-miR-24.
Particularly preferably, compare with described one or more control cells, the arbitrary or multiple nucleic acids developed by molecule of encode in described one or more target cell hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-135a raises and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-375, hsa-miR-335, hsa-miR-592, hsa-miR-24.
Aspect the 7th, the present invention relates to for gland cancer lung cancer, the diagnostic kit of prognosis of squamous cell lung cancer or small cell lung cancer and other two kinds of molecule markers that differentiate, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is to have gland cancer lung cancer, the indication of prognosis of squamous cell lung cancer or small cell lung cancer.
The expression of nucleic acid feature that this paper limits can comprise at least 23 kinds of nucleic acid molecule, preferably at least 7 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-25, hsa-miR-205, hsa-miR-34a, hsa-miR-375, hsa-miR-29a, hsa-miR-27a, hsa-miR-29b, hsa-miR-93, hsa-miR-106b, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-145, hsa-miR-29c, hsa-miR-221, hsa-miR-335, hsa-miR-23a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-592, hsa-miR-95, arbitrary or the multiple nucleic acids molecule of hsa-miR-24 and hsa-miR-92a.
Particularly preferably, compare with small cell lung cancer with prognosis of squamous cell lung cancer, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-34a, hsa-miR-29a, hsa-miR-29b, hsa-miR-145, hsa-miR-29c of encoding in gland cancer lung cancer raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-25, hsa-miR-93, hsa-miR-301a, hsa-miR-106b, hsa-miR-15b, has-miR-92a.Encode in gland cancer lung cancer the arbitrary of hsa-miR-205, hsa-miR-27a, hsa-miR-221 or multiple nucleic acids molecule are compared up-regulated with small cell lung cancer, compare down-regulated expression with prognosis of squamous cell lung cancer.The nucleic acid molecule of coding hsa-miR-375 is compared up-regulated with prognosis of squamous cell lung cancer in gland cancer lung cancer, compares down-regulated expression with small cell lung cancer.Compare with small cell lung cancer, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-24, hsa-miR-23a, hsa-miR-22, hsa-miR-199a-5p of encoding in gland cancer lung cancer raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-592, hsa-miR-335, hsa-miR-95, hsa-miR-454.
In a more preferred embodiment, described expression of nucleic acid feature comprises the arbitrary or multiple nucleic acids molecule of coding hsa-miR-25, hsa-miR-205, hsa-miR-34a, hsa-miR-375, hsa-miR-29a, hsa-miR-27a, hsa-miR-29b.
Particularly preferably, compare with small cell lung cancer with prognosis of squamous cell lung cancer, encode in gland cancer lung cancer the arbitrary of hsa-miR-34a, hsa-miR-29a, hsa-miR-29b or multiple nucleic acids developed by molecule raises, and the nucleic acid molecule down-regulated expression of coding hsa-miR-25.Encode in gland cancer lung cancer the arbitrary of hsa-miR-205, hsa-miR-27a or multiple nucleic acids molecule are compared up-regulated with small cell lung cancer, compare down-regulated expression with prognosis of squamous cell lung cancer.The nucleic acid molecule of coding hsa-miR-375 is compared up-regulated with prognosis of squamous cell lung cancer in gland cancer lung cancer, compares down-regulated expression with small cell lung cancer.
In eight aspect, the present invention relates to the diagnostic kit for the molecule marker of difference gland cancer lung cancer and prognosis of squamous cell lung cancer, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has gland cancer lung cancer or prognosis of squamous cell lung cancer.
The expression of nucleic acid feature that this paper limits can comprise at least 14 kinds of nucleic acid molecule, preferably at least 8 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises the arbitrary or multiple nucleic acids molecule of coding hsa-miR-497, hsa-miR-93, hsa-miR-25, hsa-miR-29c, hsa-miR-205, hsa-miR-375, hsa-miR-149, hsa-miR-29a, hsa-miR-1, hsa-miR-15b, hsa-miR-181c, hsa-miR-29b, hsa-miR-769-5p and hsa-miR-221.
Particularly preferably, compare with described one or more control cells, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-497, hsa-miR-29c, hsa-miR-375, hsa-miR-29a, hsa-miR-1, hsa-miR-181c, hsa-miR-29b of encoding in described one or more target cell raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-93, hsa-miR-25, hsa-miR-205, hsa-miR-149, hsa-miR-15b, hsa-miR-769-5p, hsa-miR-221.
In a more preferred embodiment, described expression of nucleic acid feature comprises the arbitrary or multiple nucleic acids molecule of coding hsa-miR-497, hsa-miR-93, hsa-miR-25, hsa-miR-29c, hsa-miR-205, hsa-miR-375, hsa-miR-149 and hsa-miR-29a.
Particularly preferably, compare with described one or more control cells, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-497, hsa-miR-29c, hsa-miR-375, hsa-miR-29a of encoding in described one or more target cell raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-93, hsa-miR-25, hsa-miR-205, hsa-miR-149.
Aspect the 9th, the present invention relates to a kind of method that shows or have one or more target cell that the lung cancer tendency occurs of identifying, described method comprises: (a) determine the expression level of multiple nucleic acids molecule in one or more target cell, every kind of nucleic acid molecule encoding microrna sequences; (b) expression level of definite described multiple nucleic acids molecule in one or more normal healthy controls cell; Reach one or more nucleic acid molecule of (c) from described multiple nucleic acids molecule, identifying differential expression in target cell and control cells by the separately expression level that compares in step (a) and obtain (b), the nucleic acid molecule of wherein said one or more differential expression has represented the expression of nucleic acid feature that this paper limits together, and this expression of nucleic acid feature is the indication that has lung cancer or the lung cancer occurence tendency is arranged.
In preferred embodiment of the present invention, described method is further used for distinguishing gland cancer lung cancer, prognosis of squamous cell lung cancer and the small cell lung cancer in the lung cancer.
Aspect the tenth, the present invention relates to the method for a kind of prevention or treatment lung cancer, described method comprises: described method comprises: the method that (a) limits with this paper is identified the expression of nucleic acid feature in one or more target cell; The expression of one or more nucleic acid molecule of the coding microrna sequences that (b) change comprises in described expression of nucleic acid feature in described one or more cell, described change is carried out in such a way, be that its expression of expressing the nucleic acid molecule that is raised in described one or more target cell is reduced, and its expression of expressing the nucleic acid molecule of being reduced in described one or more target cell is raised.
The tenth on the one hand, the present invention relates to be used to the pharmaceutical composition that prevents and/or treats lung cancer, described composition comprises one or more nucleic acid molecule, every kind of nucleic acid molecule encoding sequence, its of described sequence and this paper restriction expressed at least part of complementation of microrna sequences of the nucleic acid molecule encoding that is raised in patients with lung cancer, and/or described sequence is corresponding to the sequence of the microrna sequences of its expression nucleic acid molecule encoding that quilt is reduced in patients with lung cancer of this paper restriction.
At last, aspect the 12, the present invention relates to described pharmaceutical composition for the preparation of the purposes in the medicine that prevents and/or treats lung cancer.
It is clear that other embodiment of the present invention will become from the following detailed description.
The accompanying drawing summary
Fig. 1: described schema, schematically shown for the key method step of determining expression characteristic of the present invention, one or more target cell that lung cancer is inclined to occurs for the identification of showing or having in described expression characteristic.
Fig. 2: a non-supervisory hierarchical classification that is illustrated in the miRNA of differential expression in normal lung tissue and the different classes of lung cancer.This classification is classified as one group with the normal sample of major part, and most of lung cancer sample is classified as another group.Lung cancer different classes of comprises small cell lung cancer, prognosis of squamous cell lung cancer, gland cancer lung cancer, also clearly is distinguished from each other.
Fig. 3: front 7 the miRNA expression characteristics in a first aspect of the present invention are shown, for the identification of one or more target cell that shows lung cancer.The tolerance range of this cross validation classification also is shown, and these miRNA compare the expression adjusting in cancerous lung tissue (namely raising or downward modulation) with normal lung tissue as key words sorting.
Fig. 4: front 9 the miRNA expression characteristics in a second aspect of the present invention are shown, and one or more target cell for the identification of showing nonsmall-cell lung cancer comprises prognosis of squamous cell lung cancer and gland cancer lung cancer.The tolerance range of this cross validation classification also is shown, and these miRNA compare the expression adjusting in nonsmall-cell lung cancer (namely raising or downward modulation) with normal lung tissue as key words sorting.
Fig. 5: front 5 the miRNA expression characteristics in a third aspect of the present invention are shown, for the identification of one or more target cell that shows gland cancer lung cancer.The tolerance range of this cross validation classification also is shown, and these miRNA compare the expression adjusting in gland cancer lung cancer (namely raising or downward modulation) with normal lung tissue as key words sorting.
Fig. 6: front 9 the miRNA expression characteristics in a fourth aspect of the present invention are shown, for the identification of one or more target cell that shows prognosis of squamous cell lung cancer.The tolerance range of this cross validation classification also is shown, and these miRNA compare the expression adjusting in prognosis of squamous cell lung cancer (namely raising or downward modulation) with normal lung tissue as key words sorting.
Fig. 7: front 11 the miRNA expression characteristics in a fifth aspect of the present invention are shown, for the identification of one or more target cell that shows small cell lung cancer.The tolerance range of this cross validation classification also is shown, and these miRNA compare the expression adjusting in small cell lung cancer (namely raising or downward modulation) with normal lung tissue as key words sorting.
Fig. 8: front 8 the miRNA expression characteristics in a sixth aspect of the present invention are shown, are used for difference nonsmall-cell lung cancer (NSCLC) and small cell lung cancer (SCLC).The tolerance range of this cross validation classification also is shown, and these miRNA compare the expression adjusting in nonsmall-cell lung cancer (namely raising or downward modulation) with small cell lung cancer as key words sorting.
Fig. 9: a non-supervisory hierarchical classification based on the miRNA of differential expression in the different classes of lung cancer is shown, shows small cell lung cancer, prognosis of squamous cell lung cancer and gland cancer lung cancer, clearly be distinguished from each other.
Figure 10: front 8 the miRNA expression characteristics in a eighth aspect of the present invention are shown, are used for difference gland cancer lung cancer (AC) and prognosis of squamous cell lung cancer (SQ).The tolerance range of this cross validation classification also is shown, and these miRNA compare the expression adjusting in gland cancer lung cancer (namely raising or downward modulation) with prognosis of squamous cell lung cancer as key words sorting.
Detailed description of the Invention
The present invention is based on following unexpected discovery, namely based on specific miRNA expression characteristic, can high precision and susceptibility identify reliably lung cancer, and distinguish dissimilar lung cancer, wherein said expression characteristic typically comprises the human miRNA that is reduced by upper mediation as defined herein.More particularly, described miRNA expression characteristic-by analyzing whole miRNA expression pattern and/or each miRNA expression level-so that can detect the lung cancer under the early stage morbid state and distinguish dissimilar lung cancer.
Following illustration of the present invention can suitably be implemented under the condition that lacks herein not concrete any one or more element that discloses, one or more restriction.
The present invention will be described according to specific embodiment and with reference to accompanying drawing, but the present invention is not limited, and limited by claims.Described accompanying drawing only is schematically, is considered to nonrestrictive.
When term " comprises " when being used in specification sheets of the present invention and claims, it does not get rid of other element or step.Be the object of the invention, term " by ... form " be considered to the preferred embodiment that term " comprises ".If group is restricted to and comprises at least one fixed number purpose embodiment hereinafter, this also has been understood to disclose the group that preferably only is comprised of these embodiments.
Use indefinite article or definite article when referring to the singulative noun, for example " one " or " a kind of " when " described ", comprise the plural form of this noun, unless otherwise indicated.
Term " approximately " refers to that in the present invention those skilled in the art understand the accuracy interval of the technique effect that still can guarantee the purpose feature.This term ordinary representation departs from indicator value ± 10%, preferred ± 5%.
In addition, term first, second, third, (a), (b), (c) etc. are used for element like the region class in specification sheets and claims, be not that description order or chronological order are necessary.The term that should understand application like this is interchangeable in suitable situation, and the embodiment that the present invention describes can be to be different from other sequential operation of described herein or illustration.
Term further be defined in following use term the time provide.
Following term or definition only provide in order to understand the present invention.These definition should not be considered to have the scope of understanding less than those skilled in the art.
One of purpose of the present invention provides by determining that the multiple nucleic acids molecule diagnoses and/or treat lung cancer and/or the novel method of the tendency of this illness occurs, every kind of microRNA of nucleic acid molecule encoding (miRNA) sequence, wherein compare with the normal healthy controls cell, one or more of described multiple nucleic acids molecule be differential expression in the target cell of analyzing, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has lung cancer or the lung cancer occurence tendency is arranged.
More specifically, one of purpose of the present invention provides expression of nucleic acid feature and/or composition, for the identification of showing or having one or more Mammals target cell that the lung cancer tendency occurs and/or distinguish the dissimilar of lung cancer.Dissimilar squamous cell carcinoma, gland cancer and the small cell lung cancers of comprising of lung cancer.
Term used herein " cancer " (being also referred to as " cancer (carcinoma) "), be often referred to the malignant growth of any type, namely compare any morphology and/or the physiology change (based on hereditary reprogrammed (genetic re-programming)) that show or have the target cell that cancer feature tendency occurs with unaffected (health) wild-type control cells.The example of this change can relate to cell size and shape (become large or diminish), cell proliferation (cell count increase), cytodifferentiation (physiological status variation), apoptosis (apoptosis) or cell survival.
Term used herein " lung cancer " refers to Growth of Cells out of control in the lung tissue, or the cancerous growths of lung.
Term used herein " lung cancer dissimilar " comprises gland cancer lung cancer, prognosis of squamous cell lung cancer and small cell lung cancer.
" gland cancer lung cancer " (" Adenocarcinoma lung cancer " or " adenocarcinoma lung carcinoma ") is a kind of nonsmall-cell lung cancer.80% lung cancer is nonsmall-cell lung cancer, and wherein about 50% is gland cancer.The gland cancer source of lung arises from the periphery position of lung, can be before making a definite diagnosis long-time in existence.Be most commonly in a kind of Lung Cancer Types of women, and be more common in the non-smoker.
" prognosis of squamous cell lung cancer " (" Squamous cell lung cancer " or " squamous cell lung carcinoma ") is a kind of nonsmall-cell lung cancer.About 30% NSCLC is prognosis of squamous cell lung cancer.The common source of prognosis of squamous cell lung cancer arises from the segmental bronchus (big airways) of lung central part.Symptom namely appears in most of patients in early days, common spitting of blood (hemoptysis (coughing up blood)).
" small cell lung cancer " (" Small cell lung cancer " or " small cell lung carcinoma ") is considered to originate from the neuroendocrine cell of a part (liner) that forms segmental bronchus (air flue) epithelium.SCLC accounts for 18% of all lung cancer cases.SCLC has strong aggressive.Growth can arrive liver, lung, bone and brain via blood flow rapidly.Often can find tumour at these organs during diagnosis.
Term used herein " patient " refers to be thought suffering from least lung cancer, or the mankind of certain type of lung cancer.And term " healthy individual " or " normal healthy controls " are often referred to the Healthy People that generation does not have this kind cancerous phenotype.For example relatively during lung cancer different classes of, the individuality of suffering from the lung cancer of other classifications also is used as " contrast " usually but in some applications.
In in vitro method of the present invention for detection of sample usually should collect in clinical acceptable mode, preferably collect with protection nucleic acid (particularly RNA) or the mode of protein.Sample to be analyzed typically derives from tissue.In addition, blood and other type sample also can use.Sample can merge after initial processing especially.But also can use the sample that does not merge.
Term used herein " microRNA " (or " miRNA ") is its its ordinary meaning in this area (Bartel, D.P. (2004) Cell 23,281-292; He, L.and Hannon, G.J. (2004) Nat.Rev.Genet.5,522-531).Therefore, " microRNA " refers to the RNA molecule derived from the genomic gene seat, and it is from forming the transcript processing of partial rna precursor miRNA structure.Ripe miRNA normal length is 20,21,22,23,24 or 25 Nucleotide, and the Nucleotide of other number also can exist, for example 18,19,26 or 27 Nucleotide.
The miRNA encoding sequence has the potentiality with the pairing of flanking gene group sequence, ripe miRNA is placed within the non-RNA duplex that matches fully (this paper is also referred to as stem-ring or hairpin structure or pre-miRNA), and described duplex is as the intermediate that carries out miRNA processing from longer precursor transcript.This processing typically continuous action of two species specific endonucleases by being called Drosha and Dicer occurs.Drosha produces the miRNA precursor (this paper is also referred to as " pre-miRNA ") that typically is folded into hair clip or stem-ring structure from primary transcript (this paper is also referred to as " pri-miRNA ").From this miRNA precursor, by Dicer cutting miRNA duplex, its one arm at hair clip or stem-ring structure comprises ripe miRNA, and the sections that comprises similar size at other one arm (is commonly referred to miRNA *).Then miRNA is directed to its said target mrna bringing into play its function, and miRNA *Be degraded.In addition, miRNA is typically derived from the genome segment different from the protein coding region of prediction.
Term used herein " miRNA precursor " (or " precursor miRNA " or " pre-miRNA ") refers to process from it part of the miRNA primary transcript of ripe miRNA.Typically, pre-miRNA is folded into stable hair clip (being duplex) or stem-ring structure.Hairpin structure typically length is 50-80 Nucleotide, preferred 60-70 Nucleotide (counting miRNA residue, with the residue of miRNA pairing, and any sections that interleaves, but get rid of the more sequence of far-end).
The term used herein nucleic acid molecule of microrna sequences " coding " refer to encode any nucleic acid molecule of microRNA (miRNA).Therefore, this term not only refers to ripe miRNA, also refers to corresponding aforesaid precursor miRNA and elementary miRNA transcript.In addition, the invention is not restricted to the RNA molecule, also comprise the dna molecular of corresponding coding microRNA, the dna molecular that for example produces by the reverse transcription miRNA sequence.The nucleic acid molecule of microrna sequences of the present invention of the encoding single miRNA sequence (being individual miRNA) of typically encoding.But, also may the two or more miRNA sequences of this nucleic acid molecule encoding (being two or more miRNA), for example a transcription unit is included in two or more miRNA sequences of regulating under sequence such as promotor or the transcription terminator control commonly used.
It (is the nucleotide sequence (coupling of 5' → 3') or (be nucleic acid array complementation in the coded miRNA (sequence of 5' → 3') or in other words mate the reverse complementary sequence (3' → 5') molecule) of coded miRNA sequence corresponding to coded miRNA (5' → 3') molecule of sequence) and " antisense nucleic acid molecule " that the term used herein nucleic acid molecule of microrna sequences " coding " also is understood to include " the phosphorothioate odn molecule is arranged ".Term used herein " complementation " refers to that " antisense " sequence of nucleic acid molecules and corresponding " justice is arranged " sequence of nucleic acid molecules (having the sequence that is complementary to antisense sequences) form the ability of base pair, preferred Watson-Crick base pair.
Within the scope of the present invention, two nucleic acid molecule (namely " justice being arranged " and " antisense " molecule) can complete complementary, and namely they do not contain any base mispairing and/or Nucleotide extra or disappearance.Perhaps, two molecules comprise one or more base mispairing or different on their Nucleotide sum (causing owing to add or lack).Preferably, " complementation " nucleic acid molecule comprises and 10 continuous nucleotides that are included in the sequence demonstration complete complementary in corresponding " justice is arranged " nucleic acid molecule at least.
Therefore, the multiple nucleic acids molecule that is included in the coding miRNA sequence in the diagnostic kit of the present invention can comprise that one or more " has the phosphorothioate odn molecule " and/or one or more " antisense nucleic acid molecule ".Sometimes, diagnostic kit comprises that one or more " has the phosphorothioate odn molecule " (being miRNA sequence itself), described molecule has been considered to form all or at least inferior set of the miRNA (being molecule marker) of differential expression, the miRNA of described differential expression is the indication that has or occur the particular disorder tendency, and this paper is lung cancer.On the other hand, when diagnostic kit comprises one or more " antisense nucleic acid molecule " sequence of miRNA sequence complementation (namely with), described molecule can comprise be suitable for detecting and/or quantitative given sample in probe molecule (being used for carrying out hybridization assays) and/or the Oligonucleolide primers (for example being used for reverse transcription or PCR uses) of one or more specific (complementation) miRNA sequence.
The multiple nucleic acids molecule of definition can comprise at least 2 kinds, at least 10 kinds, at least 50 kinds, at least 100 kinds, at least 200 kinds, at least 500 kinds, at least 1000 kinds, at least 10000 kinds or at least 100000 kinds of nucleic acid molecule, miRNA sequence of every kind of molecule encoding in the present invention.
Term used herein " differential expression " refers to that the expression level of specific miRNA in target cell changes than the normal healthy controls cell, and it can be to raise (namely miRNA concentration increases in target cell) or downward modulation (namely miRNA concentration reduces or disappears in target cell).In other words, nucleic acid molecule is activated in target cell to than level higher or lower in control cells.
Within the scope of the present invention, nucleic acid molecule is considered to differential expression, if the corresponding expression level of this nucleic acid molecule in target cell and control cells typically differs at least 5% or at least 10%, preferably at least 20% or at least 25%, most preferably at least 30% or at least 50%.Therefore, the latter's value raises respectively at least 1.3 times or at least 1.5 times corresponding to the expression level of given nucleic acid molecule in target cell than control cells, otherwise perhaps the expression level in target cell is reduced at least 0.7 times or at least 0.5 times.
Term used herein " expression level " refers to the degree that specific miRNA sequence is transcribed from its genomic gene seat, i.e. the concentration of miRNA in one or more analyzed cell.
As mentioned above, term " control cells " typically refers to collect from (health) the individual cell sample that does not have the lung cancer phenotypic characteristic.But in some applications, for example relatively during lung cancer different classes of, the cell of collecting from the lung cancer individuality of other classifications also is used as " control cells " usually.
The determining of expression level typically followed the standard program (Sambrook that has set up well known in the art, J.et al. (1989) Molecular Cloning:A Laboratory Manual.2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F.M.et al. (2001) Current Protocols in Molecular Biology.Wiley﹠amp; Sons, Hoboken, NJ).Determine and to carry out at rna level, for example use the miRNA specific probe to carry out the Northern engram analysis, perhaps behind reverse transcription (and clone) RNA group, for example carry out at dna level by quantitative PCR or real time pcr.Any nucleic acid molecule of the above-mentioned microrna sequences of analysis of encoding " determined " to comprise in term used herein.But, owing to pri-miRNA and pre-mRNA half life weak point, typically only measure the concentration of ripe miRNA.
In special embodiment, the standard value of the expression level that obtains in some independent measurements (for example two, three, five or ten measurements) of given sample and/or the some measurements in a group target cell or control cells is used to analyze.Standard value can obtain with any method known in the art.For example, the scope of mean value ± 2SD (standard deviation) or mean value ± 3SD can be used as standard value.
Difference between the sick cell that obtains and the expression level of control cells can be normalized to the expression level of further contrast nucleic acid, and for example the expression level of known house-keeping gene is not according to the individual morbid state in sample source and difference.House-keeping gene for example comprises beta-actin, glyceraldehyde-3-phosphate dehydrogenase and ribosomal protein P1 etc.In preferred embodiments, contrast nucleic acid is the another kind of miRNA of stably express in known different non-cancer at sample source individuality and cancer (front) state.
But, replace in any experiment, determining the expression level of one or more control cells, also can be based on experimental evidence and/or prior art data definition one or more cutoff value for specific cells phenotype (being morbid state).In this case, the corresponding expression level of one or more target cell can be determined with the contrast miRNA that is used for normalized stably express.If the expression level of " normalization method " of calculating is higher than the cutoff value of corresponding definition, then this discovery is the indication that genetic expression is raised.Otherwise if the expression level of " normalization method " of calculating is lower than the cutoff value of corresponding definition, then this discovery is the indication of down regulation of gene expression.
In the present invention, term " is identified demonstration or is had one or more Mammals target cell that the lung cancer tendency occurs " and also comprises prediction and probability analysis (on " diagnosis " meaning).Composition disclosed herein and method are intended to clinical application, to determine form of therapy, comprise therapeutic intervention, Case definition such as disease stage, and diseases monitoring and surveillance of disease.According to the present invention, can be provided for checking the intermediate result of Obj State.This intermediate result can make up to help doctor, nurse or other practitioner to diagnose out this object to suffer from this disease with extraneous information.Perhaps, the present invention can be used for from cell sample detecting carcinous change, and provide useful information to the doctor to diagnose.In addition, the present invention also is used for distinguishing dissimilar lung cancer.
In the present invention, the nucleic acid molecule of one or more differential expression of identifying represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has lung cancer.Term used herein " expression characteristic " refers to one group of nucleic acid molecule (for example miRNA), wherein the expression level of each nucleic acid molecule collect between the cell of patients with lung cancer and normal healthy controls different.Herein, the expression of nucleic acid feature also refers to a group echo and represents minimum purpose (difference) nucleic acid molecule that every kind of nucleic acid molecule encoding can be identified the one by one miRNA sequence of the phenotype state of body.
In first aspect, the present invention relates to for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell that the lung cancer tendency occurs, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has lung cancer or the lung cancer occurence tendency is arranged.
The expression of nucleic acid feature that this paper limits can comprise at least 82 kinds of nucleic acid molecule, preferably at least 13 kinds of nucleic acid molecule, particularly preferably at least 7 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-183 (SEQ ID NO:1), hsa-miR-451 (SEQ ID NO:4), hsa-miR-126 (SEQ ID NO:54), hsa-miR-126 *(SEQ ID NO:55), hsa-miR-30a (SEQ ID NO:56), hsa-miR-145 (SEQ ID NO:58), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-96 (SEQ ID NO:2), hsa-miR-144 (SEQ ID NO:3), hsa-miR-200c (SEQ ID NO:5), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR-218 (SEQ ID NO:57), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR-130b (SEQ ID NO:9), hsa-miR-30a *(SEQ ID NO:10), hsa-miR-144 *(SEQ ID NO:11), hsa-miR-425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-497 (SEQ ID NO:14), hsa-miR-182 (SEQ ID NO:15), hsa-miR-187 *(SEQ ID NO:16), hsa-miR-30b (SEQ ID NO:17), hsa-miR-93 (SEQ ID NO:18), hsa-miR-145 *(SEQ ID NO:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID NO:21), hsa-miR-200a (SEQ ID NO:22), hsa-miR-625 (SEQ ID NO:23), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c-2 *(SEQ ID NO:25), hsa-miR-98 (SEQ ID NO:26), hsa-miR-1 (SEQ ID NO:27), hsa-miR-106b (SEQ ID NO:28), hsa-miR-150 *(SEQ ID NO:29), hsa-miR-25 (SEQ ID NO:30), hsa-miR-134 (SEQ ID NO:31), hsa-miR-328 (SEQ ID NO:32), hsa-miR-638 (SEQ ID NO:33), has-miR-200b *(SEQ ID NO:34), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-1224-5p (SEQ ID NO:36), hsa-miR-557 (SEQ ID NO:37), hsa-miR-15b (SEQ ID NO:38), has-miR-454 (SEQ ID NO:39), hsa-miR-301a (SEQ ID NO:40), hsa-miR-135b (SEQ ID NO:41), hsa-miR-100 (SEQ ID NO:42), hsa-miR-223 (SEQ ID NO:43), hsa-miR-196b (SEQ ID NO:44), hsa-miR-196a (SEQ ID NO:45), hsa-miR-1226 *(SEQ ID NO:46), hsa-miR-424 (SEQ ID NO:47), hsa-miR-21 *(SEQ ID NO:48), hsa-miR-572 (SEQ ID NO:49), hsa-miR-18b (SEQ ID NO:50), hsa-miR-18a (SEQ ID NO:51), hsa-miR-9 *(SEQ ID NO:52), hsa-miR-301b (SEQ ID NO:53), hsa-miR-101 (SEQ ID NO:63), has-miR-143 (SEQ ID NO:61), hsa-miR-140-5p (SEQ ID NO:62), hsa-miR-30d (SEQ ID NO:63), hsa-miR-29c (SEQ ID NO:64), hsa-miR-199b-5p (SEQ ID NO:65), hsa-miR-224 (SEQ ID NO:66), hsa-miR-125a-3p (SEQ ID NO:67), hsa-miR-9 (SEQ ID NO:68), hsa-5miR-200b (SEQ ID NO:69), hsa-miR-195 (SEQ ID NO:70), hsa-miR-210 (SEQ ID NO:71), hsa-miR-7 (SEQ ID NO:72), hsa-miR-21 (SEQ ID NO:73), hsa-miR-17 (SEQ ID NO:74), hsa-miR-128 (SEQ ID NO:75), hsa-miR-141 (SEQ ID NO:76), hsa-miR-142-5p (SEQ ID NO:77), hsa-miR-150 (SEQ ID NO:78), hsa-miR-205 (SEQ ID NO:79), hsa-miR-192 (SEQ ID NO:80), the nucleic acid molecule of hsa-miR-215 (SEQ ID NO:81) and hsa-miR-106a (SEQ ID NO:82).
Particularly preferably, compare with described one or more control cells, has-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR-425, hsa-miR-182, has-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR-98, hsa-miR-106b, has-miR-25, hsa-miR-200b encode in described one or more target cell *, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-196b, hsa-miR-196a, hsa-miR-424, hsa-miR-21 *, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *, hsa-miR-301b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa-miR-192, hsa-miR-215, hsa-miR-106a the nucleic acid molecule up-regulated, and coding hsa-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-218, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, has-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-1226 *, hsa-miR-572, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, has-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p, hsa-miR-195, hsa-miR-142-5p and hsa-miR-150 the down-regulated expression of arbitrary or multiple nucleic acids molecule.
The nucleotide sequence of above-mentioned miRNA is listed in table 1.
Table 1
miRNA Sequence (5' → 3')
hsa-miR-183 uauggcacugguagaauucacu
hsa-miR-96 uuuggcacuagcacauuuuugcu
hsa-miR-144 uacaguauagaugauguacu
hsa-miR-451 aaaccguuaccauuacugaguu
hsa-miR-200c uaauacugccggguaaugaugga
hsa-miR-486-5p uccuguacugagcugccccgag
hsa-miR-338-3p uccagcaucagugauuuuguug
hsa-miR-139-5p ucuacagugcacgugucuccag
hsa-miR-130b cagugcaaugaugaaagggcau
hsa-miR-30a * cuuucagucggauguuugcagc
hsa-miR-144 * ggauaucaucauauacuguaag
hsa-miR-425 aaugacacgaucacucccguuga
hsa-miR-133b uuugguccccuucaaccagcua
hsa-miR-497 cagcagcacacugugguuugu
hsa-miR-182 uuuggcaaugguagaacucacacu
hsa-miR-187 * ggcuacaacacaggacccgggc
hsa-miR-30b uguaaacauccuacacucagcu
hsa-miR-93 caaagugcuguucgugcagguag
hsa-miR-145 * ggauuccuggaaauacuguucu
hsa-miR-429 uaauacugucugguaaaaccgu
hsa-miR-498 uuucaagccagggggcguuuuuc
hsa-miR-200a uaacacugucugguaacgaugu
hsa-miR-625 agggggaaaguucuauagucc
hsa-miR-130a cagugcaauguuaaaagggcau
hsa-miR-30c-2 * cugggagaaggcuguuuacuc
hsa-miR-98 ugagguaguaaguuguauuguu
hsa-miR-1 uggaauguaaagaaguauguau
hsa-miR-106b uaaagugcugacagugcagau
hsa-miR-150 * cugguacaggccugggggacag
hsa-miR-25 cauugcacuugucucggucuga
hsa-miR-134 ugugacugguugaccagagggg
hsa-miR-328 cuggcccucucugcccuuccgu
[0148]
hsa-miR-638 agggaucgcgggcggguggcggccu
hsa-miR-200b * caucuuacugggcagcauugga
hsa-miR-1225-5p guggguacggcccagugggggg
hsa-miR-1224-5p gugaggacucgggaggugg
hsa-miR-557 guuugcacgggugggccuugucu
hsa-miR-15b uagcagcacaucaugguuuaca
hsa-miR-454 uagugcaauauugcuuauagggu
hsa-miR-301a cagugcaauaguauugucaaagc
hsa-miR-135b uauggcuuuucauuccuauguga
hsa-miR-100 aacccguagauccgaacuugug
hsa-miR-223 ugucaguuugucaaauacccca
hsa-miR-196b uagguaguuuccuguuguuggg
hsa-miR-196a uagguaguuucauguuguuggg
hsa-miR-1226 * gugagggcaugcaggccuggaugggg
hsa-miR-424 cagcagcaauucauguuuugaa
hsa-miR-21 * caacaccagucgaugggcugu
hsa-miR-572 guccgcucggcgguggccca
hsa-miR-18b uaaggugcaucuagugcaguuag
hsa-miR-18a uaaggugcaucuagugcagauag
hsa-miR-9 * auaaagcuagauaaccgaaagu
hsa-miR-301b cagugcaaugauauugucaaagc
hsa-miR-126 ucguaccgugaguaauaaugcg
hsa-miR-126 * cauuauuacuuuugguacgcg
hsa-miR-30a uguaaacauccucgacuggaag
hsa-miR-218 uugugcuugaucuaaccaugu
hsa-miR-145 guccaguuuucccaggaaucccu
hsa-miR-140-3p uaccacaggguagaaccacgg
hsa-miR-101 uacaguacugugauaacugaa
hsa-miR-143 ugagaugaagcacuguagcuc
hsa-miR-140-5p cagugguuuuacccuaugguag
hsa-miR-30d uguaaacauccccgacuggaag
hsa-miR-29c uagcaccauuugaaaucgguua
hsa-miR-199b-5p cccaguguuuagacuaucuguuc
hsa-miR-224 caagucacuagugguuccguu
hsa-miR-125a-3p acaggugagguucuugggagcc
hsa-miR-9 ucuuugguuaucuagcuguauga
hsa-miR-200b uaauacugccugguaaugauga
hsa-miR-195 uagcagcacagaaauauuggc
hsa-miR-210 cugugcgugugacagcggcuga
hsa-miR-7 uggaagacuagugauuuuguugu
hsa-miR-21 uagcuuaucagacugauguuga
hsa-miR-17 caaagugcuuacagugcagguag
hsa-miR-128 ucacagugaaccggucucuuu
hsa-miR-141 uaacacugucugguaaagaugg
[0149]
hsa-miR-142-5p cauaaaguagaaagcacuacu
hsa-miR-150 ucucccaacccuuguaccagug
hsa-miR-205 uccuucauuccaccggagucug
hsa-miR-192 cugaccuaugaauugacagcc
hsa-miR-215 augaccuaugaauugacagac
hsa-miR-106a aaaagugcuuacagugcagguag
All miRNA sequences that this paper discloses all have been kept at (http://microrna.sanger.ac.uk/ in the miRBase database; Also referring to Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).
Term used herein " at least a nucleic acid molecule " can relate to any subgroup of described multiple nucleic acids molecule, such as any, any two, the nucleic acid molecule such as wantonly three kinds, wantonly four kinds, wantonly five kinds, wantonly six kinds, wantonly seven kinds, wantonly eight kinds, wantonly nine kinds, wantonly ten kinds, every kind of equal encoded packets of nucleic acid molecule is contained in the microrna sequences in the described expression of nucleic acid feature.
In second aspect, the present invention relates to comprise squamous cell carcinoma and gland cancer for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell that the nonsmall-cell lung cancer tendency occurs.Described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, this expression of nucleic acid feature is the indication that has nonsmall-cell lung cancer or the nonsmall-cell lung cancer occurence tendency is arranged, and comprises squamous cell carcinoma and gland cancer.
The expression of nucleic acid feature that this paper limits can comprise at least 70 kinds of nucleic acid molecule, preferably at least 14 kinds of nucleic acid molecule, particularly preferably at least 9 kinds of nucleic acid molecule.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-183 (SEQ ID NO:1), hsa-miR-451, (SEQ ID NO:4), hsa-miR-497 (SEQ ID NO:14), hsa-miR-126 (SEQ ID NO:54), hsa-miR-126 *(SEQ ID NO:55), hsa-miR-30a (SEQ ID NO:56), hsa-miR-218 (SEQ ID NO:57), hsa-miR-145 (SEQ ID NO:58), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-96 (SEQ ID NO:2), hsa-miR-144 (SEQ ID NO:3), hsa-miR-200c (SEQ ID NO:5), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR-130b (SEQ ID NO:9), hsa-miR-144 *(SEQ ID NO:11), hsa-miR-425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-182 (SEQ ID NO:15), hsa-miR-187 *(SEQ ID NO:16), hsa-miR-30b (SEQ ID NO:17), hsa-miR-93 (SEQ ID NO:18), hsa-miR-145 *(SEQ ID NO:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID NO:21), hsa-miR-200a (SEQ ID NO:22), hsa-miR-625 (SEQ ID NO:23), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c-2 *(SEQ ID NO:25), hsa-miR-98 (SEQ ID NO:26), hsa-miR-1 (SEQ ID NO:27), hsa-miR-150 *(SEQ ID NO:29), hsa-miR-25 (SEQ ID NO:30), hsa-miR-134 (SEQ ID NO:31), hsa-miR-328 (SEQ ID NO:32), hsa-miR-638 (SEQ ID NO:33), hsa-miR-200b *(SEQ ID NO:34), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-1224-5p (SEQ ID NO:36), hsa-miR-557 (SEQ ID NO:37), hsa-miR-135b (SEQ ID NO:41), hsa-miR-100 (SEQ ID NO:42), has-miR-424 (SEQ ID NO:47), hsa-miR-21 *(SEQ ID NO:48), hsa-miR-30a *(SEQ ID NO:10), hsa-miR-494 (SEQ ID NO:83), hsa-miR-193b (SEQ ID NO:84), hsa-miR-99a (SEQ ID NO:85), hsa-miR-335 (SEQ ID NO:86), hsa-miR-106b (SEQ ID NO:28), has-miR-140-5p (SEQ ID NO:59), hsa-miR-101 (SEQ ID NO:60), hsa-miR-143 (SEQ ID NO:61), hsa-miR-30d (SEQ ID NO:63), hsa-miR-29c (SEQ ID NO:64), hsa-miR-224 (SEQ ID NO:66), hsa-miR-9 (SEQ ID NO:68), hsa-miR-200b (SEQ ID NO:69), has-miR-195 (SEQ ID NO:70), hsa-miR-210 (SEQ ID NO:71), hsa-miR-7 (SEQ ID NO:72), hsa-miR-21 (SEQ ID NO:83), hsa-miR-128 (SEQ ID NO:75), hsa-miR-141 (SEQ ID NO:76), hsa-miR-142-5p (SEQ ID NO:77), hsa-miR-150 (SEQ ID NO:78), hsa-miR-205 (SEQ ID NO:79), hsa-miR-192 (SEQ ID NO:80) and hsa-miR-215 (SEQ ID NO:215). arbitrary or multiple nucleic acids molecule.
Particularly preferably, compare with described one or more control cells, hsa-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR-98, hsa-miR-25, hsa-miR-200b encode in described one or more target cell *, hsa-miR-135b, hsa-miR-424, hsa-miR-21 *, hsa-miR-494, hsa-miR-193b, hsa-miR-106b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa-miR-192, hsa-miR-215 arbitrary or multiple nucleic acids developed by molecule raise and coding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p and hsa-miR-139-5p, hsa-miR-338-3p, hsa-miR-144 *, hsa-miR-133b, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-30a *, hsa-miR-99a, hsa-miR-335, has-miR-140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 the down-regulated expression of arbitrary or multiple nucleic acids molecule.
The nucleotide sequence of above-mentioned miRNA is listed in table 2.
Table 2
miRNA Sequence (5' → 3')
hsa-miR-183 uauggcacugguagaauucacu
hsa-miR-96 uuuggcacuagcacauuuuugcu
hsa-miR-144 uacaguauagaugauguacu
hsa-miR-451 aaaccguuaccauuacugaguu
hsa-miR-200c uaauacugccggguaaugaugga
hsa-miR-486-5p uccuguacugagcugccccgag
hsa-miR-139-5p ucuacagugcacgugucuccag
hsa-miR-497 cagcagcacacugugguuugu
hsa-miR-338-3p uccagcaucagugauuuuguug
hsa-miR-130b cagugcaaugaugaaagggcau
hsa-miR-144 * ggauaucaucauauacuguaag
hsa-miR-425 aaugacacgaucacucccguuga
hsa-miR-133b uuugguccccuucaaccagcua
hsa-miR-182 uuuggcaaugguagaacucacacu
hsa-miR-187 * ggcuacaacacaggacccgggc
hsa-miR-30b uguaaacauccuacacucagcu
hsa-miR-93 caaagugcuguucgugcagguag
hsa-miR-145 * ggauuccuggaaauacuguucu
hsa-miR-429 uaauacugucugguaaaaccgu
hsa-miR-498 uuucaagccagggggcguuuuuc
hsa-miR-200a uaacacugucugguaacgaugu
hsa-miR-572 guccgcucggcgguggccca
hsa-miR-130a cagugcaauguuaaaagggcau
hsa-miR-30c-2 * cugggagaaggcuguuuacuc
hsa-miR-98 ugagguaguaaguuguauuguu
hsa-miR-1 uggaauguaaagaaguauguau
hsa-miR-150 * cugguacaggccugggggacag
hsa-miR-25 cauugcacuugucucggucuga
hsa-miR-134 ugugacugguugaccagagggg
[0159]
hsa-miR-328 cuggcccucucugcccuuccgu
hsa-miR-638 agggaucgcgggcggguggcggccu
hsa-miR-200b * caucuuacugggcagcauugga
hsa-miR-1225-5p guggguacggcccagugggggg
hsa-miR-1224-5p gugaggacucgggaggugg
hsa-miR-557 guuugcacgggugggccuugucu
hsa-miR-135b uauggcuuuucauuccuauguga
hsa-miR-100 aacccguagauccgaacuugug
hsa-miR-424 cagcagcaauucauguuuugaa
hsa-miR-21 * caacaccagucgaugggcugu
hsa-miR-30a * cuuucagucggauguuugcagc
hsa-miR-494 ugaaacauacacgggaaaccuc
hsa-miR-193b aacuggcccucaaagucccgcu
hsa-miR-99a aacccguagauccgaucuugug
hsa-miR-335 ucaagagcaauaacgaaaaaugu
hsa-miR-126 ucguaccgugaguaauaaugcg
hsa-miR-126 * cauuauuacuuuugguacgcg
hsa-miR-30a uguaaacauccucgacuggaag
hsa-miR-218 uugugcuugaucuaaccaugu
hsa-miR-145 guccaguuuucccaggaaucccu
hsa-miR-140-3p uaccacaggguagaaccacgg
hsa-miR-106b uaaagugcugacagugcagau
hsa-miR-140-5p cagugguuuuacccuaugguag
hsa-miR-101 uacaguacugugauaacugaa
hsa-miR-143 ugagaugaagcacuguagcuc
hsa-miR-30d uguaaacauccccgacuggaag
hsa-miR-29c uagcaccauuugaaaucgguua
hsa-miR-224 caagucacuagugguuccguu
hsa-miR-9 ucuuugguuaucuagcuguauga
hsa-miR-200b uaauacugccugguaaugauga
hsa-miR-195 uagcagcacagaaauauuggc
hsa-miR-210 cugugcgugugacagcggcuga
hsa-miR-7 uggaagacuagugauuuuguugu
hsa-miR-21 uagcuuaucagacugauguuga
hsa-miR-128 ucacagugaaccggucucuuu
hsa-miR-141 uaacacugucugguaaagaugg
hsa-miR-142-5p cauaaaguagaaagcacuacu
hsa-miR-150 ucucccaacccuuguaccagug
hsa-miR-205 uccuucauuccaccggagucug
hsa-miR-192 cugaccuaugaauugacagcc
hsa-miR-215 augaccuaugaauugacagac
All miRNA sequences that this paper discloses all have been kept at (http://microrna.sanger.ac.uk/ in the miRBase database; Also referring to Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).
In the third aspect, the present invention relates to for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell that gland cancer lung cancer tendency occurs, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has gland cancer lung cancer or gland cancer lung cancer occurence tendency is arranged.
The expression of nucleic acid feature that this paper limits can comprise at least 57 kinds of nucleic acid molecule, preferably at least 13 kinds of nucleic acid molecule, particularly preferably at least 5 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-96 (SEQ ID NO:2), hsa-miR-126 (SEQ ID NO:54), hsa-miR-126 *(SEQ ID NO:55), hsa-miR-30a (SEQ ID NO:56), hsa-miR-218 (SEQ ID NO:57), hsa-miR-21 (SEQ ID NO:73), hsa-miR-183 (SEQ ID NO:1), hsa-miR-144 (SEQ ID NO:3), hsa-miR-451 (SEQ ID NO:4), hsa-miR-200c (SEQ ID NO:5), hsa-miR-135b (SEQ ID NO:41), hsa-miR-148a (SEQ ID NO:86), hsa-miR-625 (SEQ ID NO:108), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR-130b (SEQ ID NO:9), has-miR-30a *(SEQ ID NO:10), hsa-miR-144 *(SEQ ID NO:11), hsa-miR-425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-497 (SEQ ID NO:14), hsa-miR-182 (SEQ ID NO:15), hsa-miR-187 *(SEQ ID NO:16), hsa-miR-30b (SEQ ID NO:17), has-miR-145 *(SEQ ID NO:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID NO:21), hsa-miR-200a (SEQ ID NO:22), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c-2 *(SEQ ID NO:25), hsa-miR-134 (SEQ ID NO:31), hsa-miR-638 (SEQ ID NO:33), hsa-miR-200b *(SEQ ID NO:34), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-557 (SEQ ID NO:37), hsa-miR-100 (SEQ ID NO:42), hsa-miR-223 (SEQ ID NO:43), hsa-miR-424 (SEQ ID NO:47), hsa-miR-21 *(SEQ ID NO:48), hsa-miR-99a (SEQ ID NO:85), hsa-miR-34a (SEQ ID NO:87), hsa-miR-542-3p (SEQ ID NO:88), hsa-miR-200a *(SEQ ID NO:89), hsa-miR-375 (SEQ ID NO:90), hsa-miR-145 (SEQ ID NO:58), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-101 (SEQ ID NO:60), has-miR-143 (SEQ ID NO:61), hsa-miR-140-5p (SEQ ID NO:62), hsa-miR-224 (SEQ ID NO:66), hsa-miR-200b (SEQ ID NO:69), hsa-miR-195 (SEQ ID NO:70), hsa-miR-210 (SEQ ID NO:71), hsa-miR-7 (SEQ ID NO:72), hsa-miR-141 (SEQ ID NO:76) and has-miR-192 (SEQ ID NO:80). arbitrary or multiple nucleic acids molecule.
Particularly preferably, compare with described one or more control cells, hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625, hsa-miR-130b, hsa-miR-425, hsa-miR-182, has-miR-429, hsa-miR-200a, hsa-miR-200b encode in described one or more target cell *, hsa-miR-424, hsa-miR-21 *, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a *, hsa-miR-375, hsa-miR-224, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-141, hsa-miR-192 arbitrary or multiple nucleic acids developed by molecule raise and coding hsa-miR-126, hsa-miR-126 *, has-miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, has-miR-134, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-99a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-195 the down-regulated expression of arbitrary or multiple nucleic acids molecule.
The nucleotide sequence of above-mentioned miRNA is listed in table 3.
Table 3
miRNA Sequence (5' → 3')
hsa-miR-183 uauggcacugguagaauucacu
hsa-miR-96 uuuggcacuagcacauuuuugcu
hsa-miR-144 uacaguauagaugauguacu
hsa-miR-451 aaaccguuaccauuacugaguu
hsa-miR-200c uaauacugccggguaaugaugga
hsa-miR-135b uauggcuuuucauuccuauguga
hsa-miR-486-5p uccuguacugagcugccccgag
[0169]
hsa-miR-338-3p uccagcaucagugauuuuguug
hsa-miR-139-5p ucuacagugcacgugucuccag
hsa-miR-130b cagugcaaugaugaaagggcau
hsa-miR-30a * cuuucagucggauguuugcagc
hsa-miR-144 * ggauaucaucauauacuguaag
hsa-miR-425 aaugacacgaucacucccguuga
hsa-miR-133b uuugguccccuucaaccagcua
hsa-miR-497 cagcagcacacugugguuugu
hsa-miR-182 uuuggcaaugguagaacucacacu
hsa-miR-187 * ggcuacaacacaggacccgggc
hsa-miR-30b uguaaacauccuacacucagcu
hsa-miR-145 * ggauuccuggaaauacuguucu
hsa-miR-429 uaauacugucugguaaaaccgu
hsa-miR-498 uuucaagccagggggcguuuuuc
hsa-miR-200a uaacacugucugguaacgaugu
hsa-miR-625 agggggaaaguucuauagucc
hsa-miR-130a cagugcaauguuaaaagggcau
hsa-miR-30c-2 * cugggagaaggcuguuuacuc
hsa-miR-134 ugugacugguugaccagagggg
hsa-miR-638 agggaucgcgggcggguggcggccu
hsa-miR-200b * caucuuacugggcagcauugga
hsa-miR-1225-5p guggguacggcccagugggggg
hsa-miR-557 guuugcacgggugggccuugucu
hsa-miR-100 aacccguagauccgaacuugug
hsa-miR-223 ugucaguuugucaaauacccca
hsa-miR-424 cagcagcaauucauguuuugaa
hsa-miR-21 * caacaccagucgaugggcugu
hsa-miR-99a aacccguagauccgaucuugug
hsa-miR-148a ucagugcacuacagaacuuugu
hsa-miR-34a uggcagugucuuagcugguugu
hsa-miR-542-3p ugugacagauugauaacugaaa
hsa-miR-200a * caucuuaccggacagugcugga
hsa-miR-375 uuuguucguucggcucgcguga
hsa-miR-126 ucguaccgugaguaauaaugcg
hsa-miR-126 * cauuauuacuuuugguacgcg
hsa-miR-30a uguaaacauccucgacuggaag
hsa-miR-218 uugugcuugaucuaaccaugu
hsa-miR-21 uagcuuaucagacugauguuga
hsa-miR-145 guccaguuuucccaggaaucccu
hsa-miR-140-3p uaccacaggguagaaccacgg
hsa-miR-101 uacaguacugugauaacugaa
hsa-miR-143 ugagaugaagcacuguagcuc
hsa-miR-140-5p cagugguuuuacccuaugguag
hsa-miR-224 caagucacuagugguuccguu
[0170]
hsa-miR-200b uaauacugccugguaaugauga
hsa-miR-195 uagcagcacagaaauauuggc
hsa-miR-210 cugugcgugugacagcggcuga
hsa-miR-7 uggaagacuagugauuuuguugu
hsa-miR-141 uaacacugucugguaaagaugg
hsa-miR-192 cugaccuaugaauugacagcc
All miRNA sequences that this paper discloses all have been kept at (http://microrna.sanger.ac.uk/ in the miRBase database; Also referring to Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).
In fourth aspect, the present invention relates to for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell that the prognosis of squamous cell lung cancer tendency occurs, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has prognosis of squamous cell lung cancer or the prognosis of squamous cell lung cancer occurence tendency is arranged.
The expression of nucleic acid feature that this paper limits can comprise at least 112 kinds of nucleic acid molecule, preferably at least 16 kinds of nucleic acid molecule, particularly preferably at least 9 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-144 (SEQ ID NO:3), hsa-miR-451 (SEQ ID NO:4), hsa-miR-200c (SEQ ID NO:5), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR-497 (SEQ ID NO:14), hsa-miR-218 (SEQ ID NO:57), hsa-miR-145 (SEQ ID NO:58), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-30b (SEQ ID NO:17), hsa-miR-93 (SEQ ID NO:18), hsa-miR-126 (SEQ ID NO:54), hsa-miR-126 *(SEQ ID NO:55), hsa-miR-30a (SEQ ID NO:56), hsa-miR-143 (SEQ ID NO:61), hsa-miR-103 (SEQ ID NO:91), hsa-miR-183 (SEQ ID NO:1), has-miR-96 (SEQ ID NO:2), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR-130b (SEQ ID NO:9), hsa-miR-30a *(SEQ ID NO:10), hsa-miR-144 *(SEQ ID NO:11), hsa-miR-425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-182 (SEQ ID NO:15), has-miR-187 *(SEQ ID NO:16), hsa-miR-145 *(SEQ ID NO:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID NO:21), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c-2 *(SEQ ID NO:25), hsa-miR-98 (SEQ ID NO:26), hsa-miR-1 (SEQ ID NO:27), has-miR-106b (SEQ ID NO:28), hsa-miR-150 *(SEQ ID NO:29), hsa-miR-25 (SEQ ID NO:30), hsa-miR-134 (SEQ ID NO:31), hsa-miR-328 (SEQ ID NO:32), hsa-miR-638 (SEQ ID NO:33), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-1224-5p (SEQ ID NO:36), hsa-miR-557 (SEQ ID NO:37), hsa-miR-15b (SEQ ID NO:38), hsa-miR-301a (SEQ ID NO:40), hsa-miR-196b (SEQ ID NO:44), hsa-miR-196a (SEQ ID NO:45), hsa-miR-1226 *(SEQ ID NO:46), hsa-miR-424 (SEQ ID NO:47), hsa-miR-21 *(SEQ ID NO:48), hsa-miR-572 (SEQ ID NO:49), hsa-miR-18b (SEQ ID NO:50), hsa-miR-18a (SEQ ID NO:51), hsa-miR-9 *(SEQ ID NO:52), hsa-miR-301b (SEQ ID NO:53), hsa-miR-29c *(SEQ ID NO:64), hsa-miR-494 (SEQ ID NO:83), hsa-miR-193b (SEQ ID NO:84), hsa-miR-375 (SEQ ID NO:90), hsa-miR-26a (SEQ ID NO:92), hsa-miR-574-3p (SEQ ID NO:93), hsa-miR-151-3p (SEQ ID NO:94), hsa-miR-149 (SEQ ID NO:95), hsa-miR-768-5p (SEQ ID NO:96), hsa-miR-181a (SEQ ID NO:97), hsa-miR-20a (SEQ ID NO:98), hsa-miR-181c (SEQ ID NO:99), hsa-miR-29a (SEQ ID NO:100), hsa-miR-29b (SEQ ID NO:101), hsa-miR-505 (SEQ ID NO:102), hsa-miR-939 (SEQ ID NO:103), hsa-miR-769-5p (SEQ ID NO:104), hsa-miR-30c (SEQ ID NO:105), has-miR-590-5p (SEQ ID NO:106), hsa-miR-671-5p (SEQ ID NO:107), hsa-miR-625 (SEQ ID NO:108), hsa-miR-652 (SEQ ID NO:109), hsa-miR-139-3p (SEQ ID NO:110), has-miR-28-5p (SEQ ID NO:111), hsa-miR-623 (SEQ ID NO:112), hsa-miR-221 (SEQ ID NO:113), hsa-miR-19a (SEQ ID NO:114), hsa-miR-944 (SEQ ID NO:115), hsa-miR-335 (SEQ ID NO:116), hsa-miR-125a-5p (SEQ ID NO:117), hsa-miR-551b (SEQ ID NO:118), hsa-let-7d *(SEQ ID NO:119), hsa-miR-31 *(SEQ ID NO:120), hsa-miR-362-5p (SEQ ID NO:121), hsa-miR-181a *(SEQ ID NO:122), hsa-miR-940 (SEQ ID NO:123), hsa-miR-30b *(SEQ ID NO:124), hsa-miR-601 (SEQ ID NO:125), hsa-miR-20b (SEQ ID NO:126), hsa-miR-202 (SEQ ID NO:127), hsa-miR-101 (SEQ ID NO:60), hsa-miR-140-5p (SEQ ID NO:62), hsa-miR-30d (SEQ ID NO:6) 3, hsa-miR-29c (SEQ ID NO:64), hsa-miR-224 (SEQ ID NO:66), hsa-miR-9 (SEQ ID NO:68), hsa-miR-200b (SEQ ID NO:69), hsa-miR-195 (SEQ ID NO:70), hsa-miR-210 (SEQ ID NO:71), has-miR-7 (SEQ ID NO:72), hsa-miR-21 (SEQ ID NO:73), hsa-miR-17 (SEQ ID NO:74), hsa-miR-128 (SEQ ID NO:75), hsa-miR-141 (SEQ ID NO:76), hsa-miR-142-5p (SEQ ID NO:77), arbitrary or the multiple nucleic acids molecule of hsa-miR-150 (SEQ ID NO:78) and hsa-miR-205 (SEQ ID NO:79).
Particularly preferably, compare with described one or more control cells, hsa-miR-200c, hsa-miR-93, hsa-miR-103, hsa-miR-183, hsa-miR-96, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-98, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, hsa-miR-424, hsa-miR-21 encode in described one or more target cell *, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *, hsa-miR-301b, has-miR-494, hsa-miR-193b, hsa-miR-151-3p, hsa-miR-149, hsa-miR-20a, hsa-miR-505, hsa-miR-769-5p, hsa-miR-590-5p, hsa-miR-590-5p, hsa-miR-625, hsa-miR-28-5p, has-miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-31 *, hsa-miR-362-5p, hsa-miR-20b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, has-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205 arbitrary or multiple nucleic acids developed by molecule raise and coding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-143, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, hsa-miR-187 *, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, has-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-1226 *, hsa-miR-572, hsa-miR-29c *, hsa-miR-375, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-181a, hsa-miR-181c, hsa-miR-29a, hsa-miR-29b, hsa-miR-939, hsa-miR-5 30c, hsa-miR-671-5p, hsa-miR-652, hsa-miR-139-3p, hsa-miR-623, hsa-miR-335, hsa-miR-125a-5p, hsa-miR-551b, hsa-let-7d *, hsa-miR-181a *, hsa-miR-940, hsa-miR-30b *, hsa-miR-601, hsa-miR-202, hsa-miR-101, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 the down-regulated expression of arbitrary or multiple nucleic acids molecule.
The nucleotide sequence of above-mentioned miRNA is listed in table 4.
Table 4
miRNA Sequence (5' → 3')
hsa-miR-144 uacaguauagaugauguacu
hsa-miR-451 aaaccguuaccauuacugaguu
hsa-miR-200c uaauacugccggguaaugaugga
hsa-miR-486-5p uccuguacugagcugccccgag
hsa-miR-338-3p uccagcaucagugauuuuguug
hsa-miR-497 cagcagcacacugugguuugu
hsa-miR-30b uguaaacauccuacacucagcu
hsa-miR-93 caaagugcuguucgugcagguag
hsa-miR-103 agcagcauuguacagggcuauga
hsa-miR-183 uauggcacugguagaauucacu
hsa-miR-96 uuuggcacuagcacauuuuugcu
hsa-miR-139-5p ucuacagugcacgugucuccag
hsa-miR-130b cagugcaaugaugaaagggcau
hsa-miR-30a * cuuucagucggauguuugcagc
hsa-miR-144 * ggauaucaucauauacuguaag
hsa-miR-425 aaugacacgaucacucccguuga
hsa-miR-133b uuugguccccuucaaccagcua
hsa-miR-182 uuuggcaaugguagaacucacacu
hsa-miR-187 * ggcuacaacacaggacccgggc
hsa-miR-145 * ggauuccuggaaauacuguucu
hsa-miR-429 uaauacugucugguaaaaccgu
hsa-miR-498 uuucaagccagggggcguuuuuc
hsa-miR-130a cagugcaauguuaaaagggcau
hsa-miR-30c-2 * cugggagaaggcuguuuacuc
hsa-miR-98 ugagguaguaaguuguauuguu
hsa-miR-1 uggaauguaaagaaguauguau
hsa-miR-106b uaaagugcugacagugcagau
hsa-miR-150 * cugguacaggccugggggacag
hsa-miR-25 cauugcacuugucucggucuga
hsa-miR-134 ugugacugguugaccagagggg
hsa-miR-328 cuggcccucucugcccuuccgu
hsa-miR-638 agggaucgcgggcggguggcggccu
hsa-miR-1225-5p guggguacggcccagugggggg
hsa-miR-1224-5p gugaggacucgggaggugg
hsa-miR-557 guuugcacgggugggccuugucu
[0180]
hsa-miR-15b uagcagcacaucaugguuuaca
hsa-miR-301a cagugcaauaguauugucaaagc
hsa-miR-196b uagguaguuuccuguuguuggg
hsa-miR-196a uagguaguuucauguuguuggg
hsa-miR-1226 * gugagggcaugcaggccuggaugggg
hsa-miR-424 cagcagcaauucauguuuugaa
hsa-miR-21 * caacaccagucgaugggcugu
hsa-miR-572 guccgcucggcgguggccca
hsa-miR-18b uaaggugcaucuagugcaguuag
hsa-miR-18a uaaggugcaucuagugcagauag
hsa-miR-9 * auaaagcuagauaaccgaaagu
hsa-miR-301b cagugcaaugauauugucaaagc
hsa-miR-29c uagcaccauuugaaaucgguua
hsa-miR-494 ugaaacauacacgggaaaccuc
hsa-miR-193b aacuggcccucaaagucccgcu
hsa-miR-375 uuuguucguucggcucgcguga
hsa-miR-26a uucaaguaauccaggauaggcu
hsa-miR-574-3p cacgcucaugcacacacccaca
hsa-miR-151-3p cuagacugaagcuccuugagg
hsa-miR-149 ucuggcuccgugucuucacuccc
hsa-miR-768-5p Bad entry!
hsa-miR-181a aacauucaacgcugucggugagu
hsa-miR-20a uaaagugcuuauagugcagguag
hsa-miR-181c aacauucaaccugucggugagu
hsa-miR-29a uagcaccaucugaaaucgguua
hsa-miR-29b uagcaccauuugaaaucaguguu
hsa-miR-505 cgucaacacuugcugguuuccu
hsa-miR-939 uggggagcugaggcucugggggug
hsa-miR-769-5p ugagaccucuggguucugagcu
hsa-miR-30c uguaaacauccuacacucucagc
hsa-miR-590-5p gagcuuauucauaaaagugcag
hsa-miR-671-5p aggaagcccuggaggggcuggag
hsa-miR-625 agggggaaaguucuauagucc
hsa-miR-652 aauggcgccacuaggguugug
hsa-miR-139-3p ggagacgcggcccuguuggagu
hsa-miR-28-5p aaggagcucacagucuauugag
hsa-miR-623 aucccuugcaggggcuguugggu
hsa-miR-221 agcuacauugucugcuggguuuc
hsa-miR-19a ugugcaaaucuaugcaaaacuga
hsa-miR-944 aaauuauuguacaucggaugag
hsa-miR-335 ucaagagcaauaacgaaaaaugu
hsa-miR-125a-5p ucccugagacccuuuaaccuguga
hsa-miR-551b gcgacccauacuugguuucag
hsa-let-7d * cuauacgaccugcugccuuucu
[0181]
hsa-miR-31 * ugcuaugccaacauauugccau
hsa-miR-362-5p aauccuuggaaccuaggugugagu
hsa-miR-181a * accaucgaccguugauuguacc
hsa-miR-940 aaggcagggcccccgcucccc
hsa-miR-30b * cugggagguggauguuuacuuc
hsa-miR-601 uggucuaggauuguuggaggag
hsa-miR-20b caaagugcucauagugcagguag
hsa-miR-202 agagguauagggcaugggaa
hsa-miR-218 uugugcuugaucuaaccaugu
hsa-miR-145 guccaguuuucccaggaaucccu
hsa-miR-140-3p uaccacaggguagaaccacgg
hsa-miR-126 ucguaccgugaguaauaaugcg
hsa-miR-126 * cauuauuacuuuugguacgcg
hsa-miR-30a uguaaacauccucgacuggaag
hsa-miR-143 ugagaugaagcacuguagcuc
hsa-miR-101 uacaguacugugauaacugaa
hsa-miR-140-5p cagugguuuuacccuaugguag
hsa-miR-30d uguaaacauccccgacuggaag
hsa-miR-224 caagucacuagugguuccguu
hsa-miR-9 ucuuugguuaucuagcuguauga
hsa-miR-200b uaauacugccugguaaugauga
hsa-miR-195 uagcagcacagaaauauuggc
hsa-miR-210 cugugcgugugacagcggcuga
hsa-miR-7 uggaagacuagugauuuuguugu
hsa-miR-21 uagcuuaucagacugauguuga
hsa-miR-17 caaagugcuuacagugcagguag
hsa-miR-128 ucacagugaaccggucucuuu
hsa-miR-141 uaacacugucugguaaagaugg
hsa-miR-142-5p cauaaaguagaaagcacuacu
hsa-miR-150 ucucccaacccuuguaccagug
hsa-miR-205 uccuucauuccaccggagucug
All miRNA sequences that this paper discloses all have been kept at (http://microrna.sange r.ac.uk/ in the miRBase database; Also referring to Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).
Aspect the 5th, the present invention relates to for the identification of the diagnostic kit that shows or have the molecule marker of one or more Mammals target cell that the small cell lung cancer tendency occurs, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has small cell lung cancer or the small cell lung cancer occurence tendency is arranged.
The expression of nucleic acid feature that this paper limits can comprise at least 116 kinds of nucleic acid molecule, preferably at least 16 kinds of nucleic acid molecule, particularly preferably at least 11 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-96 (SEQ ID NO:2), hsa-miR-144 (SEQ ID NO:3), hsa-miR-93 (SEQ ID NO:18), hsa-miR-106b (SEQ ID NO:28), hsa-miR-25 (SEQ ID NO:30), hsa-miR-15b (SEQ ID NO:38), hsa-miR-145 (SEQ ID NO:58), hsa-miR-375 (SEQ ID NO:90), hsa-miR-103 (SEQ ID NO:91), hsa-miR-20a (SEQ ID NO:98), hsa-miR-107 (SEQ ID NO:129), hsa-miR-451 (SEQ ID NO:4), hsa-miR-130b (SEQ ID NO:7), hsa-miR-454 (SEQ ID NO:39), hsa-miR-30a (SEQ ID NO:56), hsa-miR-17 (SEQ ID NO:74), hsa-miR-183 (SEQ ID NO:1), hsa-miR-486-5p (SEQ ID NO:6), hsa-miR-338-3p (SEQ ID NO:7), hsa-miR-139-5p (SEQ ID NO:8), hsa-miR-30a *(SEQ ID NO:10), hsa-miR-144 *(SEQ ID NO:11), hsa-miR-425 (SEQ ID NO:12), hsa-miR-133b (SEQ ID NO:13), hsa-miR-497 (SEQ ID NO:14), hsa-miR-182 (SEQ ID NO:15), hsa-miR-187 *(SEQ ID NO:16), hsa-miR-30b (SEQ ID NO:17), hsa-miR-145 *(SEQ ID NO:19), hsa-miR-429 (SEQ ID NO:20), hsa-miR-498 (SEQ ID NO:21), hsa-miR-200a (SEQ ID NO:22), hsa-miR-130a (SEQ ID NO:24), hsa-miR-30c-2 *(SEQ ID NO:25), hsa-miR-98 (SEQ ID NO:26), hsa-miR-1 (SEQ ID NO:27), hsa-miR-150 *(SEQ ID NO:29), hsa-miR-134 (SEQ ID NO:31), hsa-miR-328 (SEQ ID NO:32), hsa-miR-638 (SEQ ID NO:33), hsa-miR-200b *(SEQ ID NO:34), hsa-miR-1225-5p (SEQ ID NO:35), hsa-miR-1224-5p (SEQ ID NO:36), hsa-miR-557 (SEQ ID NO:37), hsa-miR-152 (SEQ ID NO:38), hsa-miR-301a, (SEQ ID NO:40), hsa-miR-100 (SEQ ID NO:42), hsa-miR-223 (SEQ ID NO:43), hsa-miR-196b (SEQ ID NO:44), hsa-miR-1226 *(SEQ ID NO:46), hsa-miR-572 (SEQ ID NO:49), hsa-miR-18b (SEQ ID NO:50), hsa-miR-9 *(SEQ ID NO:52), hsa-miR-301b (SEQ ID NO:53), hsa-miR-199b-3p (SEQ ID NO:65), hsa-miR-34a (SEQ ID NO:87), hsa-miR-200a *(SEQ ID NO:89), hsa-miR-26a (SEQ ID NO:92), hsa-miR-574-3p (SEQ ID NO:93), hsa-miR-768-5p (SEQ ID NO:96), hsa-miR-29a (SEQ ID NO:100), hsa-miR-29b (SEQ ID NO:101), hsa-miR-505 (SEQ ID NO:102), hsa-miR-939 (SEQ ID NO:103), hsa-miR-769-5p (SEQ ID NO:104), hsa-miR-625 (SEQ ID NO:108), hsa-miR-139-3p (SEQ ID NO:110), hsa-miR-19a (SEQ ID NO:114), hsa-miR-551b (SEQ ID NO:118), has-miR-362-5p (SEQ ID NO:121), hsa-miR-181a *(SEQ ID NO:122), hsa-miR-940 (SEQ ID NO:123), hsa-miR-601 (SEQ ID NO:125), hsa-miR-20b (SEQ ID NO:126), has-miR-23a (SEQ ID NO:130), hsa-miR-27a (SEQ ID NO:131), hsa-miR-199a-5p (SEQ ID NO:132), hsa-let-7i (SEQ ID NO:133), hsa-miR-19b (SEQ ID NO:134), hsa-miR-20a *(SEQ ID NO:135), hsa-miR-17 *(SEQ ID NO:136), hsa-miR-22 (SEQ ID NO:137), hsa-miR-340 *(SEQ ID NO:138), hsa-miR-214 (SEQ ID NO:139), hsa-miR-592 (SEQ ID NO:140), hsa-miR-335 *(SEQ ID NO:141), hsa-miR-29c *(SEQ ID NO:142), hsa-miR-421 (SEQ ID NO:143), hsa-miR-886-3p (SEQ ID NO:144), hsa-miR-16-2 *(SEQ ID NO:145), hsa-miR-135a (SEQ ID NO:146), hsa-miR-183 *(SEQ ID NO:147), hsa-miR-7-1 *(SEQ ID NO:148), hsa-miR-26b (SEQ ID NO:149), has-miR-455-3p (SEQ ID NO:150), hsa-miR-222 (SEQ ID NO:151), hsa-miR-95 (SEQ ID NO:152), hsa-miR-564 (SEQ ID NO:153), hsa-miR-636 (SEQ ID NO:154), hsa-miR-34b *(SEQ ID NO:155), hsa-miR-18a (SEQ ID NO:51), hsa-miR-126 (SEQ ID NO:54), hsa-miR-126 *(SEQ ID NO:55), hsa-miR-140-3p (SEQ ID NO:59), hsa-miR-101 (SEQ ID NO:60), hsa-miR-143 (SEQ ID NO:61), hsa-miR-140-5p (SEQ ID NO:62), hsa-miR-29c (SEQ ID NO:64), hsa-miR-199b-5p (SEQ ID NO:65), hsa-miR-125a-3p (SEQ ID NO:67), hsa-miR-9 (SEQ ID NO:68), hsa-miR-200b (SEQ ID NO:69), hsa-miR-210 (SEQ ID NO:71), hsa-miR-7 (SEQ ID NO:72), arbitrary or the multiple nucleic acids molecule of hsa-miR-128 (SEQ ID NO:75) and hsa-miR-106a (SEQ ID NO:82).
Particularly preferably, compare with described one or more control cells, hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR-454, hsa-miR-17, hsa-miR-183, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-200a, hsa-miR-98, hsa-miR-200b encode in described one or more target cell *, hsa-miR-301a, hsa-miR-196b, hsa-miR-505, hsa-miR-769-5p, hsa-miR-625, hsa-miR-19a, hsa-miR-362-5p, hsa-miR-20b, hsa-let-7i, has-miR-19b, hsa-miR-20a *, hsa-miR-17 *, hsa-miR-340 *, hsa-miR-592, hsa-miR-335 *, hsa-miR-421, hsa-miR-16-2 *, hsa-miR-135a, hsa-miR-183 *, hsa-miR-7-1 *, hsa-miR-95, hsa-miR-18a, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-128 and hsa-miR-106a arbitrary or multiple nucleic acids developed by molecule raise and coding hsa-miR-144, hsa-miR-145, hsa-miR-451, hsa-miR-30a, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, has-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-152, hsa-miR-100, hsa-miR-223, hsa-miR-1226 *, hsa-miR-572, hsa-miR-18b, hsa-miR-9 *, hsa-miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a *, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-29a, hsa-miR-29b, hsa-miR-939, hsa-miR-139-3p, hsa-miR-551b, hsa-miR-181a *, hsa-miR-940, hsa-miR-601, hsa-miR-23a, hsa-miR-27a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-214, hsa-miR-29c *, hsa-miR-886-3p, hsa-miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR-564, hsa-miR-636, hsa-miR-34b *, hsa-miR-126, hsa-5miR-126 *, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p the down-regulated expression of arbitrary or multiple nucleic acids molecule.
The nucleotide sequence of above-mentioned miRNA is listed in table 5.
Table 5
miRNA Sequence (5' → 3')
hsa-miR-96 uuuggcacuagcacauuuuugcu
hsa-miR-144 uacaguauagaugauguacu
hsa-miR-451 aaaccguuaccauuacugaguu
hsa-miR-130b cagugcaaugaugaaagggcau
hsa-miR-93 caaagugcuguucgugcagguag
hsa-miR-25 cauugcacuugucucggucuga
[0191]
hsa-miR-15b uagcagcacaucaugguuuaca
hsa-miR-454 uagugcaauauugcuuauagggu
hsa-miR-375 uuuguucguucggcucgcguga
hsa-miR-103 agcagcauuguacagggcuauga
hsa-miR-107 agcagcauuguacagggcuauca
hsa-miR-183 uauggcacugguagaauucacu
hsa-miR-486-5p uccuguacugagcugccccgag
hsa-miR-338-3p uccagcaucagugauuuuguug
hsa-miR-139-5p ucuacagugcacgugucuccag
hsa-miR-30a * cuuucagucggauguuugcagc
hsa-miR-144 * ggauaucaucauauacuguaag
hsa-miR-425 aaugacacgaucacucccguuga
hsa-miR-133b uuugguccccuucaaccagcua
hsa-miR-497 cagcagcacacugugguuugu
hsa-miR-182 u uuggcaaugguagaacucacacu
hsa-miR-187 * ggcuacaacacaggacccgggc
hsa-miR-30b uguaaacauccuacacucagcu
hsa-miR-145 * ggauuccuggaaauacuguucu
hsa-miR-429 uaauacugucugguaaaaccgu
hsa-miR-498 uuucaagccagggggcguuuuuc
hsa-miR-200a uaacacugucugguaacgaugu
hsa-miR-130a cagugcaauguuaaaagggcau
hsa-miR-30c-2 * cugggagaaggcuguuuacuc
hsa-miR-98 ugagguaguaaguuguauuguu
hsa-miR-1 uggaauguaaagaaguauguau
hsa-miR-150 * cugguacaggccugggggacag
hsa-miR-134 ugugacugguugaccagagggg
hsa-miR-328 cuggcccucucugcccuuccgu
hsa-miR-638 agggaucgcgggcggguggcggccu
hsa-miR-200b * caucuuacugggcagcauugga
hsa-miR-1225-5p guggguacggcccagugggggg
hsa-miR-1224-5p gugaggacucgggaggugg
hsa-miR-557 guuugcacgggugggccuugucu
hsa-miR-152 ucagugcaugacagaacuugg
hsa-miR-301a cagugcaauaguauugucaaagc
hsa-miR-100 aacccguagauccgaacuugug
hsa-miR-223 ugucaguuugucaaauacccca
hsa-miR-196b uagguaguuuccuguuguuggg
hsa-miR-1226 * gugagggcaugcaggccuggaugggg
hsa-miR-572 guccgcucggcgguggccca
hsa-miR-18b uaaggugcaucuagugcaguuag
hsa-miR-9 * auaaagcuagauaaccgaaagu
hsa-miR-301b cagugcaaugauauugucaaagc
hsa-miR-199b-3p cccaguguuuagacuaucuguuc
[0192]
hsa-miR-34a uggcagugucuuagcugguugu
hsa-miR-200a * caucuuaccggacagugcugga
hsa-miR-26a uucaaguaauccaggauaggcu
hsa-miR-574-3p cacgcucaugcacacacccaca
hsa-miR-768-5p Bad entry
hsa-miR-29a uagcaccaucugaaaucgguua
hsa-miR-29b uagcaccauuugaaaucaguguu
hsa-miR-505 cgucaacacuugcugguuuccu
hsa-miR-939 uggggagcugaggcucugggggug
hsa-miR-769-5p ugagaccucuggguucugagcu
hsa-miR-625 agggggaaaguucuauagucc
hsa-miR-139-3p ggagacgcggcccuguuggagu
hsa-miR-19a ugugcaaaucuaugcaaaacuga
hsa-miR-551b gcgacccauacuugguuucag
hsa-miR-362-5p aauccuuggaaccuaggugugagu
hsa-miR-181a * accaucgaccguugauuguacc
hsa-miR-940 aaggcagggcccccgcucccc
hsa-miR-601 uggucuaggauuguuggaggag
hsa-miR-20b caaagugcucauagugcagguag
hsa-miR-23a aucacauugccagggau uucc
hsa-miR-27a uucacaguggcuaaguuccgc
hsa-miR-199a-5p cccaguguucagacuaccuguuc
hsa-let-7i ugagguaguaguuugugcuguu
hsa-miR-19b ugugcaaauccaugcaaaacuga
hsa-miR-20a * acugcauuaugagcacuuaaag
hsa-miR-17 * acugcagugaaggcacuuguag
hsa-miR-22 aagcugccaguugaagaacugu
hsa-miR-340 * uccgucucaguuacuuuauagc
hsa-miR-214 acagcaggcacagacaggcagu
hsa-miR-592 uugugucaauaugcgaugaugu
hsa-miR-335 * uuuuucauuauugcuccugacc
hsa-miR-29c * ugaccgauuucuccugguguuc
hsa-miR-421 aucaacagacauuaauugggcgc
hsa-miR-886-3p cgcgggugcuuacugacccuu
hsa-miR-16-2 * ccaauauuacugugcugcuuua
hsa-miR-135a uauggcuuuuuauuccuauguga
hsa-miR-183 * gugaauuaccgaagggccauaa
hsa-miR-7-1 * caacaaaucacagucugccaua
hsa-miR-26b uucaaguaauucaggauaggu
hsa-miR-455-3p gcaguccaugggcauauacac
hsa-miR-222 agcuacaucuggcuacugggu
hsa-miR-95 uucaacggguauuuauugagca
hsa-miR-564 aggcacggugucagcaggc
hsa-miR-636 ugugcuugcucgucccgcccgca
[0193]
hsa-miR-34b * uaggcagugucauuagcugauug
hsa-miR-106b uaaagugcugacagugcagau
hsa-miR-30a uguaaacauccucgacuggaag
hsa-miR-145 guccaguuuucccaggaaucccu
hsa-miR-17 caaagugcuuacagugcagguag
hsa-miR-20a uaaagugcuuauagugcagguag
hsa-miR-18a uaaggugcaucuagugcagauag
hsa-miR-126 ucguaccgugaguaauaaugcg
hsa-miR-126 * cauuauuacuuuugguacgcg
hsa-miR-140-3p uaccacaggguagaaccacgg
hsa-miR-101 uacaguacugugauaacugaa
hsa-miR-143 ugagaugaagcacuguagcuc
hsa-miR-140-5p cagugguuuuacccuaugguag
hsa-miR-29c uagcaccauuugaaaucgguua
hsa-miR-199b-5p cccaguguuuagacuaucuguuc
hsa-miR-125a-3p acaggugagguucuugggagcc
hsa-miR-9 ucuuugguuaucuagcuguauga
hsa-miR-200b uaauacugccugguaaugauga
hsa-miR-210 cugugcgugugacagcggcuga
hsa-miR-7 uggaagacuagugauuuuguugu
hsa-miR-128 ucacagugaaccggucucuuu
hsa-miR-106a aaaagugcuuacagugcagguag
All miRNA sequences that this paper discloses all have been kept at (http://microrna.sanger.ac.uk/ in the miRBase database; Also referring to Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).
Aspect the 6th, the present invention relates to the diagnostic kit for the molecule marker of difference nonsmall-cell lung cancer and small cell lung cancer, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has nonsmall-cell lung cancer or small cell lung cancer.
The expression of nucleic acid feature that this paper limits can comprise at least 17 kinds of nucleic acid molecule, preferably at least 8 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-375 (SEQ ID NO:90), hsa-miR-335 (SEQ ID NO:116), hsa-miR-23a (SEQ ID NO:130), hsa-miR-27a (SEQ ID NO:131), hsa-miR-22 (SEQ ID NO:137), hsa-miR-592 (SEQ ID NO:140), hsa-miR-135a (SEQ ID NO:146), hsa-miR-24 (SEQ ID NO:156), hsa-miR-454 (SEQ ID NO:39), hsa-miR-301a (SEQ ID NO:40), hsa-miR-199b-5p (SEQ ID NO:65), hsa-miR-9 (SEQ ID NO:68), hsa-miR-34a (SEQ ID NO:87), hsa-miR-199a-5p (SEQ ID NO:132), hsa-miR-335 *Arbitrary or the multiple nucleic acids molecule of (SEQ ID NO:141), hsa-miR-152 (SEQ ID NO:157) and hsa-miR-216b (SEQ ID NO:158).
Particularly preferably, compare with described one or more control cells, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-135a, hsa-miR-199b-5p, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-152 of encoding in described one or more target cell raises, and coding hsa-miR-375, hsa-miR-335, hsa-miR-592, hsa-miR-24, hsa-miR-454, hsa-miR-301a, hsa-miR-9, has-miR-335 *, hsa-miR-216b the down-regulated expression of arbitrary or multiple nucleic acids molecule.
The nucleotide sequence of above-mentioned miRNA is listed in table 6.
Table 6
miRNA Sequence (5' → 3')
hsa-miR-375 uuuguucguucggcucgcguga
hsa-miR-335 ucaagagcaauaacgaaaaaugu
hsa-miR-23a aucacauugccagggauuucc
hsa-miR-27a uucacaguggcuaaguuccgc
hsa-miR-22 aagcugccaguugaagaacugu
hsa-miR-592 uugugucaauaugcgaugaugu
hsa-miR-135a uauggcuuuuuauuccuauguga
hsa-miR-24 uggcucaguucagcaggaacag
hsa-miR-454 uagugcaauauugcuuauagggu
hsa-miR-301a cagugcaauaguauugucaaagc
hsa-miR-199b-5p cccaguguuuagacuaucuguuc
hsa-miR-9 ucuuugguuaucuagcuguauga
hsa-miR-34a uggcagugucuuagcugguugu
hsa-miR-199a-5p cccaguguucagacuaccuguuc
hsa-miR-335 * uuuuucauuauugcuccugacc
hsa-miR-152 ucagugcaugacagaacuugg
hsa-miR-216b aaaucucugcaggcaaauguga
All miRNA sequences that this paper discloses all have been kept at (http://microrna.sanger.ac.uk/ in the miRBase database; Also referring to Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).
Aspect the 7th, the present invention relates to for gland cancer lung cancer, the diagnostic kit of prognosis of squamous cell lung cancer or small cell lung cancer and other two kinds of molecule markers that distinguish, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is to have gland cancer lung cancer, the indication of prognosis of squamous cell lung cancer or small cell lung cancer.
The expression of nucleic acid feature that this paper limits can comprise at least 23 kinds of nucleic acid molecule, preferably at least 7 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-25 (SEQ ID NO:30), hsa-miR-205 (SEQ ID NO:79), hsa-miR-34a (SEQ ID NO:87), hsa-miR-375 (SEQ ID NO:90), hsa-miR-29a (SEQ ID NO:100), hsa-miR-27a (SEQ ID NO:131), hsa-miR-29b (SEQ ID NO:101), hsa-miR-93 (SEQ ID NO:18), hsa-miR-106b (SEQ ID NO:28), hsa-miR-15b (SEQ ID NO:38), hsa-miR-454 (SEQ ID NO:39), hsa-miR-301a (SEQ ID NO:40), hsa-miR-145 (SEQ ID NO:58), hsa-miR-29c (SEQ ID NO:64), hsa-miR-221 (SEQ ID NO:113), hsa-miR-335 (SEQ ID NO:116), hsa-miR-23a (SEQ ID NO:130), hsa-miR-199a-5p (SEQ ID NO:132), hsa-miR-22 (SEQ ID NO:137), hsa-miR-592 (SEQ ID NO:140), hsa-miR-95 (SEQ ID NO:152), hsa-miR-24 (SEQ ID NO:7156) and hsa-miR-92a (SEQ ID NO:160). arbitrary or multiple nucleic acids molecule.
Particularly preferably, compare with small cell lung cancer with prognosis of squamous cell lung cancer, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-34a, hsa-miR-29a, hsa-miR-29b, hsa-miR-145, hsa-miR-29c of encoding in gland cancer lung cancer raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-25, hsa-miR-93, hsa-miR-301a, hsa-miR-106b, hsa-miR-15b, has-miR-92a.Encode in gland cancer lung cancer the arbitrary of hsa-miR-205, hsa-miR-27a, hsa-miR-221 or multiple nucleic acids molecule are compared up-regulated with small cell lung cancer, compare down-regulated expression with prognosis of squamous cell lung cancer.The nucleic acid molecule of coding hsa-miR-375 is compared up-regulated with prognosis of squamous cell lung cancer in gland cancer lung cancer, compares down-regulated expression with small cell lung cancer.Compare with small cell lung cancer, arbitrary or the multiple nucleic acids developed by molecule of hsa-5miR-24, hsa-miR-23a, hsa-miR-22, hsa-miR-199a-5p of encoding in gland cancer lung cancer raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-592, hsa-miR-335, hsa-miR-95, hsa-miR-454.
The nucleotide sequence of above-mentioned miRNA is listed in table 7.
Table 7
miRNA Sequence (5' → 3')
hsa-miR-25 cauugcacuugucucggucuga
hsa-miR-205 uccuucauuccaccggagucug
hsa-miR-34a uggcagugucuuagcugguugu
hsa-miR-375 uuuguucguucggcucgcguga
hsa-miR-29a uagcaccaucugaaaucgguua
hsa-miR-29b uagcaccauuugaaaucaguguu
hsa-miR-27a uucacaguggcuaaguuccgc
hsa-miR-93 caaagugcuguucgugcagguag
hsa-miR-106b uaaagugcugacagugcagau
hsa-miR-15b uagcagcacaucaugguuuaca
hsa-miR-454 uagugcaauauugcuuauagggu
hsa-miR-301a cagugcaauaguauugucaaagc
hsa-miR-145 guccaguuuucccaggaaucccu
hsa-miR-29c uagcaccauuugaaaucgguua
hsa-miR-221 agcuacauugucugcuggguuuc
hsa-miR-335 ucaagagcaauaacgaaaaaugu
hsa-miR-23a aucacauugccagggauuucc
hsa-miR-199a-5p cccaguguucagacuaccuguuc
hsa-miR-22 aagcugccaguugaagaacugu
hsa-miR-592 uugugucaauaugcgaugaugu
hsa-miR-95 uucaacggguauuuauugagca
hsa-miR-24 uggcucaguucagcaggaacag
hsa-miR-92a uauugcacuugucccggccugu
All miRNA sequences that this paper discloses all have been kept at (http://microrna.sanger.ac.uk/ in the miRBase database; Also referring to Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).
In eight aspect, the present invention relates to the diagnostic kit for the molecule marker of distinguishing gland cancer lung cancer and prognosis of squamous cell lung cancer, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule encoding microrna sequences, one or more of wherein said multiple nucleic acids molecule target cell and in one or more control cells differential expression, and the nucleic acid molecule of wherein said one or more differential expression represents a kind of expression of nucleic acid feature together, and this expression of nucleic acid feature is the indication that has gland cancer lung cancer or prognosis of squamous cell lung cancer.
The expression of nucleic acid feature that this paper limits can comprise at least 14 kinds of nucleic acid molecule, preferably at least 8 kinds of nucleic acid molecule.
In preferred embodiments, described expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell to compare with one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell to compare with one or more control cells and is reduced.
In a more preferred embodiment, described expression of nucleic acid feature comprises coding hsa-miR-497 (SEQ ID NO:14), hsa-miR-93 (SEQ ID NO:18), hsa-miR-25 (SEQ ID NO:30), hsa-miR-29c (SEQ ID NO:64), hsa-miR-205 (SEQ ID NO:79), hsa-miR-375 (SEQ ID NO:90), hsa-miR-149 (SEQ ID NO:95), hsa-miR-29a (SEQ ID NO:100), hsa-miR-1 (SEQ ID NO:27), has-miR-15b (SEQ ID NO:38), hsa-miR-181c (SEQ ID NO:99), hsa-miR-29b (SEQ ID NO:101), hsa-miR-769-5p (SEQ ID NO:104) and hsa-miR-221 (SEQ ID NO:113). arbitrary or multiple nucleic acids molecule.
Particularly preferably, compare with described one or more control cells, arbitrary or the multiple nucleic acids developed by molecule of hsa-miR-497, hsa-miR-29c, hsa-miR-375, hsa-miR-29a, hsa-miR-1, hsa-miR-181c, hsa-miR-29b of encoding in described one or more target cell raises, and the down-regulated expression of the arbitrary or multiple nucleic acids molecule of coding hsa-miR-93, hsa-miR-25, hsa-miR-205, hsa-miR-149, hsa-miR-15b, hsa-miR-769-5p, hsa-miR-221.
The nucleotide sequence of above-mentioned miRNA is listed in table 8.
Table 8
miRNA Sequence (5' → 3')
hsa-miR-497 cagcagcacacugugguuugu
hsa-miR-93 caaagugcuguucgugcagguag
hsa-miR-25 cauugcacuugucucggucuga
hsa-miR-29c uagcaccauuugaaaucgguua
hsa-miR-205 uccuucauuccaccggagucug
hsa-miR-375 uuuguucguucggcucgcguga
hsa-miR-149 ucuggcuccgugucuucacuccc
hsa-miR-29a uagcaccaucugaaaucgguua
hsa-miR-1 uggaauguaaagaaguauguau
hsa-miR-15b uagcagcacaucaugguuuaca
[0221]
hsa-miR-181c aacauucaaccugucggugagu
hsa-miR-29b uagcaccauuugaaaucaguguu
hsa-miR-769-5p ugagaccucuggguucugagcu
hsa-miR-221 agcuacauugucugcuggguuuc
All miRNA sequences that literary composition discloses all have been kept at (http://microrna.sanger.ac.uk/ in the miRBase database; Also referring to Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).
Aspect the 9th, the present invention relates to a kind of method that shows or have one or more target cell that the lung cancer tendency occurs of identifying, described method comprises: (a) determine the expression level of multiple nucleic acids molecule in one or more target cell, every kind of nucleic acid molecule encoding microrna sequences; (b) expression level of definite described multiple nucleic acids molecule in one or more normal healthy controls cell; Reach one or more nucleic acid molecule of (c) from described multiple nucleic acids molecule, identifying differential expression in target cell and control cells by the separately expression level that compares in step (a) and obtain (b), the nucleic acid molecule of wherein said one or more differential expression has represented the expression of nucleic acid feature that this paper limits together, and this expression of nucleic acid feature is the indication that has lung cancer or the lung cancer occurence tendency is arranged.
In preferred embodiment of the present invention, described method is further used for distinguishing gland cancer lung cancer, prognosis of squamous cell lung cancer and the small cell lung cancer in the lung cancer.
Aspect the tenth, the present invention relates to the method for a kind of prevention or treatment lung cancer, described method comprises: described method comprises: the method that (a) limits with this paper is identified the expression of nucleic acid feature in one or more target cell; The expression of one or more nucleic acid molecule of the coding microrna sequences that (b) change comprises in described expression of nucleic acid feature in described one or more cell, described change is carried out in such a way, be that its expression of expressing the nucleic acid molecule that is raised in described one or more target cell is reduced, and its expression of expressing the nucleic acid molecule of being reduced in described one or more target cell is raised.
Term used herein " changes the expression of the nucleic acid molecule of coding miRNA sequence " and refers to any manipulation of specific nucleic acid molecule is changed with the expression level that causes described molecule, namely compares the corresponding miRNA that produces different amounts from the expression of " wild-type " (being unaltered contrast).Term used herein " different amount " had both comprised the high amount of comparing with unaltered contrast, also comprised lower amount.In other words, handling as herein defined can be the expression (namely particularly transcribing) of raising (namely activating) or downward modulation (namely suppressing) nucleic acid molecule.
In the present invention, the expression of one or more nucleic acid molecule of the coding microrna sequences that comprises in the expression of nucleic acid feature is changed by this way, be that its expression of expressing the nucleic acid molecule that is raised in described one or more target cell is reduced, and its expression of expressing the nucleic acid molecule of being reduced in described one or more target cell is raised.In other words, the change of expression of the specific nucleic acid molecule of coding miRNA sequence occurs with the antimode (anti-cyclical) with the regulating effect of described molecule in described one or more cancer target cell, with " overactivity " of disturbing the molecule that is raised in described one or more target cell and/or recover " defective is active " of the molecule reduced.
In a preferred embodiment of the inventive method, the expression of downward modulation nucleic acid molecule comprise will coding with imported in one or more target cell by the nucleic acid molecule of the sequence of the microrna sequences complementation of the nucleic acid molecule encoding reduced.
" complementation " nucleic acid molecule (this paper is also referred to as " antisense nucleic acid molecule ") that term used herein " complementary sequence " refers to import in the blood in one or more cell can form base pair with endogenous " justice is arranged " nucleic acid molecule that raises, preferred Watson-Crick base pair.
Two kinds of nucleic acid molecule (namely " justice being arranged " and " antisense " molecule) can be complete complementaries, and namely it does not contain any base mispairing and/or interpolation or disappearance Nucleotide.In other embodiments, these two kinds of molecules comprise one or more base mispairing or its Nucleotide sum different (because due to interpolation or disappearances).In other embodiments, " complementation " nucleic acid molecule comprise one section with " justice is arranged " nucleic acid molecule that raises at least ten continuous nucleotides of the sequence complete complementary that comprises.
" complementation " nucleic acid molecule (i.e. the nucleic acid molecule of the nucleotide sequence of the microrna sequences complementation of the nucleic acid molecule encoding of coding and downward modulation) can be DNA-or the RNA molecule of natural generation or the synthetic nucleic acid molecule that comprises one or more same type or one or more dissimilar modified nucleotide in its sequence.
For example, may comprise at least one ribonucleotide main chain unit and at least one deoxyribonucleotide main chain unit by this nucleic acid molecule.In addition, it is 2'-O-methyl group or 2'-O-methoxy group (being also referred to as 2'-O-methylates) that described nucleic acid molecule can contain one or more RNA backbone modifications, it prevents at substratum amplifying nucleic acid enzyme liberating, and importantly be that the kernel that also prevents the reticent mixture nuclease of RNA inducibility separates, cause the irreversible inhibition of miRNA.Another possible modification (its function equivalence methylates in 2'-O-) comprises locked nucleic acid (LNAs), representative contains the nucleic acid analog of one or more LNA nucleotide monomer, described monomer is simulated at RNA has locking bifuran sugar unit (referring to for example Orom in the sugared conformation, U.A.et al. (2006) Gene 372,137-141).
Developed recently another kind of miRNA expression silencing gene.These chemical engineering oligonucleotide that are called " antagomirs " are RNA molecules (Krutzfeldt, J.et al. (2005) Nature 438,685689) of 23 Nucleotide of strand of puting together with cholesterol.Select as another of this chemically modified oligonucleotide, produced as RNA from transgenosis, produce can be at the microRNA inhibitor of cells.These competitive inhibitors that are called " microRNA sponge (microRNA sponges) " are the transcripts of expressing from strong promoter, the a plurality of series combination site (Ebert that contains interested microRNA, M.S.et al. (2007) Nat.Methods 4,721-726).
In order to illustrate any potential association of the miRNA that identifies in the sample before carcinous or the cancer, can carry out the preparation function analysis about the evaluation of the combinable mRNA target sequence of described miRNA.Based on find miRNA both can participate in tumor suppressor also can participate in tumour occur (summary is referring to for example Esquela-Kerscher, A.and Slack, F.J (2006) is as front; Calin, G.A.and Croce, C.M. (2007) is as front; Blenkiron, C.and Miska, E.A. (2007) is as front), can infer that the mRNA target site of this miRNA comprises tumor suppressor gene and oncogene.
If nucleic acid molecule comprises the sequential element that contains relevant for transcribing and/or translate adjusting information, and this sequence " operably connects " in the nucleotide sequence of coded polypeptide, then claims this nucleic acid molecule to be " energy express nucleic acid molecule " or energy " so that nucleotide sequence expression ".Operably connect be wherein said adjusting sequential element with the sequence that is expressed (and/or sequence of expressing mutually) with energy so that the connection that the mode of genetic expression is connected.
For the definite character of the essential regulatory region of genetic expression can be different in different plant species, but these zones all comprise promotor usually, it contains two promotor per se, the DNA element that namely instructs the DNA element of transcription initiation and send translation initiation signal when being transcribed into RNA in prokaryotic organism.This promoter region generally includes the 5' non-coding region that participates in transcribing with translation initiation, as in prokaryotic organism-35/-10 box and Shine-Dalgarno element or the TATA box in eukaryotic cell, CAAT sequence and 5'-add the cap element.These zones also can comprise enhanser or prevent sub-element and translation signals and leader sequence with the specific compartment of natural polypeptides target in host cell.In addition, the 3' non-coding sequence can contain the regulatory element that participates in Transcription Termination, polyadenylation etc.Yet if the function of these terminator sequences in specific host cell is unsatisfactory, the signal that can be used in performance function in this cell replaces.
In addition, as defined herein the expression of nucleic acid molecule also can affect (as mentioned above) by the Nucleotide of for example exist modifying.For example, locked nucleic acid (LNA) monomer is considered to increase in the body the functional transformation period of miRNA for reticent active crucial miRNA-target duplex structure and (see for example Naguibneva by strengthening to the resistance of degraded and by stable, I.et al. (2006) Biomed.Pharmacother.60,633-638).
Therefore, the nucleic acid molecule of the present invention that is imported into the patient can comprise the adjusting sequence, preferred promoter sequence, the optional transcription termination sequence that also comprises.Described promotor can allow composing type or inducible gene expression.Suitable promotor comprises intestinal bacteria (E.coli) lacUV5 and tet (tsiklomitsin is replied) promotor, T7 promotor and SV40 promotor or CMV promotor.
Nucleic acid molecule of the present invention also can be included in carrier or other cloning vector such as plasmid, phagemid, phage, clay or the artificial chromosome.In preferred embodiments, described nucleic acid molecule is included in the carrier, particularly is included in the expression vector.This expression vector except the nucleotide sequence of the genetic constructs of above-mentioned adjusting sequence and coding as the present invention definition, can comprise derived from the selective marker that can select phenotype with control sequence and the cell of giving transfection that copies for the compatible species of the host of expression.Many suitable carriers known in the art and commercially available such as pSUPER and pSUPERIOR.
The tenth on the one hand, the present invention relates to be used to the pharmaceutical composition that prevents and/or treats lung cancer, described composition comprises one or more nucleic acid molecule, every kind of nucleic acid molecule encoding and this paper limit its express the nucleic acid molecule encoding that in patients with lung cancer, is raised at least part of complementation of microrna sequences sequence and/or limit corresponding to this paper its express the sequence of the microrna sequences of the nucleic acid molecule encoding of in patients with lung cancer, being reduced.
At last, aspect the 12, the present invention relates to described pharmaceutical composition for the preparation of the application in the medicine that prevents and/or treats lung cancer.
Within the scope of the present invention, suitable pharmaceutical composition comprises and is suitable for those compositions that oral, rectum, nose, part (comprising through containing clothes and hypogloeeis), peritonaeum and parenteral (comprising intramuscular, subcutaneous or intravenously) give, perhaps by sucking or be blown into those compositions that give.Can the part or general give.Preferably give by oral or intravenous route.Described preparation can be packaged as separate dosage units.
Pharmaceutical composition of the present invention comprises any pharmaceutical dosage forms that this area is determined; for example capsule, micro-capsule, cachet, pill, tablet, powder, pilule (pellet), many granular preparations (for example pearl, particle or crystal), aerosol, sprays, foam, solution, dispersion agent, tincture, syrup, elixir, suspension, water-in-oil emulsion such as ointment, and water external emulsion such as emulsion, lotion and face cream.
The preparation method who uses the acceptable composition of pharmacology and set up can be formulated as pharmaceutical composition (Gennaro with above-mentioned (" justice is arranged " and " antisense ") nucleic acid molecule, A.L.and Gennaro, A.R. (2000) Remington:The Science and Practice of Pharmacy, 20th Ed., Lippincott Williams﹠amp; Wilkins, Philadelphia, PA; Crowder, T.M.et al. (2003) A Guide to Pharmaceutical Particulate Science.Interpharm/CRC, Boca Raton, FL; Niazi, S.K. (2004) Handbook of Pharmaceutical Manufacturing Formulations, CRC Press, Boca Raton, FL).
For pharmaceutical compositions, can use the inorganic or organic excipients (being carrier) of pharmacy inertia.For preparation example such as pill, tablet, capsule or particle, can use for example lactose, talcum, stearic acid and salt thereof, fat, wax, solid or liquid polyol, natural oil or winterized stearin.For the production of solution, suspension, milk sap, aerosol mixture or before using reprovision comprise water, alcohol, glycerine, polyvalent alcohol and suitable mixture and vegetables oil thereof as the appropriate excipients of the powder of solution or aerosol mixture.
Described pharmaceutical composition also can contain additive, such as filling agent, wedding agent, moistening agent, glidant, stablizer, sanitas, emulsifying agent, and the material of other solvent or solubilizing agent or realization storage effect.The latter can be regarded as and nucleic acid molecule can be mixed in slowly-releasing or sustained release or the targeted system as in liposome, nano particle and the micro-capsule.
For the great majority tissue in the target body, need clinical feasible nothing wound strategy so that this pharmaceutical composition as defined herein is oriented to cell.In the past, certain methods has obtained great treatment benefit by the siRNA with Rational Dosage in intravenous injection enters mouse and primate body, and without obvious limiting toxicity.
A kind of method comprises the passerby's chain (miRNA with miRNA *Chain) with cholesterol or derivatives thereof/conjugate covalent coupling with promote by all over the absorption of the cell surface ldl receptor of expressing (Soutschek, J.et al. (2004) Nature 432,173-178).Perhaps, the oligonucleotide (LNA-antimiR) that the locked nucleic acid of unconjugated PBS-preparation is modified can be used for general carry (Elmen, J.et al. (2008) Nature 452,896-899).The method of the another kind of miRNA of conveying comprises to be used polyoxyethylene glycol to make the miRNA capsulation become specific liposome with the absorption that reduces scavenger cell and strengthens cycling time.These specific nucleic acid particles (stable nucleic acid-lipid granule or SNALP) effectively are delivered to miRNA liver and (and do not arrive other organ (Zimmermann; T.S.et al. (2006) Nature 441,111-114 is described)).In recent years, the novel lipid sample delivery of molecules that one class is called lipidoids (based on alkyl acrylate or alkyl-acrylamide and primary amine or the puting together addition of secondary amine and synthesize) has been described as the agent delivery (Akinc of RNAi therapeutical agent, A.et al. (2008) Nat.Biotechnol.26,561-569).
Further cell-specific target strategy comprises miRNA is mixed with a kind of fusion rotein, this fusion rotein is comprised of the targeting antibodies fragment that is connected with protamine, described protamine is the basic protein (Song that makes the DNA nucleation in the sperm and pass through charge bonded miRNA, E.et al. (2005) Nat.Biotechnol.23,709-717).Recently developed multiple modification and the change that above-mentioned basic carrying method is carried out.These technology are known in the art, and summarize at for example de Fougerolles A.et al. (2007) Nat.Rev.Drug Discov.6,443-453; Kim, D.H.and Rossi, J.J. (2007) Nat.Genet.8,173-184) in.
The present invention further describes by accompanying drawing and following embodiment, and described drawings and Examples just for the purpose of illustration special embodiment of the present invention, should not be construed as the meaning that limits by any way the scope of the invention.
Embodiment
Embodiment 1: sample collection and preparation
Differentiate that the main method step that shows the target cell of lung cancer in patient's sample is shown in Fig. 1.
126 tissue samples are taken between 2007 to 2009 the undergo surgery patients with lung cancer of excision in upper marine mountain hospital.Sample is processed after operation immediately, and with the suitableeest shear temperature (optimum cutting temperature, OCT) embedding, quick-frozen in liquid nitrogen is stored in-80 ° of C.Contiguous form healthy tissues (apart from tumour kitchen range 10m at least) is taken from same patients with lung cancer.The essential characteristic of these tumor samples is shown in Table 9.
Table 9
The essential characteristic of tumor sample among the present invention
Tissue samples Quantity
Normal lung tissue 44
Lung cancer
Gland cancer
36
Squamous cell carcinoma 30
Small cell lung cancer 16
Amount to 126
Patient's data (age, sex, image data, methods for the treatment of, other medical conditions, family history etc.) derives from hospital database and is used for mating collected different samples.The pathology follow is (for example by h and E (H﹠amp; E) histologic analysis that dyes and carry out) be used for clearly determining the morbid state of given sample and the consistent classification that guarantees sample.
Carry out the laser capture micro-dissections with specific isolation tumor cell group (about 200000 cells) to each cancer sample is optional.In brief, transparent transfer film is applied to the surface of tissue slice or sample.At microscopically, observe the thin tissue section that places on the slide glass, and the identification of cell group is to separate.When the cell of selecting is positioned at the center of field of view, activate the integrated Optics in Microscope device of near-infrared laser diode (near IR laser diode integral with the microscope optics).Pulse laser beam activates the spot (spot) on the transfer film, makes the cytogamy of this film and following selection.The transfer film that then will have the cell of combination is peeled off (Emmert-Buck, M.R.et al. (1996) .Science 274,998-1001 from described thin tissue section; Espina, V.et al. (2007) Expert Rev.Mol.Diagn.7,647-657).Basic as manufacturer's guidance system is for freezing microtome section and use laser capture microscope (Arcturus Veritas TMLaser Capture Microdissection Instrument (Molecular Devices, Inc., Sunnyvale, CA, USA) catches step.
Use mirVana TMMiRNA separating kit (Ambion, Inc., Austin, TX) instructs according to manufacturer and extract total RNA from tissue slice.Use NanoDrop 1000 spectrophotometers (NanoDrop Technologies, Waltham, MA) that concentration is carried out quantitatively.Use RNA 6000 Pico LabChip kit (Agilent Technologies, Santa Clara, CA) to carry out the quality control of RNA by 2100 biological analysers.
Embodiment 2: the analysis of miRNA express spectra in the sample
Use Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA) to instruct the optional miRNA that (difference) in the specific sample is expressed to carry out qualitative analysis according to manufacturer.This microarray comprises 723 from the Sanger database probe for human miRNA v.10.1.Total RNA (100ng) of any in the lung tissue that 136 LCM choose mixes mark as input (inputs) through Cy3.Micro-array chip scans with XDR Scan (PMT100, PMT5).Mark and hybridization all operate according to the specification sheets of Agilent miRNA microarray system (Agilent miRNA microarray system).
Repeatedly independent experiment is carried out in each measurement of 126 tissue samples, the mean value of each data separately that definite miRNA expression level representative obtains.
Embodiment 3: the data analysis of microarray data
By the raw data normalization method of using the Quantile method and using GeneSpring GX10 software known in the art (Agilent Technologies, Santa Clara, CA, USA) that monochromatic (CY3) hybridization is obtained.Among 723 miRNA of Agilent miRNA microarray, 296 miRNA are selected as the positive signal of subsequent analysis.
The analysis of miRNA differential expression.Use Fisher check (F-test) and identify respectively between normal lung tissue and lung cancer with non-paired t test again after Bonferroni is relevant, perhaps the differential expression of the miRNA of different classes of of lung cancer.The multiple that calculates expression signal between normal and tumor sample with normalized value changes.
The one-way analysis of variance (ANOVA) of using p value＜0.00001 is identified the differential expression of the miRNA between normal and different classes of cancerous lung tissue.The miRNA of differential expression is by the relevant hierarchical classification (Hierarchical clustering) that carries out of Pearson.
For specificity and the susceptibility of miRNA individuality as diagnostic marker, use MedCalc software respectively the miRNA individuality in normal tissue and the cancerous tissue carry out recipient's operating characteristics (ROC) tracing analysis.95% credibility interval is used for determining this feature.
For assess a specific miRNA in carcinous target cell with whether in the normal healthy controls cell, compare differential expression, use following standard:
(i) the p value (probable value)≤0.05 of the variation of expression level 〉=2 at least 50% tumor sample; And
(ii) p value≤0.05/295 (coefficient 295 is proofreaied and correct owing to Bonferroni, because on Agilent miRNA microarray 295 people miRNA positive signals).
If satisfy at least one in these standards, think that then described miRNA distinguishes differential expression in target cell and control cells.
Classification/anticipate: to anticipate (Tibshirani et al. (2002) .Proc Natl Acad Sci USA.99, the 6567-6572 of chip data; Http:// wwwstat.stanford.edu/ ~ tibs/PAM) distinguishes normal lung tissue and cancerous lung tissue, and each tissue subtype of lung cancer.Carry out the selection of cutoff value (respectively organizing gene) according to 10 times of cross validation accuracys.At the Working environment of WEKA software (under the http://www.cs.waikato.ac.nz/ ~ ml/weka/), the InfoGain method is used for selecting the feature of miRNA, and carries out the Multi-step classification algorithm to obtain the accuracy of classification with 10 times of these features of cross validation.The PAM signatures to predict person who obtains from WEKA will be combined and these miRNA will be carried out the Multi-step classification algorithm.
Embodiment 4: the proofing chip data
MiRNA expression data in order to verify that (and/or quantitatively) has chip to record according to manufacturer's operational requirement, has carried out the detection of quantitative RT-PCR with TaqMan MicroRNA probe (Applied Biosystems, Foster City, CA, USA).In brief, use the Taqman microRNA reverse transcription test kit of Applied Biosystem company to carry out reverse transcription.Add the total RNA of 100ng in each reaction system, 15ul reverse transcription reagent mixture, comprising 1 * reverse transcription damping fluid, 1 * dNTP, 4U RNase inhibitor and 50U MultiScribe Reverse Transcriptase.Reverse transcription reaction is finished in PCR instrument (Thermal cycler alpha engine, Bio-rad), and specific procedure is: 16 ° of C, 30 minutes; 42 ° of C, 30 minutes; 85 ° of C, 5 minutes.Quantitative PCR is finished according to the specifying of TaqMan Universal PCR Master Mix kit and and Taqman microRNA assays kits of Applied Biosystem company.The reverse transcription product that comprises 2ul in the reaction system, 1X TaqMan Universal PCR Master Mix, finish in Roch Light Cycling 480 instruments without AmpErase UNG and 1X TaqMan MicroRNA Assay mix.Real-time PCR, specific procedure is 96 ° of C, preheating in 5 minutes; 95 ° of C, 15 seconds; 60 ° of C, 45 or 50 circulations in 60 seconds.The Cp value carries software by Roch Light Cycling 480 instruments and carries out secondary derivatization method calculating gained.The absolute quantitation of miRNA obtains according to the Cp value of standard substance.17 miRNA in two different platforms resulting data relatively see Figure 11 for details.The healthy tissues that obtains and the signal ratio of tumor tissues dependency (R) in the different platform of Agilent miRNA chip platform and quantitative RT-PCR is 0.90.Data results shows that the miRNA signal that obtains is highly believable from Agilent miRNA chip platform.
Figure 11
Figure DEST_PATH_GDA00002443037600011
Embodiment 5: first aspect is confirmed the miRNA expression data of lung cancer
The miRNA of the lung cancer of affirmation described in a first aspect of the present invention expresses and can distinguish normal lung tissue and cancerous lung tissue, specifically sees table 10-11 for details.That table 10 is listed is the new miRNA that can distinguish normal lung tissue and cancerous lung tissue, and shown in the table 11 is the expression characteristics of these miRNA in lung cancer.In lung cancer among known 29 miRNA, the expression of 24 (82%) and in the past invention are arranged and the data delivered in expression be consistent.In form, " t " represents cancerous lung tissue, and " n " represents normal lung tissue.Wherein, preferred miRNA (SEQ ID NO:1 to the SEQ ID NO:7 in the table 10, and SEQ ID NO:54 to the SEQ ID NO:59 in the table 11) marks with runic.
Table 10
The new miRNA that can distinguish normal lung tissue and cancerous lung tissue
Figure BDA00002055920100631
Table 11
The expression of miRNA in the cancerous lung tissue of having reported
Figure BDA00002055920100641
The anticipate result that the miRNA that can distinguish normal lung tissue and cancerous lung tissue described in a first aspect of the present invention expresses specifically sees table 12-15 for details.Table 12 has shown the PAM classification of 10 times of cross validations.Table 13 has been listed the important miRNA that obtains with the WEKA algorithm and has been selected feature.Table 14 has shown the sort merge with two kinds of different calculation method gained.Table 15 has shown the characteristic of division of specific miRNA predictor in multiple calculation method.Preferred 7 miRNA (SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:54 to SEQ ID NO:1056, SEQ ID NO:58 and SEQ ID NO:59) mark with runic in table 14.
Table 12
The PAM mark of prediction lung cancer and normal lung tissue
Title The lung cancer mark The healthy tissues mark
hsa-miR-30a -0.3173 0.5914
hsa-miR-145 -0.1445 0.2693
hsa-miR-126 * -0.084 0.1565
hsa-miR-140-3p -0.0423 0.0788
Figure BDA00002055920100642
Table 13
The selection feature of important miRNA among the WEKA
Title Mean value Average order Characteristic value
hsa-miR-126 0.88+-0.019 1+-0 60
hsa-miR-183 0.785+-0.022 3.4+-0.8 141
hsa-miR-451 0.786+-0.034 4.2+-2.14 390
hsa-miR-126 * 0.78+-0.024 4.5+-1.2 61
hsa-miR-30a 0.768+-0.04 5.1+-2.95 274
hsa-miR-144 0.776+-0.018 5.2+-1.33 97
hsa-miR-96 0.752+-0.021 6.7+-1.55 717
hsa-miR-218 0.749+-0.02 7.1+-1.04 212
hsa-miR-486-5p 0.694+-0.024 9.4+-1.28 404
hsa-miR-200c 0.675+-0.029 10.9+-1.14 187
hsa-miR-338-3p 0.673+-0.048 10.9+-2.21 306
hsa-miR-140-3p 0.644+-0.075 11.9+-3.75 89
hsa-miR-145 0.643+-0.021 12.1+-1.22 99
Counter: weka.attributeSelection.InfoGainAttributeEval
Computation schema: 10 times of cross validations
Table 14
The sort merge of two kinds of different calculation method gained
Title PAM WEKA
hsa-miR-126 X
hsa-miR-126 * X X
hsa-miR-140-3p X X
hsa-miR-145 X X
hsa-miR-30a X X
hsa-miR-451 X
hsa-miR-183 X
hsa-miR-200c X
hsa-miR-338-3p X
hsa-miR-144 X
hsa-miR-218 X
hsa-miR-486-5p X
hsa-miR-96 X
Table 15
The characteristic of division of specific miRNA predictor in multiple calculation method
Figure BDA00002055920100651
Embodiment 6: second aspect is confirmed the miRNA data representation of nonsmall-cell lung cancer
The miRNA that confirms nonsmall-cell lung cancer (NSCLC) and normal lung tissue described in a second aspect of the present invention expresses, and specifically sees table 16-17 for details.That table 16 is listed is the new miRNA that can distinguish normal lung tissue and small cell lung cancer, and shown in the table 17 is the expression characteristics of these miRNA in NSCLC.In NSCLC among known 26 miRNA, the expression of 21 (81%) and in the past invention are arranged and the data delivered in expression be consistent.In form, " t " represents cancerous lung tissue, and " n " represents normal lung tissue.Wherein, preferred miRNA (the SEQ ID NO:1-SEQ ID NO:6 in the table 16, SEQ ID NO:8, SEQ ID NO:14, and SEQ ID NO:54 to SEQ ID NO:59 in the table 17) marks with runic.
Table 16
The new miRNA in nonsmall-cell lung cancer expresses
Table 17
The expression of miRNA in the cancerous lung tissue of having reported
Figure BDA00002055920100672
The anticipate result that the miRNA that can distinguish normal lung tissue and Non-Small Cell Lung Carcinoma described in a second aspect of the present invention expresses specifically sees table 18-21 for details.Table 18 has shown the PAM classification of 10 times of cross validations.Table 19 has been listed the important miRNA that obtains with the WEKA algorithm and has been selected feature.Table 20 has shown the sort merge with two kinds of different calculation method gained.Table 21 has shown the characteristic of division of specific miRNA predictor in multiple calculation method.Preferred 7 miRNA (SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:14, SEQ ID NO:54 to SEQ ID NO:59) mark with runic in table 21.
Table 18
The PAM mark of prediction nonsmall-cell lung cancer and normal lung tissue
Title The healthy tissues mark The NSCLC mark
hsa-miR-218 0.5167 -0.3444
hsa-miR-30a 0.4787 -0.3191
hsa-miR-140-3p 0.312 -0.208
hsa-miR-145 0.1928 -0.1285
hsa-miR-126 * 0.155 -0.1033
hsa-miR-497 0.0946 -0.063
Figure BDA00002055920100681
Table 19
Distinguish the selection feature of the important miRNA of nonsmall-cell lung cancer and normal lung tissue among the WEKA
Title Mean value Average order Characteristic value
hsa-miR-126 0.971+-0.003 1+-0 60
hsa-miR-218 0.864+-0.021 2.3+-0.64 212
hsa-miR-126 * 0.843+-0.028 3+-0.63 61
hsa-miR-183 0.81+-0.023 4.8+-1.47 141
hsa-miR-451 0.8+-0.029 5.5+-1.5 390
hsa-miR-144 0.791+-0.018 6.3+-1.27 97
hsa-miR-96 0.775+-0.031 7+-1.73 717
hsa-miR-200c 0.755+-0.035 8.1+-1.58 187
hsa-miR-30a 0.738+-0.04 8.9+-1.97 274
hsa-miR-140-3p 0.703+-0.044 10.8+-2.14 89
hsa-miR-497 0.693+-0.048 11.4+-2.11 420
hsa-miR-486-5p 0.69+-0.042 11.5+-2.01 404
hsa-miR-139-5p 0.647+-0.03 14.3+-2.53 88
Table 20
The sort merge of two kinds of different calculation method gained
Figure BDA00002055920100691
Table 21
The characteristic of division of specific miRNA predictor in multiple calculation method
Figure BDA00002055920100692
Embodiment 7: the third aspect is confirmed the miRNA expression data of gland cancer lung cancer
The miRNA that confirms gland cancer lung cancer (AC) and normal lung tissue described in a third aspect of the present invention expresses, and specifically sees table 22-23 for details.That table 22 is listed is the new miRNA that can distinguish normal lung tissue and gland cancer cancerous lung tissue, and shown in the table 23 is the expression characteristics of these miRNA in gland cancer lung cancer.In gland cancer lung cancer among known 17 miRNA, the expression of 16 (94%) and in the past invention are arranged and the data delivered in expression be consistent.In form, " t " represents cancerous lung tissue, and " n " represents normal lung tissue.Wherein, preferred miRNA (SEQ ID NO:1 to the SEQ ID NO:5 in the table 22, SEQ ID NO:41, SEQ ID NO:54 to the SEQ ID NO:57 in the table 23, SEQ ID NO:73) marks with runic.
Table 22
The new miRNA that can distinguish normal lung tissue and gland cancer cancerous lung tissue
Figure BDA00002055920100693
Figure BDA00002055920100701
Table 23
The expression of miRNA in the gland cancer cancerous lung tissue of having reported
Figure BDA00002055920100702
Figure BDA00002055920100711
The anticipate result that the miRNA that can distinguish normal lung tissue and gland cancer cancerous lung tissue described in a third aspect of the present invention expresses specifically sees table 24-27 for details.Table 24 has shown the PAM classification of 10 times of cross validations.Table 25 has been listed the important miRNA that obtains with the WEKA algorithm and has been selected feature.Table 26 has shown the sort merge with two kinds of different calculation method gained.Table 27 has shown the characteristic of division of specific miRNA predictor in multiple calculation method.Preferred 5 miRNA (SEQ ID NO:2, SEQ ID NO:54 to SEQ ID NO:57) mark with runic in table 26.
Table 24
The PAM mark of prediction gland cancer lung cancer and normal lung tissue
Figure BDA00002055920100712
Table 25
Distinguish the selection feature of the important miRNA of gland cancer lung cancer and normal lung tissue among the WEKA
Title Mean value Average order Characteristic value
hsa-miR-126 0.993+-0.002 1+-0 60
hsa-miR-218 0.845+-0.027 3.3+-1.27 212
hsa-miR-126 * 0.828+-0.037 4.2+-1.54 61
hsa-miR-96 0.804+-0.036 5+-1.26 717
hsa-miR-30a 0.813+-0.052 5.1+-2.84 274
hsa-miR-183 0.804+-0.036 5.8+-1.47 141
hsa-miR-135b 0.778+-0.038 6.6+-2.58 79
hsa-miR-200c 0.738+-0.046 8.6+-2.8 187
hsa-miR-144 0.746+-0.035 8.7+-2.19 97
hsa-miR-451 0.732+-0.054 9.2+-3.09 390
hsa-miR-148a 0.682+-0.063 12.5+-3.04 107
hsa-miR-625 0.657+-0.038 13+-1.41 601
hsa-miR-21 0.633+-0.049 14.2+-2.4 201
[0345] Table 26
The sort merge of two kinds of different calculation method gained
Title PAM WEKA
hsa-miR-96 X
hsa-miR-126 X
hsa-miR-126 * X
hsa-miR-30a X X
hsa-miR-218 X X
hsa-miR-21 X
hsa-miR-183 X
hsa-miR-144 X
hsa-miR-451 X
hsa-miR-200c X
hsa-miR-135b X
hsa-miR-148a X
hsa-miR-625 X
Table 27
The characteristic of division of specific miRNA predictor in multiple calculation method
Figure BDA00002055920100721
Embodiment 8: fourth aspect is confirmed the miRNA expression data of prognosis of squamous cell lung cancer
The miRNA that confirms prognosis of squamous cell lung cancer (SQ) and normal lung tissue described in a fourth aspect of the present invention expresses, and specifically sees table 28-29 for details.That table 28 is listed is the new miRNA that can distinguish normal lung tissue and prognosis of squamous cell lung cancer tissue, and shown in the table 28 is the expression characteristics of these miRNA in prognosis of squamous cell lung cancer.In prognosis of squamous cell lung cancer among known 24 miRNA, the expression of 19 (79%) and in the past invention are arranged and the data delivered in expression be consistent.In form, " t " represents cancerous lung tissue, and " n " represents normal lung tissue.Wherein, preferred miRNA (SEQ ID NO:3 to the SEQ ID NO:7SEQ ID NO:14 in the table 28, SEQ ID NO:57 to the SEQ ID NO:59 in the table 29) marks with runic.
Table 28: the new miRNA that can distinguish normal lung tissue and prognosis of squamous cell lung cancer tissue
Figure BDA00002055920100731
Figure BDA00002055920100741
Table 29
The expression of miRNA in the prognosis of squamous cell lung cancer tissue of having reported
Figure BDA00002055920100751
The anticipate result that the miRNA that can distinguish normal lung tissue and prognosis of squamous cell lung cancer tissue described in a fourth aspect of the present invention expresses specifically sees table 30-33 for details.Table 30 has shown the PAM classification of 10 times of cross validations.Table 31 has been listed the important miRNA that obtains with the WEKA algorithm and has been selected feature.Table 32 has shown the sort merge with two kinds of different calculation method gained.Table 33 has shown the characteristic of division of specific miRNA predictor in multiple calculation method.Preferred 9 miRNA (SEQ ID NO:3-SEQ ID NO:6, SEQ ID NO:14, SEQ ID NO:57 10 to SEQ ID NO:59) mark with runic in table 32.
Table 30
The PAM mark of prediction prognosis of squamous cell lung cancer and normal lung tissue
Figure BDA00002055920100752
Figure BDA00002055920100762
Table 31
Distinguish the selection feature of the important miRNA of prognosis of squamous cell lung cancer and normal lung tissue among the WEKA
Title Mean value Average order Characteristic value
hsa-miR-144 0.974+-0.002 2.9+-1.92 97
hsa-miR-486-5p 0.974+-0.002 3.6+-1.43 404
hsa-miR-451 0.974+-0.002 3.7+-1.79 390
hsa-miR-338-3p 0.974+-0.002 3.8+-1.94 306
hsa-miR-218 0.974+-0.002 3.8+-2.09 212
hsa-miR-126 0.974+-0.002 5.3+-2.28 60
hsa-miR-126 * 0.89+-0.028 8.3+-1.62 61
hsa-miR-30b 0.89+-0.028 8.4+-1.8 276
hsa-miR-103 0.89+-0.029 10.6+-2.84 23
hsa-miR-93 0.89+-0.029 10.7+-1.27 702
hsa-miR-143 0.884+-0.03 12.4+-4.54 95
hsa-miR-145 0.883+-0.031 12.8+-3.09 99
hsa-miR-30a 0.883+-0.03 13.3+-3.29 274
Table 32
The sort merge of two kinds of different calculation method gained
Title PAM WEKA
hsa-miR-144 X
hsa-miR-451 X
hsa-miR-200c X
hsa-miR-486-5p X
hsa-miR-338-3p X X
hsa-miR-497 X
hsa-miR-218 X
hsa-miR-145 X X
hsa-miR-140-3p X
hsa-miR-30b X
hsa-miR-93 X
hsa-miR-126 X
hsa-miR-126 * X
hsa-miR-30a X
hsa-miR-143 X
hsa-miR-103 X
[0371] Table 33
The characteristic of division of specific miRNA predictor in multiple calculation method
Figure BDA00002055920100771
The miRNA data representation of embodiment five aspects affirmation in 9: the small cell lung cancer
The miRNA that confirms small cell lung cancer (SCLC) and normal lung tissue described in a fifth aspect of the present invention expresses, and specifically sees table 34-35 for details.That table 34 is listed is the new miRNA that can distinguish normal lung tissue and small cell lung cancer, and shown in the table 35 is the expression characteristics of these miRNA in SCLC.In SCLC among known 21 miRNA, the expression of 20 (95%) and in the past invention are arranged and the data delivered in expression be consistent.In form, " t " represents cancerous lung tissue, and " n " represents normal lung tissue.Wherein, preferred miRNA (the SEQ ID NO:2 in the table 34～SEQ ID NO:4, SEQ ID NO:9, SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:90, SEQ ID NO:28 in SEQ ID NO:91 and SEQ ID NO:129 and the table 35, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:74 and SEQ ID NO:98) mark with runic.
Table 34
The new miRNA in small cell lung cancer expresses
Figure BDA00002055920100772
Figure BDA00002055920100781
Figure BDA00002055920100791
Table 35
The expression of miRNA in the small cell lung cancer of having reported
Figure BDA00002055920100792
The anticipate result that the miRNA that can distinguish normal lung tissue and small cell lung cancer described in a fifth aspect of the present invention expresses specifically sees table 36-39 for details.Table 36 has shown the PAM classification of 10 times of cross validations.Table 37 has been listed the important miRNA that obtains with the WEKA algorithm and has been selected feature.Table 38 has shown the sort merge with two kinds of different calculation method gained.Table 39 has shown the characteristic of division of specific miRNA predictor in multiple calculation method.Preferred 11 miRNA (SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:18, SEQ ID NO:28, SEQ ID NO:38, SEQ ID NO:58, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:9810and SEQ ID NO:129) in table 38, mark with runic.
Table 36
The PAM mark of prediction small cell lung cancer and normal lung tissue
Title The healthy tissues mark The small cell lung cancer mark
hsa-miR-107 -0.1539 0.4233
hsa-miR-25 -0.1487 0.409
hsa-miR-103 -0.1351 0.3714
hsa-miR-93 -0.1143 0.3143
hsa-miR-96 -0.1091 0.3001
hsa-miR-106b -0.1036 0.285
hsa-miR-15b -0.0164 0.045
Figure BDA00002055920100802
Table 37
Distinguish the selection feature of the important miRNA of small cell lung cancer and normal lung tissue among the WEKA
Title Mean value Average order Characteristic value
hsa-miR-145 0.836+-0.013 5+-3.41 99
hsa-miR-144 0.836+-0.013 5.2+-3.92 97
hsa-miR-103 0.836+-0.013 6+-3.13 23
hsa-miR-375 0.836+-0.013 6.3+-3.69 347
hsa-miR-20a 0.836+-0.013 7.1+-4.13 197
hsa-miR-130b 0.836+-0.013 7.7+-4.2 70
hsa-miR-30a 0.836+-0.013 8.6+-4.65 274
hsa-miR-454 0.836+-0.013 9.6+-4.43 394
hsa-miR-106b 0.836+-0.013 9.9+-4.37 28
hsa-miR-25 0.836+-0.013 10.3+-4.2 237
hsa-miR-15b 0.836+-0.013 10.3+-4.98 125
hsa-miR-451 0.836+-0.013 10.4+-4.43 390
hsa-miR-17 0.836+-0.013 10.6+-3.69 130
Table 38
The sort merge of two kinds of different calculation method gained
Title PAM WEKA
hsa-miR-96 X
hsa-miR-144 X
hsa-miR-93 X
hsa-miR-106b X X
hsa-miR-25 X X
hsa-miR-15b X X
hsa-miR-145 X
hsa-miR-375 X
hsa-miR-103 X X
hsa-miR-20a X
hsa-miR-107 X
hsa-miR-451 X
hsa-miR-130b X
hsa-miR-454 X
hsa-miR-30a X
hsa-miR-17 X
Table 39
The characteristic of division of specific miRNA predictor in multiple calculation method
Figure BDA00002055920100811
The miRNA data representation of small cell lung cancer and nonsmall-cell lung cancer is confirmed in 10: the six aspects of embodiment
The miRNA that confirms small cell lung cancer (SCLC) and nonsmall-cell lung cancer (NSCLC) described in a sixth aspect of the present invention expresses, and specifically sees table 40-43 for details.Table 40 has shown the PAM classification of 10 times of cross validations.Table 41 has been listed the important miRNA that obtains with the WEKA algorithm and has been selected feature.Table 42 has shown the sort merge with two kinds of different calculation method gained.Table 43 has shown the characteristic of division of specific miRNA predictor in multiple calculation method.Preferred 8 miRNA (SEQ ID NO:90, SEQ ID NO:116, SEQ ID NO:130, SEQ ID NO:131, SEQ ID NO:137, SEQ ID NO:140, SEQ ID NO:146and SEQ ID NO:156) mark with runic in table 42.
Table 40
The PAM mark of prediction small cell lung cancer and nonsmall-cell lung cancer
Title The NSCLC mark The SCLC mark
hsa-miR-375 -0.158 0.6519
hsa-miR-92a -0.0757 0.3125
hsa-miR-23a 0.0635 -0.2618
hsa-miR-454 -0.0605 0.2497
hsa-miR-335 -0.0585 0.2412
hsa-miR-24 0.0549 -0.2263
hsa-miR-301a -0.0287 0.1183
hsa-miR-135a -0.0227 0.0936
hsa-miR-27a 0.0106 -0.0439
hsa-miR-9 -0.008 0.0328
hsa-miR-592 -0.0078 0.0321
hsa-miR-216b -0.0009 0.0038
hsa-miR-22 0.0002 -0.0009
Figure BDA00002055920100821
Table 41
Distinguish the selection feature of the important miRNA of small cell lung cancer and acellular lung cancer among the WEKA
Figure BDA00002055920100831
Table 42
The sort merge of two kinds of different calculation method gained
Title PAM WEKA
hsa-miR-375 X X
hsa-miR-335 X X
hsa-miR-23a X X
hsa-miR-27a X X
hsa-miR-22 X X
hsa-miR-592 X X
hsa-miR-135a X X
hsa-miR-24 X X
hsa-miR-454 X
hsa-miR-301a X
hsa-miR-199b-5p X
hsa-miR-9 X
hsa-miR-34a X
hsa-miR-199a-5p X
hsa-miR-335 * X
hsa-miR-152 X
hsa-miR-216b X
Table 43
The characteristic of division of specific miRNA predictor in multiple calculation method
Figure BDA00002055920100832
The miRNA data representation of embodiment seven aspects affirmation in 11: the gland cancer, squamous cell carcinoma or small cell lung cancer
The miRNA that confirms gland cancer (AC), squamous cell carcinoma (SQ) or small cell lung cancer (SCLC) described in a seventh aspect of the present invention expresses, and specifically sees table 44-47 for details.Table 44 has shown the PAM classification of 10 times of cross validations.Table 45 has been listed the important miRNA that obtains with the WEKA algorithm and has been selected feature.Table 46 has shown the sort merge with two kinds of different calculation method gained.Table 47 has shown the characteristic of division of specific miRNA predictor in multiple calculation method.Preferred 7 miRNA (SEQ ID NO:30, SEQ ID NO:79, SEQ ID NO:87, SEQ ID NO:90, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:131) mark with runic in table 47.
Table 44
The PAM mark of prediction gland cancer, squamous cell carcinoma or small cell lung cancer
Title The gland cancer mark The SCLC mark The squamous cell carcinoma mark
hsa-miR-205 -0.0317 0 0.554
hsa-miR-375 0 0.4798 0
hsa-miR-25 -0.3066 0 0
hsa-miR-92a 0 0.2156 0
hsa-miR-93 -0.1945 0 0
hsa-miR-34a 0.1718 0 0
hsa-miR-29c 0.1691 0 0
hsa-miR-23a 0 -0.1452 0
hsa-miR-27a 0 -0.0614 0.1239
hsa-miR-24 0 -0.116 0
hsa-miR-29b 0.1119 0 0
hsa-miR-454 0 0.0872 0
hsa-miR-335 0 0.0709 0
hsa-miR-29a 0.059 0 0
hsa-miR-106b -0.0509 0 0
hsa-miR-301a 0 0.0073 0
hsa-miR-145 0.0068 0 0
Figure BDA00002055920100841
Table 45
Distinguish the selection feature of the important miRNA of gland cancer, squamous cell carcinoma or small cell lung cancer among the WEKA
Figure BDA00002055920100842
Figure BDA00002055920100851
Table 46
The sort merge of two kinds of different calculation method gained
Title PAM WEKA
hsa-miR-25 X X
hsa-miR-205 X X
hsa-miR-34a X X
hsa-miR-375 X X
hsa-miR-29a X X
hsa-miR-29b X X
hsa-miR-27a X X
hsa-miR-93 X
hsa-miR-106b X
hsa-miR-15b X
hsa-miR-454 X
hsa-miR-301a X
hsa-miR-145 X
hsa-miR-29c X
hsa-miR-221 X
hsa-miR-335 X
hsa-miR-23a X
hsa-miR-199a-5p X
hsa-miR-22 X
hsa-miR-592 X
hsa-miR-95 X
hsa-miR-24 X
hsa-miR-92a X
Table 47
The characteristic of division of specific miRNA predictor in multiple calculation method
Figure BDA00002055920100861
Embodiment confirms gland cancer and squamous cell carcinoma miRNA data representation in 12: the seven aspects
(miRNA of SQ expresses, and specifically sees table 48-51 for details to confirm gland cancer (AC), squamous cell carcinoma described in a seventh aspect of the present invention.Table 48 has shown the PAM classification of 10 times of cross validations.Table 49 has been listed the important miRNA that obtains with the WEKA algorithm and has been selected feature.Table 50 has shown the sort merge with two kinds of different calculation method gained.Table 51 has shown the characteristic of division of specific miRNA predictor in multiple calculation method.Preferred 8 miRNA (SEQ ID NO:14, SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:1579, SEQ ID NO:90, SEQ ID NO:95 and SEQ ID NO:100) mark with runic in table 52.
Table 49
The PAM mark of prediction gland cancer, squamous cell carcinoma
Title The AC mark The SQ mark
hsa-miR-205 -0.2566 0.3079
hsa-miR-25 -0.1618 0.1942
hsa-miR-93 -0.0677 0.0812
hsa-miR-29c 0.0174 -0.0209
Table 50
Distinguish the selection feature of the important miRNA of gland cancer, squamous cell carcinoma among the WEKA
Figure BDA00002055920100863
Table 51
The sort merge of two kinds of different calculation method gained
Title PAM WEKA
hsa-miR-497 X
hsa-miR-93 X
hsa-miR-25 X X
hsa-miR-29c X
hsa-miR-205 X X
hsa-miR-375 X
hsa-miR-149 X
hsa-miR-29a X
hsa-miR-1 X
hsa-miR-15b X
hsa-miR-181c X
hsa-miR-29b X
hsa-miR-769-5p X
hsa-miR-221 X
Table 52
The characteristic of division of specific miRNA predictor in multiple calculation method
Figure BDA00002055920100872
The result of gained has shown the comprehensively miRNA expression of high special adjusting in the lung cancer.The specificity miRNA of each subgroup is representing in the cancerous lung tissue unique miRNA express spectra, and they can not only show that the state that whether has cancer can also distinguish the lung cancer of different tissues hypotype.
Therefore, the expression signal of these miRNA not only can be confirmed the existence of lung cancer, can also enable a reliable risk assessment to the patient and maybe may be in the cancer last stage, and no matter whether this cancer last stage can make progress is infiltrating carcinoma.In other words, this defined miRNA expression signal can predictive disease progress, perhaps progress is had susceptibility for lung cancer.
Some aspects that are evaluated at of this cancer development risk have significant clinical importance.The discriminating of miRNA expression characteristic of the present invention provides unique molecule marker, so that stage detection of lung cancer (namely in the stage that can't detect malignant cell by in-situ techniques or microscopical analysis biopsy or excision material) in early days, thereby the lung cancer that is still can be treated significantly effectively.In addition, the prediction of cancer development can be used for instructing the treatment to showing the patient of pathology before the lung cancer carcinoma to determine.
Can suitably not exist in this present invention who describes for example under the condition of the special any factor that discloses of this paper, restriction and carry out.Therefore, such as term " comprise ", " comprising " " contain " etc. and should have broad sense and unrestricted.In addition, the term that this paper adopts and representation are used for describing the present invention and unrestricted meaning, and use these terms and representation not to have shown in the eliminating and any equivalent of described feature or the meaning of its part, but can recognize in the claim scope and can carry out various modifications to the present invention.Therefore, although should understand by embodiment and optional feature the present invention has been carried out special announcement, those skilled in the art can make amendment and change the present invention, this modification and changing within the scope of the present invention.
This paper extensively reaches and has briefly described the present invention.Each the narrower subordinate concept and the inferior upper set that fall in the upper description scope have also formed a part of the present invention.This comprises the negative restriction of removing any theme with conditioned disjunction from upper to upper description of the present invention, and whether the theme of no matter removing is quoted from this article especially.
Other embodiment is in following claim scope.In addition, when feature of the present invention or all respects were described with Ma Kushi prescription formula, those skilled in the art can recognize that the present invention also is described with any each member or member's subgroup mode of Ma Kushi group.
Figure IDA00002055920800011
Figure IDA00002055920800021
Figure IDA00002055920800031
Figure IDA00002055920800041
Figure IDA00002055920800051
Figure IDA00002055920800061
Figure IDA00002055920800071
Figure IDA00002055920800081
Figure IDA00002055920800091
Figure IDA00002055920800101
Figure IDA00002055920800131
Figure IDA00002055920800141
Figure IDA00002055920800151
Figure IDA00002055920800161
Figure IDA00002055920800181
Figure IDA00002055920800191
Figure IDA00002055920800211
Figure IDA00002055920800221
Figure IDA00002055920800231
Figure IDA00002055920800251
Figure IDA00002055920800261
Figure IDA00002055920800271
Figure IDA00002055920800281
Figure IDA00002055920800291
Figure IDA00002055920800301
Figure IDA00002055920800311

Claims (56)

1. for the identification of the molecule marker diagnostic kit of one or more Mammals target cell that shows or have the tendency of development lung cancer, described test kit comprises the multiple nucleic acids molecule, every kind of nucleic acid molecule microrna sequences of all encoding,
In the wherein said multiple nucleic acids molecule one or more described target cell and in one or more control cells differential expression, and
The nucleic acid molecule of wherein said one or more differential expression represents the expression of nucleic acid feature together, and described expression of nucleic acid feature is to have the indication of lung cancer and/or dissimilar lung cancer or have development lung cancer and/or the indication of dissimilar lung cancer tendency; And
Wherein said different lung cancer is comprised of gland cancer lung cancer, prognosis of squamous cell lung cancer and small cell lung cancer.
2. the test kit of claim 1, wherein said expression of nucleic acid feature can comprise at least 82 kinds of nucleic acid molecule, preferably at least 13 kinds of nucleic acid molecule, particularly preferably at least 7 kinds of nucleic acid molecule.
3. the test kit of claim 1-2, wherein said expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell with comparing in one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell with comparing in one or more control cells and is reduced.
4. each test kit of claim 1-3, wherein said expression of nucleic acid feature comprises coding hsa-miR-183, has-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, has-miR-218, hsa-miR-139-5p, hsa-miR-130b, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR-187 *, hsa-miR-30b, hsamiR-93, hsa-miR-145 *, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-625, has-miR-130a, hsa-miR-30c-2 *, hsa-miR-98, hsa-miR-1, hsa-miR-106b, hsa-miR-150 *, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b *, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-100, hsa-miR-223, hsa-miR-196b, hsa-miR-196a, hsa-miR-1226 *, hsa-miR-424, hsa-miR-21 *, hsa-miR-572, hsa-miR-18b, hsa-miR-18a, has-miR-9 *Hsa-miR-301b, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-224, hsa-miR-125a-3p, hsa-miR-9, has-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, has-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150, hsa-miR-205, hsa-miR-192, any one of hsa-miR-215 and hsa-miR-106a or multiple nucleic acids molecule.
5. the test kit of claim 4, wherein compare with described one or more normal control cells, in described one or more target cell, coding has-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, hsa-miR-425, hsa-miR-182, has-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, hsa-miR-98, hsa-miR-106b, has-miR-25, hsa-miR-200b *, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-135b, hsa-miR-196b, hsa-miR-196a, hsa-miR-424, hsa-miR-21 *, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *, hsa-miR-301b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205, hsa-miR-192, hsa-miR-215, hsa-miR-106a the expression of nucleic acid molecule raised and coding hsa-miR-451, hsa-miR-126, has-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-218, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, has-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-1226 *, hsa-miR-572,, the expression of any one or the multiple nucleic acids molecule of hsa-miR-101, hsa-miR-143, has-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p, has-miR-195, hsa-miR-142-5p and hsa-miR-150 reduced.
6. each test kit of claim 1-3, wherein said expression of nucleic acid feature comprises coding hsa-miR-183, hsa-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p and hsa-miR-218 nucleic acid molecule.
7. the test kit of claim 6, wherein compare with described one or more normal control cells, in described one or more target cell, the expression of the nucleic acid molecule of coding has-miR-183, hsa-miR-96 and hsa-miR-200c is raised, and encode hsa-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-14, hsa-miR-486-5p, hsa-miR-338-3p and hsa-miR-218 the expression of any one or multiple nucleic acids molecule reduced.
8. each test kit of claim 1-3, wherein said expression of nucleic acid feature comprises coding hsa-miR-183, has-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145 and hsa-miR-140-3p any one or multiple nucleic acids molecule.
9. the test kit of claim 8 is wherein compared with described one or more normal control cells, and in described one or more target cell, the expression of hsa-miR-183 is raised, and encode has-miR-451, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-145 and hsa-miR-140-3p the expression of any one or multiple nucleic acids molecule reduced.
10. the test kit of claim 1, wherein said lung cancer is nonsmall-cell lung cancer, comprises prognosis of squamous cell lung cancer and gland cancer lung cancer.
11. the test kit of claim 1 or 10, wherein said expression of nucleic acid feature can comprise at least 70 kinds of nucleic acid molecule, preferably at least 14 kinds of nucleic acid molecule, particularly preferably at least 9 kinds of nucleic acid molecule.
12. claim 1,10 or 11 test kit, wherein said expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell with comparing in one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell with comparing in one or more control cells and is reduced.
13. each test kit of claim 1 or 10-12, wherein said expression of nucleic acid feature comprise coding hsa-miR-183, has-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-139-5p, hsa-miR-338-3p, hsa-miR-130b, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, hsa-miR-182, hsa-miR-187 *, hsa-miR-30b, hsa-miR-93, has-miR-145 *, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-625, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-98, hsa-miR-1, hsa-miR-150 *, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b *, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-135b, hsa-miR-100, hsa-miR-424, hsa-miR-21 *, hsa-miR-30a *Hsa-miR-494, hsa-miR-193b, hsa-miR-99a, hsa-miR-335, hsa-miR-106b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, hsa-miR-29c, hsa-miR-224, has-miR-9, hsa-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150, hsa-miR-205, any one of hsa-miR-192 and hsa-miR-215 or multiple nucleic acids molecule.
14. the test kit of claim 13, wherein compare with described one or more normal control cells, in described one or more target cell, coding hsa-miR-183, hsa-miR-96, hsa-miR-200c, hsa-miR-130b, has-miR-425, hsa-miR-182, hsa-miR-93, hsa-miR-429, hsa-miR-200a, hsa-miR-625, has-miR-98, hsa-miR-25, hsa-miR-200b *, hsa-miR-135b, hsa-miR-424, hsa-miR-21 *, hsa-miR-494, hsa-miR-193b, hsa-miR-106b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-128, hsa-miR-141, hsa-miR-205, has-miR-192, hsa-miR-215 the expression of any one or multiple nucleic acids molecule raised and coding hsa-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-144, has-miR-486-5p and hsa-miR-139-5p, hsa-miR-338-3p, hsa-miR-144 *, hsa-miR-133b, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, hsa-miR-638, has-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-100, hsa-miR-30a *, hsa-miR-99a, hsa-miR-335, hsa-miR-140-5p, hsa-miR-101, hsa-miR-143, hsa-miR-30d, has-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 the expression of any one or multiple nucleic acids molecule reduced.
15. each test kit of claim 1 or 10-12, wherein said expression of nucleic acid feature comprise coding hsa-miR-183, has-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-96, hsa-miR-144, hsa-miR-200c, hsa-miR-486-5p and hsa-miR-139-5p any one or multiple nucleic acids molecule.
16. the test kit of claim 15, wherein compare with described one or more normal control cells, in described one or more target cell, the expression of any one of coding hsa-miR-183, hsa-miR-96, hsa-miR-200c or multiple nucleic acids molecule is raised, and encode has-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145, the expression of any one of hsa-miR-140-3p, hsa-miR-144, hsa-miR-486-5p and hsa-miR-139-5p or multiple nucleic acids molecule is reduced.
17. each test kit of claim 1 or 10-12, wherein said expression of nucleic acid feature comprise coding hsa-miR-183, has-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145 and hsa-miR-140-3p any one or multiple nucleic acids molecule.
18. the test kit of claim 17, wherein compare with described one or more normal control cells, in described one or more target cell, the expression of hsa-miR-183 is raised, and encode has-miR-451, hsa-miR-497, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-145 and hsa-miR-140-3p the expression of any one or multiple nucleic acids molecule reduced.
19. the test kit of claim 1, wherein said lung cancer are gland cancer lung cancer.
20. the test kit of claim 1 or 19, wherein said expression of nucleic acid feature can comprise at least 57 kinds of nucleic acid molecule, preferably at least 13 kinds of nucleic acid molecule, particularly preferably at least 5 kinds of nucleic acid molecule.
21. the test kit of claim 1 or 19-20, wherein said expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell with comparing in one or more control cells and is raised; And the nucleic acid molecule that comprises at least a coding microrna sequences, it is expressed in one or more target cell with comparing in one or more control cells and is reduced.
22. each test kit of claim 1 or 19-21, wherein said expression of nucleic acid feature comprise coding hsa-miR-96, has-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-21, hsa-miR-183, has-miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-130b, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, hsa-miR-497, hsa-miR-182, hsa-miR-180187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-429, hsa-miR-498, hsa-miR-200a, has-miR-130a, hsa-miR-30c-2 *, hsa-miR-134, hsa-miR-638, hsa-miR-200b *, hsa-miR-1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-424, hsa-miR-21 *, has-miR-99a, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a *, hsa-miR-375, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-224, has-miR-200b, hsa-miR-195, hsa-miR-210, hsa-miR-7, hsa-miR-141 and hsa-miR-192 any one or multiple nucleic acids molecule.
23. the test kit of claim 22, wherein compare with described one or more normal control cells, in described one or more target cell, coding hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625, hsa-miR-130b, hsa-miR-425, hsa-miR-182, has-miR-429, hsa-miR-200a, hsa-miR-200b *, hsa-miR-424, hsa-miR-21 *, hsa-miR-34a, hsa-miR-542-3p, hsa-miR-200a *, hsa-miR-375, hsa-miR-224, hsa-miR-200b, has-miR-210, hsa-miR-7, hsa-miR-141, hsa-miR-192 the expression of any one or multiple nucleic acids molecule raised and coding hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-134, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-557, hsa-miR-100, hsa-miR-223, hsa-miR-99a, hsa-miR-145, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-195 the expression of any one or multiple nucleic acids molecule reduced.
24. each test kit of claim 1 or 19-21, wherein said expression of nucleic acid feature comprise coding hsa-miR-96, has-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-218, hsa-miR-21, hsa-miR-183, has-miR-144, hsa-miR-451, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a and hsa-miR-625 any one or multiple nucleic acids molecule.
25. the test kit of claim 24, wherein compare with described one or more normal control cells, in described one or more target cell, coding hsa-miR-126, hsa-miR-126 are raised in the expression of any one of coding hsa-miR-96, hsa-miR-21, hsa-miR-183, hsa-miR-200c, hsa-miR-135b, hsa-miR-148a, hsa-miR-625 or multiple nucleic acids molecule *, hsa-miR-30a, hsa-miR-218, hsa-miR-144, hsa-miR-451 the expression of any one or multiple nucleic acids molecule reduced.
26. each test kit of claim 1 or 19-21, wherein said expression of nucleic acid feature comprise coding hsa-miR-96, has-miR-126, hsa-miR-126 *, hsa-miR-30a and hsa-miR-218 any one or multiple nucleic acids molecule.
27. the test kit of claim 26 is wherein compared with described one or more normal control cells, in described one or more target cell, the expression of hsa-miR-96 is raised, and coding has-miR-126, hsa-miR-126 *, hsa-miR-30a and hsa-miR-218 any one or multiple nucleic acids molecule expression reduced.
28. the test kit of claim 1, wherein said lung cancer are prognosis of squamous cell lung cancer.
29. the test kit of claim 1 or 28, wherein said expression of nucleic acid feature comprises at least 112 kinds of nucleic acid molecule, preferably at least 16 kinds of nucleic acid molecule, particularly preferably at least 9 kinds of nucleic acid molecule.
30. claim 1,28 or 29 test kit, wherein said expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell with comparing in one or more control cells and is raised; And comprising the nucleic acid molecule of at least a coding microrna sequences, it is expressed in one or more target cell with comparing in one or more control cells and is reduced.
31. each test kit of claim 1 or 28-30, wherein said expression of nucleic acid feature comprise coding hsa-miR-144, has-miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-93, hsa-miR-126, has-miR-126 *, hsa-miR-30a, hsa-miR-143, hsa-miR-103, hsa-miR-183, hsa-miR-96, has-miR-139-5p, hsa-miR-130b, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, hsa-miR-182, hsa-miR-187 *, hsa-miR-145 *, hsa-miR-429, hsa-miR-498, has-miR-130a, hsa-miR-30c-2 *, hsa-miR-98, hsa-miR-1, hsa-miR-106b, hsa-miR-150 *, hsa-miR-25, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, hsa-miR-1226 *, hsa-miR-424, hsa-miR-21 *, hsa-miR-572, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *, hsa-miR-301b, hsa-miR-29c *Hsa-miR-494, hsa-miR-193b, hsa-miR-375, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-151-3p, hsa-miR-149, hsa-miR-768-5p, has-miR-181a, hsa-miR-20a, hsa-miR-181c, hsa-miR-29a, hsa-miR-29b, hsa-miR-505, hsa-miR-939, hsa-miR-769-5p, hsa-miR-30c, hsa-miR-590-5p, hsa-miR-590-5p, has-miR-671-5p, hsa-miR-625, hsa-miR-652, hsa-miR-139-3p, hsa-miR-28-5p, hsa-miR-623, hsa-miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-335, hsa-miR-125a-5p, has-miR-551b, hsa-let-7d *, hsa-miR-31 *, hsa-miR-362-5p, hsa-miR-181a *, hsa-miR-940, hsa-miR-30b *, hsa-miR-601, hsa-miR-20b, hsa-miR-202, hsa-miR-101, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR195, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-142-5p, hsa-miR-150 and hsa-miR-205 any one or multiple nucleic acids molecule.
32. the test kit of claim 31, wherein compare with described one or more normal control cells, in described one or more target cell, coding hsa-miR-200c, hsa-miR-93, hsa-miR-103, hsa-miR-183, hsa-miR-96, hsa-miR-130b, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-98, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-301a, hsa-miR-196b, hsa-miR-196a, has-miR-424, hsa-miR-21 *, hsa-miR-18b, hsa-miR-18a, hsa-miR-9 *, hsa-miR-301b, has-miR-494, hsa-miR-193b, hsa-miR-151-3p, hsa-miR-149, hsa-miR-20a, hsa-miR-505, hsa-miR-769-5p, hsa-miR-590-5p, hsa-miR-590-5p, hsa-miR-625, hsa-miR-28-5p, hsa-miR-221, hsa-miR-19a, hsa-miR-944, hsa-miR-31 *, hsa-miR-362-5p, hsa-miR-20b, hsa-miR-224, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-21, hsa-miR-17, hsa-miR-128, hsa-miR-141, hsa-miR-205 the expression of any one or multiple nucleic acids molecule raised and coding hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, has-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-143, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-133b, has-miR-187 *, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-1226 *, hsa-miR-572, hsa-miR-29c *, hsa-miR-375, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-181a, hsa-miR-181c, has-miR-29a, hsa-miR-29b, hsa-miR-939, hsa-miR-30c, hsa-miR-671-5p, hsa-miR-652, hsa-miR-139-3p, hsa-miR-623, hsa-miR-335, hsa-miR-125a-5p, hsa-miR-551b, has-let-7d *, hsa-miR-181a *, hsa-miR-940, hsa-miR-30b *, hsa-miR-601, hsa-miR-202, hsa-miR-101, hsa-miR-140-5p, hsa-miR-30d, hsa-miR-29c, hsa-miR-195, hsa-miR-142-5p, hsa-miR-150 the expression of any one or multiple nucleic acids molecule reduced.
33. each test kit of claim 1 or 28-30, wherein said expression of nucleic acid feature comprise coding hsa-miR-144, has-miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-93, hsa-miR-126, has-miR-126 *, hsa-miR-30a, hsa-miR-143 and hsa-miR-103 any one or multiple nucleic acids molecule.
34. the test kit of claim 35, wherein compare with described one or more normal control cells, in described one or more target cell, the expression of any one of coding hsa-miR-200c, hsa-miR-93, hsa-miR-103 or multiple nucleic acids molecule is raised, and encode hsa-miR-144, hsa-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, has-miR-145, hsa-miR-140-3p, hsa-miR-30b, hsa-miR-126, hsa-miR-126 *, hsa-miR-30a, hsa-miR-143 the expression of any one or multiple nucleic acids molecule reduced.
35. each test kit of claim 1 or 28-30, wherein said expression of nucleic acid feature comprise any one or the multiple nucleic acids molecule of coding hsa-miR-144, has-miR-451, hsa-miR-200c, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145 and hsa-miR-140-3p.
36. the test kit of claim 35, wherein compare with described one or more normal control cells, in described one or more target cell, the expression of hsa-miR-200c is raised, and the expression of any one or the multiple nucleic acids molecule of coding hsa-miR-144, has-miR-451, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-497, hsa-miR-218, hsa-miR-145 and hsa-miR-140-3p is reduced.
37. the test kit of claim 1, wherein said lung cancer are small cell lung cancer.
38. the test kit of claim 1 or 37, wherein said expression of nucleic acid feature comprises at least 116 kinds of nucleic acid molecule, preferably at least 16 kinds of nucleic acid molecule, particularly preferably at least 11 kinds of nucleic acid molecule.
39. the test kit of claim 1,37-38, wherein said expression of nucleic acid feature comprises the nucleic acid molecule of at least a coding microrna sequences, and it is expressed in one or more target cell with comparing in one or more control cells and is raised; And comprising the nucleic acid molecule of at least a coding microrna sequences, it is expressed in one or more target cell with comparing in one or more control cells and is reduced.
40. each test kit of claim 1 or 37-39, wherein said expression of nucleic acid feature comprise coding hsa-miR-96, has-miR-144, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, has-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-451, hsa-miR-130b, has-miR-454, hsa-miR-30a, hsa-miR-17, hsa-miR-183, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a *, hsa-miR-144 *, hsa-miR-425, hsa-miR-133b, has-miR-497, hsa-miR-182, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-429, hsa-miR-498, hsa-miR-200a, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-98, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-200b *, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-152, hsa-miR-301a, hsa-miR-100, hsa-miR-223, hsa-miR-196b, hsa-miR-1226 *, hsa-miR-572, hsa-miR-18b, hsa-miR-9 *, hsa-miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a *, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-29a, hsa-miR-29b, hsa-miR-505, has-miR-939, hsa-miR-769-5p, hsa-miR-625, hsa-miR-139-3p, hsa-miR-19a, hsa-miR-551b, hsa-miR-362-5p, hsa-miR-181a *, hsa-miR-940, hsa-miR-601, hsa-miR-20b, hsa-miR-23a, hsa-miR-27a, hsa-miR-199a-5p, hsa-let-7i, hsa-miR-19b, hsa-miR-20a *, hsa-miR-17 *, hsa-miR-22, hsa-miR-340 *, hsa-miR-214, hsa-miR-592, hsa-miR-335 *, hsa-miR-29c *, hsa-miR-421, hsa-miR-886-3p, hsa-miR-16-2 *, hsa-miR-135a, has-miR-183 *, hsa-miR-7-1 *, hsa-miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR-95, hsa-miR-564, hsa-miR-636, hsa-miR-34b *, hsa-miR-18a, hsa-miR-126, hsa-miR-126 *, hsa-miR-140-3p, hsa-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-29c, has-miR-199b-5p, hsa-miR-125a-3p, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-128 and hsa-miR-106a any one or multiple nucleic acids molecule.
41. the test kit of claim 40, wherein compare with described one or more normal control cells, in described one or more target cell, coding hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR-350, hsa-miR-454, hsa-miR-17, hsa-miR-183, hsa-miR-425, hsa-miR-182, hsa-miR-429, hsa-miR-200a, hsa-miR-98, hsa-miR-200b *, hsa-miR-301a, hsa-miR-196b, hsa-miR-505, has-miR-769-5p, hsa-miR-625, hsa-miR-19a, hsa-miR-362-5p, hsa-miR-20b, hsa-let-7i, hsa-miR-19b, hsa-miR-20a *, hsa-miR-17 *, hsa-miR-340 *, hsa-miR-592, hsa-miR-335 *, hsa-miR-421, hsa-miR-16-2 *, hsa-miR-135a, hsa-miR-183 *, hsa-miR-7-1 *, hsa-miR-95, hsa-miR-18a, hsa-miR-9, hsa-miR-200b, hsa-miR-210, hsa-miR-7, hsa-miR-128 and hsa-miR-106a the expression of any one or multiple nucleic acids molecule raised and coding hsa-miR-144, hsa-miR-145, hsa-miR-451, has-miR-30a, hsa-miR-486-5p, hsa-miR-338-3p, hsa-miR-139-5p, hsa-miR-30a *, has-miR-144, hsa-miR-133b, hsa-miR-497, hsa-miR-187 *, hsa-miR-30b, hsa-miR-145 *, hsa-miR-498, hsa-miR-130a, hsa-miR-30c-2 *, hsa-miR-1, hsa-miR-150 *, hsa-miR-134, hsa-miR-328, hsa-miR-638, hsa-miR-1225-5p, hsa-miR-1224-5p, hsa-miR-557, hsa-miR-152, hsa-miR-100, hsa-miR-223, hsa-miR-1226 *, hsa-miR-572, hsa-miR-18b, hsa-miR-9 *, hsa-miR-301b, hsa-miR-199b-3p, hsa-miR-34a, hsa-miR-200a *, hsa-miR-26a, hsa-miR-574-3p, hsa-miR-768-5p, hsa-miR-29a, hsa-miR-29b, has-miR-939, hsa-miR-139-3p, hsa-miR-551b, hsa-miR-181a *, hsa-miR-940, hsa-miR-601, hsa-miR-23a, hsa-miR-27a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-214, has-miR-29c *, hsa-miR-886-3p, hsa-miR-26b, hsa-miR-455-3p, hsa-miR-222, hsa-miR-564, hsa-miR-636, hsa-miR-34b *, hsa-miR-126, hsa-miR-126 *, hsa-miR-140-3p, has-miR-101, hsa-miR-143, hsa-miR-140-5p, hsa-miR-29c, hsa-miR-199b-5p, hsa-miR-125a-3p the expression of any one or multiple nucleic acids molecule reduced.
42. each test kit of claim 1 or 37-39, wherein said expression of nucleic acid feature comprise any one or the multiple nucleic acids molecule of coding hsa-miR-96, has-miR-144, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, has-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-451, hsa-miR-130b, has-miR-454, hsa-miR-30a and hsa-miR-17.
43. the test kit of claim 42, wherein compare with one or more normal control cell, in described one or more target cell, coding hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a, hsa-miR-107, hsa-miR-130b, hsa-miR-454, the expression of any one of hsa-miR-17 or multiple nucleic acids molecule is raised, and coding hsa-miR-144, hsa-miR-145, hsa-miR-451, the expression of any one of hsa-miR-30a or multiple nucleic acids molecule is reduced.
44. each test kit of claim 1 or 37-39, wherein said expression of nucleic acid feature comprise any one or the multiple nucleic acids molecule of coding hsa-miR-96, hsamiR-144, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-145, hsa-miR-375, hsa-miR-103, hsa-miR-20a and hsa-miR-107.
45. the test kit of claim 44, wherein compare with described one or more normal control cells, in described one or more target cell, the expression of any one of coding hsa-miR-96, hsa-miR-93, hsa-miR-106b, hsa-miR-25, hsa-miR-15b, hsa-miR-375, hsa-miR-103, hsa-miR-20a and hsa-miR-107 or multiple nucleic acids molecule is raised, and the expression of any one or the multiple nucleic acids molecule of coding hsa-miR-144, hsa-miR-145 is reduced.
46. the test kit of claim 1-45 is further used for distinguishing nonsmall-cell lung cancer and small cell lung cancer, and
Wherein said expression of nucleic acid feature comprises coding hsa-miR-375, hsa-miR-335, hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-592, hsa-miR-135a, hsa-miR-24, hsa-miR-454, hsa-miR-301a, hsa-miR-199b-5p, hsa-miR-9, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-335 *, hsa-miR-152 and hsa-miR-216b any one or multiple nucleic acids molecule.
47. the test kit of claim 46, wherein compare with one or more control cells, in described one or more target cell, the expression of any one of coding hsa-miR-23a, hsa-miR-27a, hsa-miR-22, hsa-miR-135a, hsa-miR-199b-5p, hsa-miR-34a, hsa-miR-199a-5p, hsa-miR-152 or multiple nucleic acids molecule is raised, and coding hsa-miR-375, hsa-miR-335, hsa-miR-592, hsa-miR-24, hsa-miR-454, hsa-miR-301a, hsa-miR-9, hsa-miR-335 *, hsa-miR-216b the expression of any one or multiple nucleic acids molecule reduced.
48. the test kit of claim 1-47, be further used for gland cancer lung cancer, small cell lung cancer or prognosis of squamous cell lung cancer and other two kinds differentiate, and wherein said expression of nucleic acid feature comprises coding hsa-miR-25, hsa-miR-205, hsa-miR-34a, hsa-miR-375, hsa-miR-29a, hsa-miR-27a, hsa-miR-29b, hsa-miR-93, hsa-miR-106b, hsa-miR-15b, hsa-miR-454, hsa-miR-301a, hsa-miR-145, hsa-miR-29c, hsa-miR-221, hsa-miR-335, hsa-miR-23a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-592, hsa-miR-95, any one of has-miR-24 and hsa-miR-92a or multiple nucleic acids molecule.
49. the test kit of claim 48, wherein compare with prognosis of squamous cell lung cancer with small cell lung cancer, the expression of any one or multiple nucleic acids molecule of hsa-miR-34a, hsa-miR-29a, hsa-miR-29b, hsa-miR-145, hsa-miR-29c of encoding in gland cancer lung cancer is raised, and the expression of any one or the multiple nucleic acids molecule of coding hsa-miR-25, hsa-miR-93, hsa-miR-301a, hsa-miR-106b, has-miR-15b, hsa-miR-92a is reduced;
The expression of any one or multiple nucleic acids molecule of hsa-miR-205, hsa-miR-27a, hsa-miR-221 of encoding in gland cancer lung cancer is compared with small cell lung cancer and is raised, and is reduced and compare with prognosis of squamous cell lung cancer; The expression of hsa-miR-375 is compared with prognosis of squamous cell lung cancer and is raised in gland cancer lung cancer, is reduced and compare with small cell lung cancer;
Compare with small cell lung cancer, the expression of any one or multiple nucleic acids molecule of hsa-miR-24, hsa-miR-23a, hsa-miR-22, hsa-miR-199a-5p of encoding in gland cancer lung cancer is raised, and the expression of any one or the multiple nucleic acids molecule of coding hsa-miR-592, hsa-miR-335, hsa-miR-95, hsa-miR-454 is reduced.
50. the test kit of claim 1-49 is further used for distinguishing gland cancer lung cancer and prognosis of squamous cell lung cancer, and
Wherein said expression of nucleic acid feature comprises any one or the multiple nucleic acids molecule of coding hsa-miR-497, hsa-miR-93, hsa-miR-25, hsa-miR-29c, hsa-miR-205, hsa-miR-375, hsa-miR-149, hsa-miR-29a, hsa-miR-1, hsa-miR-15b, hsa-miR-181c, hsa-miR-29b, hsa-miR-769-5p and hsa-miR-221.
51. the test kit of claim 50, wherein compare with one or more control cells, in described one or more target cell, the expression of any one of coding hsa-miR-497, hsa-miR-29c, hsa-miR-375, hsa-miR-29a, hsa-miR-1, hsa-miR-181c, hsa-miR-29b or multiple nucleic acids molecule is raised, and the expression of any one or the multiple nucleic acids molecule of coding hsa-miR-93, hsa-miR-25, hsa-miR-205, has-miR-149, hsa-miR-15b, hsa-miR-769-5p, hsa-miR-221 is reduced.
52. for the identification of the method that shows or have one or more Mammals target cell of development lung cancer tendency, described method comprises:
(a) in described one or more target cell, determine the expression level of multiple nucleic acids molecule, every kind of nucleic acid molecule microrna sequences of all encoding;
(b) expression level of definite described multiple nucleic acids molecule in one or more control cells; And
(c) by the expression level separately of contrast acquisition in step (a) and (b) in, from described multiple nucleic acids molecule, identify in described target cell with described control cells in one or more nucleic acid molecule of differential expression,
The nucleic acid molecule of wherein said one or more differential expression represents the defined expression of nucleic acid feature in each such as claim 1-51 together, and described expression of nucleic acid feature is the indication that has the tendency of lung cancer or development lung cancer.
53. the method for claim 52 is further used for distinguishing the lung cancer that is selected from gland cancer lung cancer, prognosis of squamous cell lung cancer and small cell lung cancer.
54. be used for the method in one or more Mammals target cell prevention or treatment lung cancer, described method comprises:
(a) require the method for 52-53 in one or more target cell, to identify the expression of nucleic acid feature by right to use; And
The expression of one or more nucleic acid molecule of the coding microrna sequences that (b) change comprises in described expression of nucleic acid feature in described one or more cell, described change is carried out in such a way, be that its expression of expressing the nucleic acid molecule that is raised in described one or more target cell is reduced, and its expression of expressing the nucleic acid molecule of being reduced in described one or more target cell is raised.
55. be used for preventing and/or treating the pharmaceutical composition of one or more Mammals target cell lung cancer, described composition comprises one or more nucleic acid molecule, every kind of equal encoding sequence of nucleic acid molecule,
Described sequence with express such as each defined its of claim 1-54 as described at least part of complementation of microrna sequences of the nucleic acid molecule encoding that raised in one or more target cell,
And/or described sequence corresponding to express such as each defined its of claim 1-54 as described in the microrna sequences of the nucleic acid molecule encoding reduced in one or more target cell.
56. the pharmaceutical composition of claim 55 is for the preparation of the purposes in the medicine that prevents and/or treats lung cancer.
CN201080064797.1A 2009-12-24 2010-12-24 The compositions of micro-RNA expression analysis of spectrum and method for pulmonary carcinoma Active CN102892897B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201080064797.1A CN102892897B (en) 2009-12-24 2010-12-24 The compositions of micro-RNA expression analysis of spectrum and method for pulmonary carcinoma

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN2009075955 2009-12-24
CNPCT/CN2009/075955 2009-12-24
CN201080064797.1A CN102892897B (en) 2009-12-24 2010-12-24 The compositions of micro-RNA expression analysis of spectrum and method for pulmonary carcinoma
PCT/CN2010/080237 WO2011076143A1 (en) 2009-12-24 2010-12-24 Compositions and methods for microrna expression profiling of lung cancer

Publications (2)

Publication Number Publication Date
CN102892897A true CN102892897A (en) 2013-01-23
CN102892897B CN102892897B (en) 2016-08-03

Family

ID=47535592

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201080064797.1A Active CN102892897B (en) 2009-12-24 2010-12-24 The compositions of micro-RNA expression analysis of spectrum and method for pulmonary carcinoma

Country Status (1)

Country Link
CN (1) CN102892897B (en)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103224983A (en) * 2013-02-22 2013-07-31 上海大学 Application of miR-96 gene in non-small cell lung cancer
CN103602678A (en) * 2013-06-18 2014-02-26 潘世扬 Non-small cell lung cancer prognosis detection composition and applications thereof
CN103642914A (en) * 2013-11-29 2014-03-19 李春英 Plasma/serum circulation microRNA marker related to mlignnt melnom and application of marker
CN104698191A (en) * 2015-03-16 2015-06-10 复旦大学附属中山医院 Applications of CALML3 (Calmodulin-like 3), MLPH (Melanophilin), TMC5 (Transmembrane Channel-like) and SFTA3 (Surfactant Associated 3) in pathological diagnosis of squamous cell lung carcinoma and adenocarcinoma
CN104862395A (en) * 2015-05-12 2015-08-26 上海大学 Novel application of Hsa-miR-182 genes
CN105002177A (en) * 2014-04-22 2015-10-28 上海盛元生物技术有限公司 MicroRNA fingerprint for detecting liposarcomata, and application thereof
CN105412944A (en) * 2015-12-09 2016-03-23 上海大学 Effect of miR-451a cells in non-small cell lung cancer
CN105457041A (en) * 2015-12-09 2016-04-06 上海大学 Application of miR-26a in non-small cell lung cancer (NSCLC)
CN105497057A (en) * 2015-10-15 2016-04-20 中山大学 Application of small molecule non-coding RNA miR-100 in preparation of drugs for treatment of tumor surrounding type vascular liver cancer
CN106148538A (en) * 2016-08-09 2016-11-23 山东大学 MicroRNA mark group and the application in preparing evaluating breast cancer chemosensitivity test kit thereof
CN106367476A (en) * 2015-07-24 2017-02-01 复旦大学 Use of human MIR421 in preparation of preparations for diagnosing and treating prostate cancer
CN106554991A (en) * 2015-09-25 2017-04-05 中国航天员科研训练中心 Can be used for the blood miR-134 detection kits of coronary artery calcification diagnosis
CN106811543A (en) * 2017-03-31 2017-06-09 四川大学华西医院 A kind of combined detection kit of lung cancer miRNA marker
CN107043770A (en) * 2016-02-05 2017-08-15 华中农业大学 The related PBLC miRNA of one group of tuberculosis and its application
CN107502586A (en) * 2017-08-15 2017-12-22 青海七彩花生物科技有限公司 The application of a kind of non-coding RNA target and its inhibitor in the medicine for promoting mesenchymal stem cells MSCs Osteoblast Differentiation is prepared
CN108165546A (en) * 2017-03-23 2018-06-15 上海立迪生物技术股份有限公司 A kind of miRNA biomarker, composition and application thereof
CN108728543A (en) * 2018-06-22 2018-11-02 南阳师范学院 Detect the miRNA combination of brain metastasis and the kit containing the combination
CN108753962A (en) * 2018-05-14 2018-11-06 丽水市人民医院 Purposes of the hsa-miR-130a in non-small cell lung cancer prognosis
CN109777874A (en) * 2019-01-29 2019-05-21 上海长海医院 It is a kind of suitable for ductal adenocarcinoma of pancreas diagnosis and Index for diagnosis blood plasma excretion body miRNA marker and application
CN110878341A (en) * 2019-12-18 2020-03-13 苏州绘真医学检验有限公司 Primer group, kit and method for detecting blood exosome miRNA
CN111218513A (en) * 2020-04-24 2020-06-02 上海思路迪医学检验所有限公司 Peripheral blood extracellular vesicle microRNA biomarker for early diagnosis of lung cancer and application thereof
CN111676291A (en) * 2020-07-14 2020-09-18 徐州医科大学 miRNA marker for lung cancer risk assessment
WO2020220994A1 (en) * 2019-04-30 2020-11-05 觅瑞实验室私人有限公司 Microrna marker combination for diagnosing gastric cancer and diagnostic kit
CN114015764A (en) * 2014-04-10 2022-02-08 中国人民解放军总医院 System, method and establishment of method for IgA nephropathy detection
CN114045340A (en) * 2021-11-24 2022-02-15 湖州市中心医院 MicroRNA marker combination for lung cancer diagnosis and application thereof
CN114457160A (en) * 2022-03-03 2022-05-10 首都医科大学附属北京胸科医院 Application of miRNA (micro ribonucleic acid) molecule as early lung cancer detection marker

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070161004A1 (en) * 2004-05-28 2007-07-12 David Brown Methods and compositions involving microRNA
CN101386848A (en) * 2008-08-12 2009-03-18 南京大学 MiRNA with cell corpuscule as vector and preparation research approach thereof and application
WO2009036236A1 (en) * 2007-09-14 2009-03-19 The Ohio State University Research Foundation Mirna expression in human peripheral blood microvesicles and uses thereof
WO2009121070A1 (en) * 2008-03-28 2009-10-01 The Trustees Of Boston University Multifactorial methods for detecting lung disorders

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070161004A1 (en) * 2004-05-28 2007-07-12 David Brown Methods and compositions involving microRNA
WO2009036236A1 (en) * 2007-09-14 2009-03-19 The Ohio State University Research Foundation Mirna expression in human peripheral blood microvesicles and uses thereof
WO2009121070A1 (en) * 2008-03-28 2009-10-01 The Trustees Of Boston University Multifactorial methods for detecting lung disorders
CN101386848A (en) * 2008-08-12 2009-03-18 南京大学 MiRNA with cell corpuscule as vector and preparation research approach thereof and application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MIKO E,ET AL: "Differentially expressed microRNAs in small cell lung cancer", 《EXPERIMENTAL LUNG RESEARCH》 *
WILLIAM CS CHO ET AL: "Restoration of tumour suppressour ahs-miR-145 inhibits cancer cell growth in lung adenocarcinoma patients with epidermal growth factor receptor mutaion", 《EUROPEAN JOURNAL OF CANCER》 *
曹学武: "miR-155对A549细胞Wee1表达调控的研究", 《中国博士学位论文全文数据库》 *

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103224983A (en) * 2013-02-22 2013-07-31 上海大学 Application of miR-96 gene in non-small cell lung cancer
CN103602678B (en) * 2013-06-18 2016-02-10 潘世扬 Nonsmall-cell lung cancer prognosis detection composition and application thereof
CN103602678A (en) * 2013-06-18 2014-02-26 潘世扬 Non-small cell lung cancer prognosis detection composition and applications thereof
CN103642914A (en) * 2013-11-29 2014-03-19 李春英 Plasma/serum circulation microRNA marker related to mlignnt melnom and application of marker
CN114150049A (en) * 2014-04-10 2022-03-08 中国人民解放军总医院 System, method and establishment of method for IgA nephropathy detection
CN114150050A (en) * 2014-04-10 2022-03-08 中国人民解放军总医院 System, method and establishment of method for IgA nephropathy detection
CN114015764A (en) * 2014-04-10 2022-02-08 中国人民解放军总医院 System, method and establishment of method for IgA nephropathy detection
CN114150048A (en) * 2014-04-10 2022-03-08 中国人民解放军总医院 System, method and establishment of method for IgA nephropathy detection
CN105002177A (en) * 2014-04-22 2015-10-28 上海盛元生物技术有限公司 MicroRNA fingerprint for detecting liposarcomata, and application thereof
CN104698191A (en) * 2015-03-16 2015-06-10 复旦大学附属中山医院 Applications of CALML3 (Calmodulin-like 3), MLPH (Melanophilin), TMC5 (Transmembrane Channel-like) and SFTA3 (Surfactant Associated 3) in pathological diagnosis of squamous cell lung carcinoma and adenocarcinoma
CN104862395A (en) * 2015-05-12 2015-08-26 上海大学 Novel application of Hsa-miR-182 genes
CN106367476A (en) * 2015-07-24 2017-02-01 复旦大学 Use of human MIR421 in preparation of preparations for diagnosing and treating prostate cancer
CN106554991A (en) * 2015-09-25 2017-04-05 中国航天员科研训练中心 Can be used for the blood miR-134 detection kits of coronary artery calcification diagnosis
CN105497057B (en) * 2015-10-15 2019-01-15 中山大学 Small molecule non-coding RNA miR-100 is preparing the application in the drug for treating the wrap-around vascular group liver cancer of tumour
CN105497057A (en) * 2015-10-15 2016-04-20 中山大学 Application of small molecule non-coding RNA miR-100 in preparation of drugs for treatment of tumor surrounding type vascular liver cancer
CN105457041A (en) * 2015-12-09 2016-04-06 上海大学 Application of miR-26a in non-small cell lung cancer (NSCLC)
CN105412944A (en) * 2015-12-09 2016-03-23 上海大学 Effect of miR-451a cells in non-small cell lung cancer
CN107043770A (en) * 2016-02-05 2017-08-15 华中农业大学 The related PBLC miRNA of one group of tuberculosis and its application
CN107043770B (en) * 2016-02-05 2020-05-19 华中农业大学 Tuberculosis-related peripheral blood lymphocyte miRNA (micro ribonucleic acid) and application thereof
CN106148538A (en) * 2016-08-09 2016-11-23 山东大学 MicroRNA mark group and the application in preparing evaluating breast cancer chemosensitivity test kit thereof
CN106148538B (en) * 2016-08-09 2019-10-22 山东大学 MicroRNA marker group and its preparing the application in evaluating breast cancer chemosensitivity kit
CN108165546A (en) * 2017-03-23 2018-06-15 上海立迪生物技术股份有限公司 A kind of miRNA biomarker, composition and application thereof
CN106811543A (en) * 2017-03-31 2017-06-09 四川大学华西医院 A kind of combined detection kit of lung cancer miRNA marker
CN107502586B (en) * 2017-08-15 2018-05-22 深圳盛皓生物科技有限公司 A kind of application of non-coding RNA target and its inhibitor in the drug for promoting mesenchymal stem cell Osteoblast Differentiation is prepared
CN107502586A (en) * 2017-08-15 2017-12-22 青海七彩花生物科技有限公司 The application of a kind of non-coding RNA target and its inhibitor in the medicine for promoting mesenchymal stem cells MSCs Osteoblast Differentiation is prepared
CN108753962A (en) * 2018-05-14 2018-11-06 丽水市人民医院 Purposes of the hsa-miR-130a in non-small cell lung cancer prognosis
CN108728543A (en) * 2018-06-22 2018-11-02 南阳师范学院 Detect the miRNA combination of brain metastasis and the kit containing the combination
CN108728543B (en) * 2018-06-22 2021-12-28 南阳师范学院 MiRNA combination for detecting lung cancer brain metastasis and kit containing same
CN109777874A (en) * 2019-01-29 2019-05-21 上海长海医院 It is a kind of suitable for ductal adenocarcinoma of pancreas diagnosis and Index for diagnosis blood plasma excretion body miRNA marker and application
WO2020220994A1 (en) * 2019-04-30 2020-11-05 觅瑞实验室私人有限公司 Microrna marker combination for diagnosing gastric cancer and diagnostic kit
CN110878341A (en) * 2019-12-18 2020-03-13 苏州绘真医学检验有限公司 Primer group, kit and method for detecting blood exosome miRNA
CN111218513B (en) * 2020-04-24 2020-08-14 上海思路迪医学检验所有限公司 Peripheral blood extracellular vesicle microRNA biomarker for early diagnosis of lung cancer and application thereof
CN111218513A (en) * 2020-04-24 2020-06-02 上海思路迪医学检验所有限公司 Peripheral blood extracellular vesicle microRNA biomarker for early diagnosis of lung cancer and application thereof
CN111676291A (en) * 2020-07-14 2020-09-18 徐州医科大学 miRNA marker for lung cancer risk assessment
CN111676291B (en) * 2020-07-14 2021-04-13 徐州医科大学 miRNA marker for lung cancer risk assessment
CN114045340A (en) * 2021-11-24 2022-02-15 湖州市中心医院 MicroRNA marker combination for lung cancer diagnosis and application thereof
CN114045340B (en) * 2021-11-24 2024-03-15 湖州市中心医院 microRNA marker combination for lung cancer diagnosis and application thereof
CN114457160A (en) * 2022-03-03 2022-05-10 首都医科大学附属北京胸科医院 Application of miRNA (micro ribonucleic acid) molecule as early lung cancer detection marker

Also Published As

Publication number Publication date
CN102892897B (en) 2016-08-03

Similar Documents

Publication Publication Date Title
CN102892897B (en) The compositions of micro-RNA expression analysis of spectrum and method for pulmonary carcinoma
CN102439169B (en) Compositions and methods for micro-rna expession profiling of colorectal cancer
US10612026B2 (en) Pharmaceutical composition for treating cancer comprising microrna as active ingredient
US20190017122A1 (en) Mirnas as diagnostic biomarkers to distinguish benign from malignant thyroid tumors
US10030273B2 (en) MicroRNA expression in human peripheral blood microvesicles and uses thereof
CN102985558B (en) For composition and the method for the micro-RNA expression spectrum analysis of hepatocellular carcinoma
US20190276892A1 (en) Micrornas in neurodegenerative disorders
DK2883966T3 (en) miRNA fingerprints in the diagnosis of lung cancer
CN103930563B (en) For the method and apparatus predicting cancer return
WO2011076143A1 (en) Compositions and methods for microrna expression profiling of lung cancer
US20110107440A1 (en) Skin cancer associated micrornas
CN102782155B (en) Be used for composition and the method for the blood plasma micro-RNA expression analysis of spectrum of lung cancer
US20130065778A1 (en) MicroRNA Signatures Predicting Responsiveness To Anti-HER2 Therapy
EP2643479B1 (en) Methods and materials for classification of tissue of origin of tumor samples
WO2008029790A1 (en) Novel nucleic acid
CN103080334A (en) Micro-RNA biomarkers and methods for diagnosis of early colorectal carcinoma and high-grade adenoma
CN102892898A (en) Diagnostic kit including micro-rna biomarkers and used for diagnosis of hepatocellular carcinoma, and method
CN102933719B (en) Compositions and methods for microrna expession profiling in plasma of colorectal cancer
CN102770561B (en) Tissue-based micro-RNA methods for diagnosis of different subtypes of lung cancer
CN102770560A (en) Plasma-based micro-RNA biomarkers and methods for early detection of colorectal cancer
Miles Identifying dysregulated pathways and signatures associated with tumorigenesis and survival differences in cancer

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20210508

Address after: 200335 Building 1, Lane 268, Linxin Road, Changning District, Shanghai

Patentee after: SHANGHAI LABWAY CLINICAL LABORATORY Co.,Ltd.

Address before: 200433 No. 220, Handan Road, Shanghai, Yangpu District

Patentee before: FUDAN University

TR01 Transfer of patent right