CN115058514A - Application of preparation for detecting circular RNA and/or expression quantity of circular RNA in preparation of colorectal cancer diagnostic reagent - Google Patents

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to application of a preparation for detecting circular RNA and/or expression quantity of the circular RNA in preparation of a colorectal cancer diagnostic reagent. The invention takes the annular RNAhsa _ circ _0071106 and/or hsa _ circ _0000825 as a new colorectal cancer detection molecular marker, the marker is specifically reduced and expressed in cancer tissues of a colorectal cancer patient, the colorectal cancer diagnosis can be simply and quickly carried out by utilizing the molecular marker, and the molecular marker becomes an effective tool for colorectal cancer detection diagnosis, pathological grading, clinical staging and treatment curative effect judgment, and has good clinical application prospect.

Description

Application of preparation for detecting circular RNA and/or expression quantity of circular RNA in preparation of colorectal cancer diagnostic reagent

Technical Field

The invention belongs to the technical field of molecular markers, and particularly relates to application of a preparation for detecting circular RNA and/or expression quantity of the circular RNA in preparation of a colorectal cancer diagnostic reagent.

Background

Colorectal cancer (CRC) is a common malignancy of the digestive system with mortality rates that rank fourth in the world's disease, and 90 million people die of the disease each year. The incidence of CRC is expected to increase by 160% by 2030, with a new increase of 210 thousands of cases per year being expected, placing a serious economic burden on the health system and the whole society. Early detection and early treatment are the best way to improve the cure rate of colorectal cancer, and the sensitivity and specificity of the existing tumor markers CEA and CA19-9 in colorectal cancer diagnosis are not high enough; meanwhile, although the prior art also has related researches taking circular RNA as a detection marker, no reports of hsa _ circ _0071106 and hsa _ circ _0000825 related to colorectal cancer research are found, so that the increase of the detection marker of colorectal cancer and the enrichment of a colorectal cancer screening way have important significance for the prevention and treatment of colorectal cancer.

Disclosure of Invention

Based on the technical problems, the invention aims to provide application of a preparation for detecting circular RNA and/or expression quantity of the circular RNA in preparing a colorectal cancer diagnostic reagent and application of a preparation for detecting circular RNA and/or expression quantity of the circular RNA in preparing a colorectal cancer diagnostic reagent.

In order to achieve the above objects, the present invention provides use of a circular RNA comprising hsa _ circ _0071106 and/or hsa _ circ _0000825 and/or an agent for detecting the expression level of the circular RNA in the preparation of a diagnostic reagent for colorectal cancer;

the nucleotide sequence of the hsa _ circ _0071106 is shown in SEQ ID NO. 1;

the nucleotide sequence of hsa _ circ _0000825 is shown in SEQ ID NO. 2.

The invention provides a diagnostic reagent for colorectal cancer, which comprises specific primers designed aiming at circular RNA hsa _ circ _0071106 and/or hsa _ circ _ 0000825;

the specific primers of the hsa _ circ _0071106 are P1 and P2; the specific primers of hsa _ circ _0000825 are P3 and P4;

the nucleotide sequence of the P1 is shown as SEQ ID NO.3, the nucleotide sequence of the P2 is shown as SEQ ID NO.4, the nucleotide sequence of the P3 is shown as SEQ ID NO.5, and the nucleotide sequence of the P4 is shown as SEQ ID NO. 6.

Preferably, the diagnostic reagent further comprises a housekeeping gene GAPDH.

Preferably, specific primers for the housekeeping gene GAPDH include P5 and P6;

the nucleotide sequence of the P5 is shown as SEQ ID NO.7, and the nucleotide sequence of the P6 is shown as SEQ ID NO. 8.

The invention also provides a colorectal cancer diagnosis kit, which comprises the diagnosis reagent in the technical scheme.

The invention also provides application of the circular RNA and/or a preparation for detecting the expression quantity of the circular RNA in preparing a reagent for judging the treatment effect of colorectal cancer, wherein the circular RNA comprises hsa _ circ _0071106 and/or hsa _ circ _ 0000825;

the nucleotide sequence of the hsa _ circ _0071106 is shown in SEQ ID NO. 1;

the nucleotide sequence of hsa _ circ _0000825 is shown in SEQ ID NO. 2.

The present invention also provides an agent for judging the effect of colorectal cancer treatment, which comprises specific primers designed for circular RNAhsa _ circ _0071106 and/or hsa _ circ _ 0000825;

the specific primers of the hsa _ circ _0071106 are P1 and P2; the specific primers of the hsa _ circ _0000825 are P3 and P4;

the nucleotide sequence of the P1 is shown as SEQ ID NO.3, the nucleotide sequence of the P2 is shown as SEQ ID NO.4, the nucleotide sequence of the P3 is shown as SEQ ID NO.5, and the nucleotide sequence of the P4 is shown as SEQ ID NO. 6.

Has the advantages that:

the invention provides application of a preparation for detecting circular RNA and/or expression quantity of the circular RNA in preparing a colorectal cancer auxiliary diagnostic reagent, wherein the circular RNA hsa _ circ _0071106 and/or hsa _ circ _0000825 is used as a novel colorectal cancer detection molecular marker which is specifically expressed in the cancer tissue of a colorectal cancer patient in a down-regulation mode, and particularly the circular RNA hsa _ circ _0071106 and hsa _ circ _0000825 are used in combination, so that colorectal cancer samples can be screened more accurately; the molecular marker can be used for diagnosing the colorectal cancer simply and quickly, becomes an effective tool for detecting and diagnosing the colorectal cancer, grading pathology, staging clinic and judging the curative effect of treatment, and has good clinical application prospect.

Meanwhile, the invention adopts real-time quantitative PCR to determine the expression quantity of the circular RNA hsa _ circ _0071106 and/or hsa _ circ _0000825, and the fluorescent dye can simultaneously detect the target circular RNA and housekeeping gene without additionally designing a probe, thereby being economic and convenient and having important significance for further researching the biological mechanism of the circular RNA related to colorectal cancer.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments will be briefly described below.

FIG. 1 is a graph of fluorescence signals of hsa _ circ _0071106 and GAPDH in normal tissue and colorectal cancer tissue;

FIG. 2 is a graph of fluorescence signals of hsa _ circ _0000825 and GAPDH in normal tissue and colorectal cancer tissue;

FIG. 3 is a fluorescent quantitative RT-PCR validation of circ RNA aberrantly expressed in colorectal cancer tissues, where expression of hsa _ circ _0071106 was significantly down-regulated in an expanded specimen validation experiment (P < 0.001);

FIG. 4 is a fluorescent quantitative RT-PCR validation of circ RNA aberrantly expressed in colorectal cancer tissues, where expression of hsa _ circ _0000825 was significantly down-regulated in an expanded specimen validation experiment (P < 0.001);

FIG. 5 shows ROC curves generated by testing the levels of hsa _ circ _0071106 in the cancer tissues and their paracarcinoma tissues of 81 patients with colorectal cancer.

FIG. 6 is a ROC curve generated by measuring the levels of hsa _ circ _0000825 in the cancer tissues and the paracarcinoma tissues of 81 patients with colorectal cancer.

FIG. 7 shows ROC curves generated by measuring the levels of hsa _ circ _0071106 and hsa _ circ _0000825 in the cancer tissues and paracarcinoma tissues of 81 patients with colorectal cancer.

Detailed Description

The invention provides application of circular RNA and/or a preparation for detecting the expression quantity of the circular RNA in preparing a colorectal cancer diagnostic reagent, wherein the circular RNA comprises hsa _ circ _0071106 and/or hsa _ circ _ 0000825; the nucleotide sequence of the hsa _ circ _0071106 is shown in SEQ ID NO. 1; the nucleotide sequence of hsa _ circ _0000825 is shown in SEQ ID NO. 2.

The positioning of the circular RNA hsa _ circ _0071106 on the genome is as follows: chr4:148778703-148803083, the corresponding linear gene is ARHGAP10 (NM-024605.4), and the nucleotide sequence of the circular RNA is shown as SEQ ID NO. 1: 5'-GAAGAAAAAAAGAAGTTTGACAAAGAGACAGAAAAGAATTATAGTCTAATTGATAAACATTTGAATTTATCAGCAAAAAAGAAAGACTCACATTTACAAGAGGCAGATATCCAAGTAGAGCAGAACCGGCAACACTTCTATGAACTGTCTCTCGAGTATGTGTGTAAGCTGCAGGAAATCCAAGAAAGAAAGAAGTTTGAGTTTGTGGAACCTATGCTGTCATTTTTTCAGGGGATGTTTACCTTCTATCATCAGGGCCATGAACTTGCCAAAGACTTCAATCACTACAAAATGGAACTACAGATCAACATTCAGAATACACGGAATCGATTTGAAGGAACAAGGTCAGAAGTGGAAGAGCTCATGAACAAAATCAGACAGAATCCCAAGGACCACAAACGAGCAAGTCAGTTTACAGCCGAAGGCTACCTGTATGTCCAGGAAAAAAGGCCTGCTCCGTTTGGTTCCAGTTGGGTCAAACACTATTGCATGTATCGAAAAGCAGCAAAGAAGTTCAACATGATCCCATTTGAGCACAGATCTGGAGGGAAACTTGGGGACGGAGAGGTGTTCTTTTTGAAAGAATGTACCAAGAGGCATACTGACTCCATTGACAGAAGGTTTTGTTTTGACATAGAAGCTGCTGATCG-3' are provided.

The positioning of the circular RNA hsa _ circ _0000825 on the genome is as follows: chr18:8718421 and 8720494, the corresponding linear gene is CCDC165(NM _001378205.1), the nucleotide sequence of the circular RNA is shown as SEQ ID NO. 2: 5'-GATGAGTTAGATGAACTCCGTGCTGAGATGGAAGAGATGAGAGACAGTTATTTAGAGGAAGATGTTTACCAGCTGCAGGAACTTCGGCGAGAACTGGACCGCGCTAATAAAAACTGCCGAATCCTGCAGTACCGTCTTCGGAAAGCCGAGCAGAAAAGCCTGAAAGTGGCTGAGACGGGTCAGGTGGATGGTGAGCTTATTCGAAGCCTGGAGCAGGACTTGAAGGTAGCCAAAGATGTATCTGTCAGATTGCACCACGAACTTAAGACGGTGGAGGAAAAGCGCGCTAAAGCTGAGGATGAAAACGAAACTCTCCGACAGCAGATGATTGAAGTGGAAATATCCAAACAGGCCCTCCAGAATGAGCTGGAGAGACTGAAAGAG-3' are provided.

The circular RNA hsa _ circ _0071106, hsa _ circ _0000825 and the combination of the RNA hsa _ circ _0071106 and hsa _ circ _0000825 are specifically expressed and reduced in tumor tissues of colorectal cancer patients, and can be used as a novel molecular marker for colorectal cancer diagnosis.

The invention provides a diagnostic reagent for colorectal cancer, which comprises specific primers designed aiming at circular RNA hsa _ circ _0071106 and/or hsa _ circ _ 0000825; the specific primers of hsa _ circ _0071106 are P1 and P2; the specific primers of the hsa _ circ _0000825 are P3 and P4; the nucleotide sequence of the P1 is shown as SEQ ID NO. 3: 5'-AGGCATACTGACTCCATTGACA-3', respectively; the nucleotide sequence of the P2 is shown as SEQ ID NO. 4: 5'-TTTTCTTCCGATCAGCAGCT-3', respectively; the nucleotide sequence of the P3 is shown as SEQ ID NO. 5: 5'-AGAATGAGCTGGAGAGACTGA-3', respectively; the nucleotide sequence of the P4 is shown as SEQ ID NO. 6: 5'-CTCTTCCATCTCAGCACGGA-3' are provided. The specific primers of hsa _ circ _0071106 of the invention are P1 and P2 and/or the specific primer of hsa _ circ _0000825 are preferably also used for detecting the expression level of the circular RNA. The diagnostic reagent of the present invention preferably further comprises a housekeeping gene GAPDH, the specific primer of the GAPDH preferably comprises P5 and P6, and the nucleotide sequence of P5 is preferably shown in SEQ ID NO. 7: 5'-GGTCTCCTCTGACTTCAACA-3', respectively; the nucleotide sequence of the P6 is preferably shown as SEQ ID NO. 8: 5'-GTGAGGGTCTCTCTCTTCCT-3' are provided.

The invention also provides a colorectal cancer diagnosis kit, which comprises the diagnosis reagent in the technical scheme. The diagnostic kit of the present invention preferably further comprises 2 XQuantNova SYBR Green PCR Master Mix.

The invention also provides a diagnostic test using the aboveA method of using the agent or diagnostic kit for assisted diagnosis of colorectal cancer, said method comprising fluorescent quantitative PCR. Normalizing the level of circRNA by Ct values of the target gene and housekeeping gene in the fluorescent quantitative PCR process and the expression level of housekeeping gene GAPDH, calculating to obtain the relative expression levels of hsa _ circ _0071106 and hsa _ circ _0000825 in the tissue, and using 2 ^ΔCt The relative quantitation of PCR was calculated for hsa _ circ _0071106 and hsa _ circ _0000825 using the formula, where Δ _Ct1 ＝Ct hsa_circ_0071106-Ct GAPDH，Δ _Ct2 Ct hsa _ circ _0000825-Ct GAPDH. Relative quantitation of PCR for the hsa _ circ _0071106 biomarker in samples _Ct1 When the number is less than or equal to 6.84, the sample is regarded as a non-colorectal cancer sample; if the sample is greater than 6.84, the sample is regarded as colorectal cancer. Relative quantitation of PCR for the hsa _ circ _0000825 biomarker in samples _Ct2 When the number is less than or equal to 7.51, the sample is regarded as a non-colorectal cancer sample; if the sample is greater than 7.51, the sample is regarded as colorectal cancer.

The system of the fluorescent quantitative PCR is calculated by 20 mul, and preferably comprises 2 XQuantiNova SYBR Green PCR Master Mix 12 mul, template 1 mul, primers 1.4 mul and ddH ₂ O4.2. mu.l. The template is preferably cDNA obtained by reverse transcription of RNA extracted from colorectal normal tissues or tumor tissues of colorectal cancer patients. The method for extracting RNA is not particularly limited, and the RNA can be extracted by using a conventional kit method in the field.

The fluorescent quantitative PCR program of the invention preferably comprises: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 30s, and 40 cycles; enzyme denaturation at 95 ℃ for 15 s; annealing at 60 deg.C for 1 min; keeping the temperature at 4 ℃.

The fluorescence quantitative PCR method can be used for pathological grading and clinical staging of colorectal cancer patients besides being used for diagnosing whether colorectal cancer exists, and the specific method is preferably the same as the fluorescence quantitative PCR method, and is not repeated.

The invention also provides application of the circular RNA and/or a preparation for detecting the expression quantity of the circular RNA in preparing a reagent for judging the treatment effect of colorectal cancer, wherein the circular RNA comprises hsa _ circ _0071106 and/or hsa _ circ _ 0000825; the nucleotide sequence of the hsa _ circ _0071106 is shown in SEQ ID NO. 1; the nucleotide sequence of hsa _ circ _0000825 is shown in SEQ ID NO. 2. The application of the present invention is preferably the same as described above and will not be described further herein.

The present invention also provides an agent for judging the effect of colorectal cancer treatment, which comprises specific primers designed for the circular RNAs hsa _ circ _0071106 and/or hsa _ circ _ 0000825; the specific primers of the hsa _ circ _0071106 are P1 and P2; the specific primers of the hsa _ circ _0000825 are P3 and P4; the nucleotide sequence of the P1 is shown as SEQ ID NO.3, the nucleotide sequence of the P2 is shown as SEQ ID NO.4, the nucleotide sequence of the P3 is shown as SEQ ID NO.5, and the nucleotide sequence of the P4 is shown as SEQ ID NO. 6. The reagents according to the invention are preferably the same as those described above and will not be described in detail here.

In order to further illustrate the present invention, the following detailed description of the technical solutions provided by the present invention is made with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Detecting the expression of hsa _ circ _0071106 and hsa _ circ _0000825 in colorectal cancer tissue and normal colorectal tissue respectively

1. Chip analysis: the level of circ RNA in colorectal and normal tissues was examined using the Array of Human circ RNA Array (6X 7K) chip from Shanghai Kangcheng Bio.

2. Chip results: the difference between the expression levels of hsa _ circ _0071106 and hsa _ circ _0000825 in colorectal cancer tissue and normal tissue was 8.73 fold, and 8.37 fold, suggesting that hsa _ circ _0071106 and hsa _ circ _0000825 may function as cancer suppressor genes in colorectal cancer.

Example 2

Collecting normal colorectal tissues as a normal control group, and detecting circular RNA according to the following steps, wherein the method comprises the following steps:

a. collecting tissues: collecting colorectal cancer tissues and normal colorectal tissues in sterile freezing tubes added with RNA preservation solution respectively, and storing the tissues in an ultra-low temperature refrigerator at minus 80 ℃ when the tissues are not used in time;

b. releasing RNA: approximately 20mg of tissue was weighed into a 2ml centrifuge tube and placed on ice to add 1ml TRIzol. Fully homogenizing the tissue by using a handheld automatic homogenizer until no solid exists, standing for 10min at room temperature to fully release RNA in the tissue into the solution;

c. and (3) chloroform extraction: adding 0.2ml of trichloromethane, uniformly mixing by vortex oscillation, and standing at room temperature for 10 min; centrifuging at 13000rpm for 10min at 4 deg.C, separating the liquid, wherein the upper water phase is enriched with RNA, and carefully absorbing the upper water phase into 1.5ml RNase-free centrifuge tube;

d. and (3) isopropanol precipitation: adding isopropanol with the same volume, vortex, shaking, mixing, standing at 4 deg.C for 30min, centrifuging at 12000rpm at 4 deg.C for 10min, and removing supernatant;

e. washing with ethanol: adding 1ml 75% ethanol, mixing, centrifuging at 12000rpm at 4 deg.C for 5min, discarding supernatant, pouring, sucking with pipette, drying, adding appropriate amount of RNase-free water to dissolve precipitate to obtain total RNA extractive solution, storing at-80 deg.C, and detecting OD ₂₆₀ /OD ₂₈₀ The ratio is between 1.8 and 2.0, and the concentration is 516-1213 g/uL;

reverse transcription of RNA: e, reverse transcribing the RNA extracted in the step e by using a reverse transcription kit to obtain cDNA, and storing the cDNA at the temperature of minus 20 ℃ for later use;

g. real-time quantitative PCR detection by a fluorescent dye method: and f, preparing a reaction system from the cDNA obtained in the step f, and performing fluorescence quantitative PCR.

20 μ l fluorescent quantitative PCR system: 2 XQuantiNova SYBR Green PCR MasterMix 12. mu.l, template 1. mu.l, primers 1.4. mu.l each and ddH ₂ O 4.2μl。

The procedure is as follows: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 30s, and 40 cycles; enzyme denaturation at 95 ℃ for 15 s; annealing at 60 deg.C for 1 min; keeping the temperature at 4 ℃.

The results are shown in FIG. 1, and hsa _ circ _0071106 and GAPDH were efficiently amplified in both normal and colorectal tissues. By the formula Δ _Ct1 Positive is obtained from Ct hsa _ circ _0071106-Ct GAPDHDelta of normal tissue _Ct1 4.06; delta of colorectal cancer tissue _Ct 8.37, a significantly greater than that of normal tissue _Ct1 Values indicating that the expression level of hsa _ circ _0071106 in colorectal cancer tissue was lower than in normal colorectal tissue should be consistent with the results of the gene chip.

The results are shown in FIG. 2, and hsa _ circ _0000825 and GAPDH were efficiently amplified in both normal and colorectal tissues. From the formula Δ _Ct2 Ct hsa _ circ _0000825-Ct GAPDH.DELTA.for normal tissue _Ct2 5.34; delta of colorectal cancer tissue _Ct 9.38, a significantly greater than that of normal tissue _Ct2 Values indicating that the expression level of hsa _ circ _0000825 in colorectal cancer tissue was lower than in normal colorectal tissue should be consistent with the results of the gene chip.

Example 3

Colorectal cancer detection using hsa _ circ _0071106 and hsa _ circ _0000825 biomarkers

1. Collecting a tissue sample;

2. extraction of circular RNA from colorectal cancer tissue (same procedure as in example 2);

3. the reverse transcription and fluorescent quantitative PCR reactions were performed as in the "reverse transcription and fluorescent quantitative reaction" in example 2;

4. using hsa _ circ _0071106 and hsa _ circ _0000825 as biomarkers for colorectal cancer detection, the expression levels of hsa _ circ _0071106 and hsa _ circ _0000825 in cancer tissues and paracarcinoma tissues of 81 patients with colorectal cancer were analyzed, respectively. Delta for colorectal cancer patient groups hsa _ circ _0071106 and hsa _ circ _0000825 _Ct Significantly higher than the normal group, P<0.01, demonstrating significantly lower expression levels of hsa _ circ _0071106 and hsa _ circ _0000825 than the normal group, as shown in FIG. 3. The cutoff value for hsa _ circ _0071106 as colorectal cancer marker was 6.84 when the PCR relative quantification Δ of hsa _ circ _0071106 biomarker in the sample was _Ct When the number is less than or equal to 6.84, the sample is regarded as a non-colorectal cancer sample; above 6.84, the sample is considered colorectal cancer, as shown in fig. 4. hsa _ circ _0000825 as marker for colorectal cancer has a cutoff value of 7.51,PCR relative quantitation of the hsa _ circ _0000825 biomarker in samples _Ct When the number is less than or equal to 7.51, the sample is regarded as a non-colorectal cancer sample; if the sample is greater than 7.51, the sample is regarded as colorectal cancer.

Levels of hsa _ circ _0071106 in colorectal cancer tissues and tissues beside the colorectal cancer tissues of 81 colorectal cancer patients were measured, and ROC curves were generated, as shown in FIG. 5, wherein AUC values were 0.788 and P was < 0.001. Table 1 shows that the sensitivity and specificity of hsa _ circ _0071106 as a colorectal cancer marker are 64.2% and 96.3% respectively as a result of colorectal cancer diagnosis using hsa _ circ _0071106 as a biomarker.

Levels of hsa _ circ _0000825 in colorectal cancer tissues and tissues beside the colorectal cancer tissues of 81 colorectal cancer patients were measured, and ROC curves were generated, as shown in FIG. 6, wherein AUC values were 0.963 and P was < 0.001. Table 1 shows that the sensitivity and specificity of hsa _ circ _0000825 as a colorectal cancer marker are 96.3% and 87.7% respectively as a result of colorectal cancer diagnosis using hsa _ circ _0000825 as a biomarker.

The combined detection of the levels of colorectal cancer tissues and the adjacent tissues hsa _ circ _0071106 and hsa _ circ _0000825 of 81 colorectal cancer patients produces ROC curve, as shown in FIG. 7, the AUC value is 0.970, and P is less than 0.001. Table 1 shows that the combined diagnosis of colorectal cancer using hsa _ circ _0071106 and hsa _ circ _0000825 as biomarkers resulted in a sensitivity of 95.1% and a specificity of 90.1% for hsa _ circ _0071106 and hsa _ circ _0000825 as colorectal cancer markers.

TABLE 1 results of colorectal cancer diagnosis with hsa _ circ _0071106 and/or hsa _ circ _0000825 as biomarkers

The ROC curve is obtained by drawing SPSS, and the sensitivity and specificity in the table 1 are directly obtained; the jotan index, sensitivity + specificity-1, represents the overall ability of the screening method to find true patients and non-patients. The larger the index, the better the screening experiment and the greater the authenticity.

From the above examples, it can be seen that the circular RNAs hsa _ circ _0071106 and/or hsa _ circ _0000825 can be used as a novel colorectal cancer detection molecular marker which specifically downregulates expression in cancer tissues of colorectal cancer patients, and particularly, the circular RNAs hsa _ circ _0071106 and hsa _ circ _0000825 are used in combination to screen colorectal cancer samples more accurately.

Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Sequence listing

<110> Guangdong university of medical science

NINGXIA MEDICAL University

<120> use of preparation for detecting circular RNA and/or expression level of circular RNA in preparation of colorectal cancer diagnostic reagent

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 650

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaagaaaaaa agaagtttga caaagagaca gaaaagaatt atagtctaat tgataaacat 60

ttgaatttat cagcaaaaaa gaaagactca catttacaag aggcagatat ccaagtagag 120

cagaaccggc aacacttcta tgaactgtct ctcgagtatg tgtgtaagct gcaggaaatc 180

caagaaagaa agaagtttga gtttgtggaa cctatgctgt cattttttca ggggatgttt 240

accttctatc atcagggcca tgaacttgcc aaagacttca atcactacaa aatggaacta 300

cagatcaaca ttcagaatac acggaatcga tttgaaggaa caaggtcaga agtggaagag 360

ctcatgaaca aaatcagaca gaatcccaag gaccacaaac gagcaagtca gtttacagcc 420

gaaggctacc tgtatgtcca ggaaaaaagg cctgctccgt ttggttccag ttgggtcaaa 480

cactattgca tgtatcgaaa agcagcaaag aagttcaaca tgatcccatt tgagcacaga 540

tctggaggga aacttgggga cggagaggtg ttctttttga aagaatgtac caagaggcat 600

actgactcca ttgacagaag gttttgtttt gacatagaag ctgctgatcg 650

<210> 2

<211> 384

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gatgagttag atgaactccg tgctgagatg gaagagatga gagacagtta tttagaggaa 60

gatgtttacc agctgcagga acttcggcga gaactggacc gcgctaataa aaactgccga 120

atcctgcagt accgtcttcg gaaagccgag cagaaaagcc tgaaagtggc tgagacgggt 180

caggtggatg gtgagcttat tcgaagcctg gagcaggact tgaaggtagc caaagatgta 240

tctgtcagat tgcaccacga acttaagacg gtggaggaaa agcgcgctaa agctgaggat 300

gaaaacgaaa ctctccgaca gcagatgatt gaagtggaaa tatccaaaca ggccctccag 360

aatgagctgg agagactgaa agag 384

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aggcatactg actccattga ca 22

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttttcttccg atcagcagct 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agaatgagct ggagagactg a 21

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctcttccatc tcagcacgga 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggtctcctct gacttcaaca 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtgagggtct ctctcttcct 20

Claims (7)

1. Use of circular RNA and/or an agent for detecting the expression level of the circular RNA in the preparation of a colorectal cancer diagnostic reagent, wherein the circular RNA comprises hsa _ circ _0071106 and/or hsa _ circ _ 0000825;

the nucleotide sequence of hsa _ circ _0071106 is shown in SEQ ID NO. 1;

the nucleotide sequence of hsa _ circ _0000825 is shown in SEQ ID NO. 2.

2. A diagnostic reagent for colorectal cancer comprising specific primers designed for the circular RNA hsa _ circ _0071106 and/or hsa _ circ _ 0000825;

the specific primers of the hsa _ circ _0071106 are P1 and P2; the specific primers of the hsa _ circ _0000825 are P3 and P4;

the nucleotide sequence of the P1 is shown as SEQ ID NO.3, the nucleotide sequence of the P2 is shown as SEQ ID NO.4, the nucleotide sequence of the P3 is shown as SEQ ID NO.5, and the nucleotide sequence of the P4 is shown as SEQ ID NO. 6.

3. The diagnostic reagent of claim 2, wherein the diagnostic reagent further comprises a housekeeping gene GAPDH.

4. The diagnostic reagent of claim 3, wherein the specific primers for the housekeeping gene GAPDH comprise P5 and P6;

the nucleotide sequence of the P5 is shown as SEQ ID NO.7, and the nucleotide sequence of the P6 is shown as SEQ ID NO. 8.

5. A diagnostic kit for colorectal cancer, comprising the diagnostic reagent according to any one of claims 2 to 4.

6. Use of circular RNA and/or an agent for detecting the expression level of the circular RNA in the preparation of a reagent for determining the therapeutic effect of colorectal cancer, wherein the circular RNA comprises hsa _ circ _0071106 and/or hsa _ circ _ 0000825;

the nucleotide sequence of hsa _ circ _0071106 is shown in SEQ ID NO. 1;

the nucleotide sequence of hsa _ circ _0000825 is shown in SEQ ID NO. 2.

7. An agent for determining the effect of a treatment for colorectal cancer, wherein the agent comprises specific primers designed for circular RNAhsa _ circ _0071106 and/or hsa _ circ _ 0000825;

the specific primers of the hsa _ circ _0071106 are P1 and P2; the specific primers of the hsa _ circ _0000825 are P3 and P4;

the nucleotide sequence of the P1 is shown as SEQ ID NO.3, the nucleotide sequence of the P2 is shown as SEQ ID NO.4, the nucleotide sequence of the P3 is shown as SEQ ID NO.5, and the nucleotide sequence of the P4 is shown as SEQ ID NO. 6.

Images