CN114134174A - Method for targeted regulation and control of hsa-miR-4638-3p by LncRNA TUG1 - Google Patents

Abstract

The invention relates to a method for targeted regulation and control of hsa-miR-4638-3p by LncRNAUG 1, and relates to the technical field of biology. The method of the invention comprises the following steps: step 1, constructing a wild type or mutant type binding site vector; step 2, adopting a cationic liposome method to perform cell transfection; and 3, performing Luciferase activity detection on the sample obtained in the step 2. The invention adopts a firefly/renilla dual-luciferase report system to carry out target verification so as to determine that the LncRNATUG1 and the hsa-miR-4638-3p gene have an exact target relationship, and the method determines the target regulation relationship of the LncRNATUG1 and the hsa-miR-4638-3p, thereby laying an experimental foundation for further researching the cardiotoxicity effect and the molecular mechanism of anthracyclines.

Description

Method for targeted regulation and control of hsa-miR-4638-3p by LncRNA TUG1

Technical Field

The invention relates to the technical field of biology, in particular to a method for targeted regulation and control of hsa-miR-4638-3p by LncRNA TUG 1.

Background

At present, the average life span of human beings is increased year by year, but the threat of cancer to human beings is increasingly prominent, and the cancer becomes one of important diseases which endanger the life safety of human beings. With the improvement of medical technology, the continuous development of anti-tumor drug research and the improvement of comprehensive diagnosis and treatment level of tumors, various tumors exist for a long time in a chronic disease mode, the life cycle of tumor patients is prolonged, and the cardiovascular toxicity caused by anti-tumor treatment is increased day by day, particularly by taking anthracyclines as a representative. In the long term, the risk of death from cardiovascular disease outweighs the risk of recurrence of many tumors; the risk of cardiovascular toxicity increases in elderly, patients with multiple disease complications, and patients in need of long-term or intensive therapy.

lncRNA is a kind of RNA molecule with length larger than 200bp and does not code protein, and is considered as a non-functional sequence without protein coding capacity for a long time without attention due to the unclear function and type. However, recent studies have found that lncRNA can regulate gene expression at the level of transcription, post-transcription, translation, etc., and thus participate in biological processes such as development, differentiation, growth, apoptosis, etc. of cells. Moreover, more and more studies have shown that lncRNA plays an important role in cardiac development and functional maintenance.

Taurine regulatory gene 1 (TUG 1) is lncRNA found in mouse retina, is located on 22q12.2 chromosome, participates in processes of angiogenesis, cell drug resistance and the like, and plays a key role in the maintenance of normal cell function and disease occurrence process of human body related to human body tumorigenesis. TUG1 modulates apoptosis, inhibiting apoptosis of certain cell systems, such as beta cells, bladder cancer cells, and hepatocellular carcinoma, but promoting apoptosis in other cells, such as lens epithelial cells, neurons, and gliomas. However, in the H9c2 cardiomyocytes stimulated by inflammation, TUG1 inhibited apoptosis and inflammatory responses, whereas under hypoxic conditions, TUG1 promoted apoptosis, aggravated injury due to hypoxia, suggesting that the dual effects of TUG1 are related to cell type and stress stimulation. Whether TUG1 can also regulate cell death by acting on specific miRNAs in cardiomyocytes or in myocardial damage of anthracyclines remains to be further investigated for the specific molecular biological mechanisms of TUG1 involved in cardiovascular toxicity of anthracyclines.

Disclosure of Invention

The invention aims to provide a method for targeted regulation and control of hsa-miR-4638-3p by LncRNA TUG1, which determines the targeted regulation and control relationship between LncRNA TUG1 and hsa-miR-4638-3p and lays an experimental foundation for further research on the cardiotoxicity action and molecular mechanism of anthracyclines.

In order to achieve the above purpose, the technical scheme of the invention is as follows:

the invention provides a method for regulating hsa-miR-4638-3p in a targeted manner by using LncRNA TUG1, which comprises the following steps:

step 1, constructing a wild-type TUG1 double-report vector;

or constructing a vector for predicting the first binding site of Hsa-miR-4638-3p by mutation;

or constructing a second binding site vector for predicting Hsa-miR-4638-3p through mutation;

or constructing a double mutation prediction Hsa-miR-4638-3p binding site vector;

the sequence of the first binding site is: tgtccagg;

the mutated sequence of the first binding site is: gagttcaa;

the sequence of the second binding site is: tgtccag;

the mutated sequence of the second binding site is: gagttca;

step 2, cotransfecting the cell with the microRNA and the plasmid

Cell transfection is carried out by adopting a cationic liposome method;

step 3, Lucifersae detection

And (3) carrying out Luciferase activity detection on the sample obtained in the step (2).

In the technical scheme, the construction of the wild-type TUG1 double-reporting vector in the step 1 comprises the following steps:

1. the TUG1 sequence;

the sequence of the first binding site is: tgtccagg;

the sequence of the second binding site is: tgtccag;

2. amplification primer sequences:

TUG1-XhoIF：

5'CCGCTCGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGC 3'；

TUG1-NotIR：

5'ATAAGAATGCGGCCGCGAAGAAATGAAATGCACACTCATGGAAC 3'；

3. PCR fishing gene:

1> template cDNA preparation

1. Total RNA extraction

1) Centrifuging to collect 293T cells, adding 1ml of a trizol solution, blowing, beating and uniformly mixing to fully crack the cells, and standing for 5 min;

2) adding 200 μ L chloroform, shaking vigorously and mixing well for 30s to make the water phase and organic phase contact sufficiently, standing at room temperature for 15 min;

3) centrifuging at 4 deg.C for 15min at 10000g, and transferring RNA in the upper aqueous phase to another new RNase free EP tube;

4) and (3) RNA precipitation: adding 0.5mL of isopropanol, uniformly mixing, and standing at room temperature for 10 min;

5) centrifuging at 4 deg.C for 10min at 10000g, collecting RNA precipitate, and removing supernatant;

6) washing twice with 75% ethanol, and air drying on a super clean bench;

7) adding 15-50 mu of LDEPC water to dissolve the precipitate;

2. total RNA purity and integrity assays

1) And (3) purity detection: taking a 1 mu LRNA sample for 50-fold dilution, determining the OD value, wherein the ratio of OD260/OD280 is more than 1.8, which indicates that the prepared RNA is purer and has no protein pollution;

2) total RNA integrity test: taking 1 mu L of RNA sample, carrying out electrophoresis on 1% agarose gel for 80V multiplied by 20min, observing 5s rRNA, 18s rRNA and 28s rRNA bands of total RNA by using a gel imaging system after EB is stained for 10min, and if the three bands are complete, the total RNA extraction can be proved to be complete;

3. reverse transcription

1) The following solutions were placed in a PCR tube of RNase free: total RNA0.75 μ g, adding water to Total volume of 12 μ L;

2) blowing and beating the solution uniformly, and keeping the temperature at 65 ℃ for 5min to denature RNA; immediately followed by ice cooling to prevent RNA renaturation;

3) the following reagents were added to the PCR tube: oligo 0.5. mu.L, Random primer 0.5. mu.L, 10mM dNTP 2.0. mu.L, RNase inhibitor 0.5. mu.L, 5 XBuffer 4.0. mu.L, M-MLV 0.5. mu.L;

4) keeping the temperature of the 20 mu L reaction solution at 30 ℃ for 10 min;

5) keeping the temperature at 42 ℃ for 60 min;

6) keeping the temperature at 72 ℃ for 10 min;

7) storing at-20 deg.C;

2> PCR reaction system

The following system was prepared in a 0.2mL EP tube, and 0.5. mu.L of amplified TUG1 was taken after diluting the template stock solution 20-fold:

2mM dNTP mixture 2.5μL，10×KOD buffer 2.5μL，25mM MgSO₄1.5. mu.L, template 0.5. mu.L, primer TUG 1F 0.3. mu.L, primer TUG 1R 0.3. mu.L, KOD Plus Neo 0.3. mu.L, ddH₂O 17.1μL；

3> amplification conditions

Amplification after mixing, amplification conditions of the TUG1 gene: 94 deg.C, 1min, 98 deg.C, 15sec, 58 deg.C, 15sec, 68 deg.C, 1min, 68 deg.C, 5min, 30 cycles; storing at 16 deg.C;

4> PCR product recovery

8) After carrying out 1% gel electrophoresis on the PCR product, cutting a gel strip containing the target gene fragment into a clean 1.5mL EP tube by using a scalpel under an ultraviolet lamp, weighing, and adding the solution BD into a centrifuge tube according to the proportion of 100mg of gel to 100 mu L of the solution BD;

9) water bath at 60 deg.C for 10min until the gel is completely dissolved, and shaking and mixing for 3 times during the water bath period;

10) transferring the solution to a DNA purification column, standing for 2min, centrifuging at the room temperature of 12000rpm for 1min, and removing the filtrate;

11) adding 500 μ L of solution PE onto the column, centrifuging at 12000rpm for 1min at room temperature, and removing the filtrate;

12) repeating the last operation once;

13) centrifuging at 12000rpm for 1min to completely remove the residual liquid in the column;

14) the column was placed on a new 1.5mL EP tube, 30. mu.L of 60 ℃ preheated sterile water was added to the center of the column, and 13400g was centrifuged for 1min to elute the DNA;

4. PCR recovery product and vector double digestion

In 2 sterile 0.2mL EP reaction tubes, 15. mu.L each of the TUG1 PCR-recovered product and the psiCHECK-2 vector were separately digested with XhoI/NotI, as follows: XhoI 1.5. mu.L, NotI 1.5. mu.L, 10 XBuffer 5. mu.L, ddH₂O27 mu L; after mixing evenly, reacting for 2.5-3.5h at 37 ℃;

5. recovery of the digestion product

1) After carrying out 1% gel electrophoresis on the enzyme digestion product, respectively cutting gel strips containing target fragments and a carrier into a clean 1.5mL EP tube by using a scalpel under an ultraviolet lamp, and adding a solution BD into a centrifuge tube according to the proportion that 100mg of gel corresponds to 100 mu L of the solution BD;

2) water bath at 60 deg.C for 10min until the gel is completely dissolved, and shaking and mixing for 3 times during the water bath period;

3) transferring the solution to a DNA purification column, standing for 2min, centrifuging at the room temperature of 12000rpm for 1min, and removing the filtrate;

4) adding 500 μ L of solution PE onto the column, centrifuging at 12000rpm for 1min at room temperature, and removing the filtrate;

5) repeating the last operation once;

6) centrifuging the empty column at 12000rpm for 1min to completely remove the residual liquid in the purification column;

7) the column was placed on a new 1.5mL EP tube, 30. mu.L of 60 ℃ preheated sterile water was added to the center of the column, and 13400g was centrifuged for 1min to elute the DNA;

6. linking the target fragment with a vector:

to a 0.2mL EP tube were added the following reagents: mu.L of the recovered TUG1 PCR product by digestion, 2. mu.L of the recovered psiCHECK-2 vector by digestion, 1. mu.L of 10 XLigase Buffer, 1. mu.L of T4 DNA Ligase, ddH₂O3 mu L; joining at 16 ℃1h；

7. Conversion of ligation products

1) Respectively adding 5 mu L of the ligation product into 50 mu L of DH5 alpha competent cells in ice bath, rotating and uniformly mixing, and carrying out ice bath for 30 min;

2) water bath heat shock at 42 ℃ for 90 s;

3) the tube was transferred to an ice bath for 2 min;

4) respectively adding 200 μ L LB culture medium, mixing, and performing shaking culture at 37 deg.C and 200rpm for 1 h;

5) uniformly coating the bacterial liquid on an LB flat plate containing ampicillin in a superclean bench, and placing at room temperature until the liquid is absorbed;

6) inverting the plate, and transferring into a biochemical incubator at 37 ℃ for overnight culture;

8. positive clone for plasmid restriction identification

1, selecting a plurality of monoclonals from a flat plate, and carrying out shaking table overnight culture in a 3mL LB tube;

2> plasmid extraction

a) Collecting 3 mu L of bacterial liquid by using a 1.5mL EP tube, centrifuging at 12000rpm for 1min, and removing supernatant;

b) adding 250 mu L of solution I/RNaseA mixed solution, and re-suspending the thalli;

c) adding 250 μ L of solution II, gently and repeatedly reversing and mixing for 6 times, and standing at room temperature for 2 min;

d) adding 350 μ L of solution III, and gently and repeatedly reversing and mixing for 6 times;

e) centrifuging at 12000rpm for 10min, sucking out supernatant, introducing into DNA purification column, and standing for 2 min;

f) centrifuging at 12000rpm for 1min, and discarding the filtrate;

g) adding 500 μ L solution PB into the column, centrifuging at 12000rpm for 1min, and removing the filtrate;

h) adding 500 μ L of solution W into the column, centrifuging at 12000rpm for 1min, discarding the filtrate, and repeating once;

i) centrifuging the hollow column at 12000rpm for 3 min;

j) taking out the column, placing in a new 1.5mL EP tube, adding 50 μ L sterile water, standing for 2min, and centrifuging at 13400rpm for 1min to elute the plasmid;

3 enzyme digestion identification and extraction of plasmid

The enzyme digestion reaction system is as follows: extracted plasmids TUG13 μ L, XhoI0.4 μ L, NotI 0.4 μ L, 10 XBuffer 1 μ L, ddH₂O5.2 μ L; carrying out enzyme digestion for 2h at 37 ℃; carrying out electrophoresis separation on the enzyme digestion product by using 1% agarose gel containing ethidium bromide, and imaging by using a UVP (ultraviolet fluorescence) gel imaging system;

solution I: 50mMl glucose/10 mM EDTA/25mM Tris-HCl, pH 8.0, i.e. resuspension;

solution II: 0.2Ml NaOH/1% SDS, i.e., lysate;

solution III: 3Ml potassium acetate/2 Ml acetic acid, namely the neutralization precipitation solution.

In the technical scheme, the step of constructing the vector for mutating and predicting the first binding site of Hsa-miR-4638-3p in the step 1 is as follows:

1. TUG1 sequence

The sequence of the first binding site is: tgtccagg;

the mutated sequence of the first binding site is: gagttcaa;

2. amplification primer sequences:

mutTUG1-1F：

5'GGCAAAACATGAGAGAGTTCAAATTGGAGGTTGAAAAGATTTCACTACAGTGTTCTG 3'；

mutTUG1-1R：

5'TTTTCAACCTCCAATTTGAACTCTCTCATGTTTTGCCACAGAATTTCAAGCTTTGAG 3'；

3. gene mutation:

1> PCR reaction System

The following system was prepared in a 0.2mL PCR reaction tube, the template was the constructed TUG1 plasmid, and 1. mu.L of the plasmid was diluted 50 times and used as the template:

2mM dNTP mixture 2.5μL，10×KOD buffer 2.5μL，25mM MgSO₄1.5. mu.L, primer mutTUG1-1F 0.3. mu.L, primer mutTUG1-1R 0.3. mu.L, KOD plus neo 0.3. mu.L, ddH₂O16.6μL；

2> amplification conditions

Amplification after mixing, the amplification condition of mutTUG1-1 gene: 94 deg.C, 1min, 98 deg.C, 15sec, 58 deg.C, 15sec, 68 deg.C, 4min30 sec, 68 deg.C, 5min, 20 cycles; storing at 16 deg.C;

3> the PCR product was digested with DpnI

Adding 1 mu LDpnI enzyme into a PCR tube, and digesting for 4h at 37 ℃;

4> transformation of the PCR product treated by DpnI, step 7 of constructing a double report vector with wild type TUG 1;

5, selecting 1 colony to extract plasmids, and constructing the plasmids with a wild-type TUG1 double-reporting vector in the step 8;

and 6> sample sending and sequencing.

In the technical scheme, the step of constructing the mutant prediction Hsa-miR-4638-3p second binding site vector in the step 1 is as follows:

1. TUG1 sequence

The sequence of the second binding site is: tgtccag;

the mutated sequence of the second binding site is: gagttca;

2. amplification primer sequences:

mutTUG1-2F：

5'GAAGACCTGAGTTTCGAGTTCAACCCTCAGTGCAAACTGAGGATGCTCCATCCAAAG 3'；

mutTUG1-2R：

5'GCACTGAGGGTTGAACTCGAAACTCAGGTCTTCTAATTCCCAGTAACAGTGCTGGTG 3'；

3. gene mutation:

1> PCR reaction System

Configuring the following system in a 0.2mL PCR reaction tube, wherein a template is a constructed TUG1 plasmid, and taking 1 mu L of diluted plasmid as the template;

2mM dNTP mixture 2.5μL，10×KOD buffer 2.5μL，25mM MgSO₄1.5. mu.L, primer mutTUG1-2F 0.3. mu.L, primer mutTUG1-2R 0.3. mu.L, KOD plus neo 0.3. mu.L, ddH₂O 16.6μL；

2> amplification conditions

Amplification after mixing, the amplification conditions of mutTUG1-2 gene: 94 deg.C, 1min, 98 deg.C, 15sec, 58 deg.C, 15sec, 68 deg.C, 4min30 sec, 68 deg.C, 5min, 20 cycles; storing at 16 deg.C;

3> the PCR product was digested with DpnI

Adding 1 mu LDpnI enzyme into a PCR tube, and digesting for 4h at 37 ℃;

4> transformation of the PCR product treated by DpnI, step 7 of constructing a double report vector with wild type TUG 1;

5, selecting 1 colony to extract plasmids, and constructing the plasmids with a wild-type TUG1 double-reporting vector in the step 8;

and 6> sample sending and sequencing.

In the technical scheme, the steps for constructing the double mutation prediction Hsa-miR-4638-3p binding site vector are as follows:

1. the TUG1 sequence;

the sequence of the first binding site is: tgtccagg;

the mutated sequence of the first binding site is: gagttcaa;

the sequence of the second binding site is: tgtccag;

the mutated sequence of the second binding site is: gagttca;

2. amplification primer sequences:

mutTUG1-2F：

5'GAAGACCTGAGTTTCGAGTTCAACCCTCAGTGCAAACTGAGGATGCTCCATCCAAAG 3'

mutTUG1-2R：

5'GCACTGAGGGTTGAACTCGAAACTCAGGTCTTCTAATTCCCAGTAACAGTGCTGGTG 3'

3. gene mutation:

1> PCR reaction System

The following system was prepared in a 0.2ml PCR reaction tube, the template was mutated mutTUG1-1 plasmid, and 1. mu.L of the plasmid was diluted 50-fold and used as template:

2mM dNTP mixture 2.5μL，10×KOD buffer 2.5μL，25mM MgSO₄1.5. mu.L, primer mutTUG1-2F 0.3. mu.L, primer mutTUG1-2R 0.3. mu.L, KOD plus neo 0.3. mu.L, ddH₂O 16.6μL；

2> amplification conditions

Amplification after mixing, the amplification condition of mutTUG1-3 gene: 94 deg.C, 1min, 98 deg.C, 15sec, 58 deg.C, 15sec, 68 deg.C, 4min30 sec, 68 deg.C, 5min, 20 cycles; storing at 16 deg.C;

3> the PCR product was digested with DpnI

Adding 1 mu LDpnI enzyme into a PCR tube, and digesting for 4h at 37 ℃;

4> transformation of the PCR product treated by DpnI, step 7 of constructing a double report vector with wild type TUG 1;

5, selecting 1 colony to extract plasmids, and constructing the plasmids with a wild-type TUG1 double-reporting vector in the step 8;

and 6> sample sending and sequencing.

In the above technical solution, step 2 specifically includes the following steps:

(1) one day before transfection, cells were at 2X 10⁴Inoculating the cells/well on a 24-well plate, wherein a culture medium is DMEM high-sugar containing 10% FBS;

(2) on the day of transfection, the confluency of cells was about 50-60%, the old medium was aspirated off, washed twice with PBS, and 300. mu.L of OPTI-MEM medium was added to each well and placed in 5% CO₂37 ℃ incubator;

(3) diluting cellfectin II Reagent1 μ L with OPTI-MEM medium in each well to a final volume of 50 μ L, and standing at room temperature for 5 min;

(4) adding 20 mu M hsa-miR-4638-3p1 mu L or hsa-miR-4638-3p inhibitor and 0.5 mu g plasmid into each well, adding OPTI-MEM to total volume of 50 mu L, and standing at room temperature for 5 min;

(5) compounding the diluent in the step (3) and the diluent in the step (4), and standing for 20min at room temperature;

(6) adding 100 mu L of the transfection complex solution in the volume ratio of 5 into each hole, shaking the 24-hole plate and mixing uniformly;

(7) at 5% CO₂Incubate at 37 ℃ for 5h, replacing the medium containing the transfection complex with the complete medium.

In the above technical solution, step 3 specifically includes the following steps:

after transfection for 48h, the old culture medium was aspirated, washed twice with PBS, 100. mu.L of PLB was added to each well of cells, shaken at room temperature for 15min, and cell lysates were collected; the determination of the Luciferase activity in the sample was carried out by using the Dual-Luciferase reporter assay System of Promega.

The invention has the beneficial effects that:

the invention adopts a firefly/renilla dual-luciferase report system to carry out target verification so as to determine that the hsa-miR-4638-3p and LncRNA TUG1 gene have an exact target relationship, and further provides a method for regulating and controlling the hsa-miR-4638-3p in a targeted manner by the LncRNA TUG1, wherein the method determines the targeted regulation and control relationship between the hsa-miR-4638-3p and the LncRNA TUG1, and lays an experimental foundation for further researching the cardiotoxicity effect and the molecular mechanism of anthracyclines.

Drawings

The present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.

Fig. 1 is a graph of predicted results in the construction of a wild-type TUG1 dual reporter vector.

Fig. 2 is an electrophoretogram of PCR products constructed from wild-type TUG1 double reporter vector, lane M2: 1kb DNAmarker; lane 1: TUG1 PCR amplification product (1000 bp).

FIG. 3 shows the electrophoresis of the cleavage products, lane M2: 1kb DNAmarker; lane 1: the product is the product of TUG1-1 plasmid after enzyme digestion; lane 2: is the product of the plasmid enzyme digestion of TUG 1-2; lane 3: is the product of the plasmid enzyme digestion of TUG 1-3; lane M1: DL 2000 DNAMarker.

FIG. 4 is a graph of the sequencing peaks of the core binding sites of the wild-type TUG1 double-reporter vector, the upper graph is the first core binding site Hsa-miR-4638-3p, and the lower graph is the second core binding site Hsa-miR-4638-3 p.

FIG. 5 is a graph of the core binding site mutation sequencing peak of the mutation prediction Hsa-miR-4638-3p first binding site vector.

FIG. 6 is a graph of the core binding site mutation sequencing peak of the mutation prediction Hsa-miR-4638-3p second binding site vector.

FIG. 7 is a graph of the core binding site mutation sequencing peak of a double mutation prediction Hsa-miR-4638-3p binding site carrier, the upper graph is a first core binding site of Hsa-miR-4638-3p, and the lower graph is a second core binding site of Hsa-miR-4638-3 p.

FIG. 8 is a graph showing the luciferase expression activity of the co-transfected TUG1 and Hsa-miR-4638-3p, wherein each group of histograms is 3 'UTR TUG1, 3' UTR mutTUG1-1, 3 'UTR mutTUG1-2, and 3' UTR mutTUG1-3 from left to right.

FIG. 9 is a graph showing the comparison of the activity of each group of plasmids transfected and cloned with the 3' UTR of the TUG1 gene.

FIG. 10 is a graph showing the comparison of the activities of each group of plasmids transfected with 3' UTR of mutTUG1-1 gene.

FIG. 11 is a graph showing the comparison of the activities of each group of plasmids transfected with 3' UTR of mutTUG1-2 gene.

FIG. 12 is a graph showing the comparison of the activities of the groups transfected with the mutTUG1-3 plasmid.

Detailed Description

The invention provides a method for targeted regulation and control of hsa-miR-4638-3p by LncRNA TUG1, which determines the targeted regulation and control relationship of LncRNA TUG1 and hsa-miR-4638-3p and lays an experimental foundation for further research of the cardiotoxicity effect and molecular mechanism of anthracyclines. The invention adopts a firefly/renilla dual-luciferase report system to carry out target verification so as to determine the exact target relationship existing between LncRNA TUG1 and hsa-miR-4638-3p genes.

A first part: wild-type TUG1 double-reporter vector construction

1. Sequence of TUG 1:

the sequence of the first binding site is: tgtccagg;

the sequence of the second binding site is: tgtccag;

the prediction results are shown in FIG. 1.

2. Amplification primer sequences: (Shanghai, Suzhou, PAGE purification of 2OD):

TUG1-XhoIF：5'CCGCTCGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGC 3'；

TUG1-NotIR：5'ATAAGAATGCGGCCGCGAAGAAATGAAATGCACACTCATGGAAC 3'；

3. PCR fishing gene:

1> template cDNA preparation

1. Total RNA extraction

1) Centrifuging to collect 293T cells, adding 1ml Trizol (Invitrogen) solution, blowing, mixing well to fully crack the cells, and standing for 5 min;

2) adding 200 μ L chloroform, shaking vigorously and mixing well for 30s to make the water phase and organic phase contact sufficiently, standing at room temperature for 15 min;

3) centrifuging at 4 deg.C for 15min at 10,000g to obtain three layers, transferring RNA to the upper water phase, and transferring to another new RNase free EP tube;

4) and (3) RNA precipitation: adding 0.5ml isopropanol, gently mixing well, standing at room temperature for 10 min;

5) centrifuging at 4 deg.C for 10min at 10,000g, collecting RNA precipitate, and removing supernatant;

6) washing twice with 75% ethanol, and air drying on a super clean bench;

7) adding 15-50 mu of LDEPC to dissolve the precipitate.

2. Total RNA purity and integrity assays

1) And (3) purity detection: a1. mu.L RNA sample was diluted 50-fold in a Beckman Co. mu.Lter

OD260/OD280 ratios of OD260/OD280 of 520UV/Vis Spectrophotometer greater than 1.8 indicated that the RNA prepared was relatively pure and free of protein contamination.

2) Total RNA integrity test: taking 1 mu L of RNA sample, carrying out electrophoresis on 1% agarose gel for 80V multiplied by 20min, observing bands of 5s rRNA, 18s rRNA and 28s rRNA of total RNA by using a gel imaging system after EB (Epstein-Barr) staining for 10min, and verifying that the total RNA is extracted completely if three bands are complete.

3. Reverse transcription

1) The following solutions were placed in a PCR tube of RNase free:

2) the solution is blown and beaten evenly and kept at 65 ℃ for 5min to denature RNA. Immediately followed by ice cooling to prevent RNA renaturation;

3) the following reagents (Promega) were added to the PCR tube:

4) keeping the temperature of the 20 mu L reaction solution at 30 ℃ for 10 min;

5) keeping the temperature at 42 ℃ for 60 min;

6) keeping the temperature at 72 ℃ for 10 mn.

7) Storing at-20 deg.

2> PCR reaction system

The following system was prepared in a 0.2mL EP tube, and 0.5. mu.L of amplified TUG1 was taken after diluting the template stock solution 20-fold:

note: KOD Plus Neo DNApolymerase available from Toyo Boseki, cat # KOD 401;

3> amplification conditions

After mixing, the mixture is put into a GeneAmp PCR System model 2400 PCR amplification instrument for amplification.

Amplification conditions for the TUG1 gene:

4> PCR product recovery (DNA gel recovery kit, DONGSHENG BIOTECH)

8) After the PCR product is subjected to 1% gel electrophoresis, a gel band containing the target gene fragment is cut by a scalpel under an ultraviolet lamp to a clean 1.5mL EP tube, and after weighing, the solution BD is added into a centrifuge tube according to the proportion of 100mg of gel to 100 μ L of the solution BD.

9) Water bath at 60 deg.C for 10min until the gel is completely dissolved, and shaking and mixing for 3 times during the water bath.

10) The solution was transferred to a DNA purification column, allowed to stand for 2min, centrifuged at 12000rpm at room temperature for 1min, and the filtrate was discarded.

11) mu.L of solution PE was added to the column, centrifuged at 12000rpm for 1min at room temperature, and the filtrate was discarded.

12) The last operation is repeated once.

13) The empty column was centrifuged at 12000rpm for 1min at room temperature to completely remove the liquid remaining in the purification column.

14) The column was placed on a new 1.5mL EP tube, 30. mu.L of 60 ℃ preheated sterile water was added to the center of the column, and 13400g was centrifuged for 1min to elute the DNA.

5> photograph of PCR product when cutting gel and recovering;

as can be seen from FIG. 2, TUG1 was amplified using the template and was consistent in size with the prediction (the amplified band was roughly at the position of Marker 1000 bp); the TUG1 target gene is proved to be amplified;

4. PCR recovery product and vector double digestion

In 2 sterile 0.2mL EP reaction tubes, 15. mu.L each of the TUG1 PCR-recovered product and the psiCHECK-2 vector were separately digested with XhoI/NotI, as follows:

after mixing, the mixture is reacted at 37 ℃ for about 3 hours.

5. Recovery of enzyme digestion products (DNA gel recovery kit, DONGSHENG BIOTECH)

1) After the enzyme digestion product is subjected to 1% gel electrophoresis, gel strips containing target fragments and a carrier are respectively cut into clean 1.5mL EP tubes by a scalpel under an ultraviolet lamp, and the solution BD is added into a centrifuge tube according to the proportion of 100mg of gel to 100 mu L of the solution BD.

2) Water bath at 60 deg.C for 10min until the gel is completely dissolved, and shaking and mixing for 3 times during the water bath.

3) The solution was transferred to a DNA purification column, allowed to stand for 2min, centrifuged at 12000rpm at room temperature for 1min, and the filtrate was discarded.

4) mu.L of solution PE was added to the column, centrifuged at 12000rpm for 1min at room temperature, and the filtrate was discarded.

5) The last operation is repeated once.

6) The empty column was centrifuged at 12000rpm for 1min to completely remove the liquid remaining in the purification column.

7) The column was placed on a new 1.5mL EP tube, 30. mu.L of 60 ℃ preheated sterile water was added to the center of the column, and 13400g was centrifuged for 1min to elute the DNA.

6. Linking the target fragment with a vector:

to a 0.2mL EP tube was added the following reagent (T4 DNAIgase enzyme available from TaKaRa Co., Ltd., cat # D2011A;)

Ligation was performed at 16 ℃ for 1 h.

7. Conversion of ligation products

1) mu.L of the ligation product was added to 50. mu.L of DH 5. alpha. competent cells, respectively, in an ice bath. Mix by gentle rotation and ice-bath for 30 min.

2) The water bath was heat shocked at 42 ℃ for 90 s.

3) The tube was quickly transferred to an ice bath for 2 min.

4) Adding 200 μ L LB culture medium respectively, mixing, and shaking culturing at 37 deg.C and 200rpm for 1 h.

5) The bacterial liquid was uniformly spread on an LB plate containing ampicillin (Amp) (100. mu.g/mL) in a clean bench, and left at room temperature until the liquid was absorbed.

6) The plate was inverted and transferred to a 37 ℃ biochemical incubator overnight.

8. Positive clone for plasmid restriction identification

1, selecting a plurality of monoclonals from a flat plate, and carrying out shaking table overnight culture in a 3mL LB tube;

2> plasmid extraction, (high purity plasmid miniprep kit, G-SHUN)

a) mu.L of the resulting suspension was collected in a 1.5mL EP tube, centrifuged at 12000rpm for 1min, and the supernatant was removed.

b) 250. mu.L of the solution I/RNaseA mixture was added to the suspension to resuspend the cells.

c) Adding 250 μ L of solution II, mixing by gently and repeatedly reversing for 6 times, and standing at room temperature for 2 min.

d) Add 350. mu.L of solution III and mix by gentle repeated inversion 6 times.

e) Centrifuging at 12000rpm for 10min, carefully sucking off the supernatant to DNA purification column, and standing for 2 min.

f) Centrifuge at 12000rpm for 1min, discard the filtrate.

g) Add 500. mu.L of solution PB to the column, centrifuge at 12000rpm for 1min, and discard the filtrate.

h) Add 500. mu.L of solution W to the column, centrifuge at 12000rpm for 1min, and discard the filtrate. And repeating the steps once.

i) The column was centrifuged at 12000rpm for 3 min.

j) The column was removed and placed in a new 1.5mL EP tube, 50. mu.L of sterile water (preheated at 60 ℃) was added, allowed to stand for 2min, and centrifuged at 13400rpm for 1min to elute the plasmid.

The solution I is 50mMl glucose/10 mMl EDTA/25mMl Tris-HCl, pH 8.0, namely a resuspension.

The solution II is 0.2Ml NaOH/1% SDS, namely lysate.

The solution III is 3Ml potassium acetate/2 Ml acetic acid, namely a neutralization precipitation solution.

Solution PB is a plasmid extraction reagent purchased from Dongsheng organism (Dongsheng BIOTECH), and contains alkali and protein denaturant without directly contacting skin. Solution W was a plasmid extraction reagent purchased from Dongsheng organism (Dongsheng BIOTECH) and diluted with absolute ethanol at a ratio of 1:1.5, i.e., containing 60% ethanol, before the first use. Solution BD is a DNA gel recovery reagent purchased from Dongsheng organism (Dongsheng Biotech) and contains denaturant without direct contact with skin.

3> enzyme digestion identification of extracted plasmid

The enzyme digestion reaction system is as follows:

the enzyme was cleaved at 37 ℃ for 2 h.

The cleavage products were separated by electrophoresis on a 1% agarose gel containing Ethidium Bromide (EB) and imaged on a UVP gel imaging system. The results are shown in FIG. 3. As can be seen from fig. 3: TUG1(1000bp) cut a band of one at the corresponding position (indicated by the lower arrow), indicating that positive clones were screened, and TUG1 positive plasmid was sent for sequencing.

9. Sequencing result report sheet

The TUG1 was sent to Shanghai Production Gene company for sequencing, and the sequencing results are shown as SEQ ID NO. 3 in the sequence Listing, and the sequence of TUG1 is shown as SEQ ID NO. 4 in the sequence Listing. Sequencing results BLAST analysis: TUG1 has been successfully cloned into the psiCHECK-2 vector in 100% BLAST agreement with known sequences on NCBI and is therefore useful in subsequent double-report experiments. Core binding site sequencing peak pattern referring to fig. 4, fig. 4 can demonstrate the success of wild type TUG1 dual reporter vector construction.

A second part: construction of vector for mutating and predicting first binding site of Hsa-miR-4638-3p

1. TUG1 sequence

The sequence of the first binding site is: tgtccagg;

the mutated sequence of the first binding site is: gagttcaa;

2. amplification primer sequences: (Shanghai, Suzhou, PAGE purification of 2OD):

mutTUG1-1F：5'GGCAAAACATGAGAGAGTTCAAATTGGAGGTTGAAAAGATTTCACTACAGTGTTCTG 3'；

mutTUG1-1R：5'TTTTCAACCTCCAATTTGAACTCTCTCATGTTTTGCCACAGAATTTCAAGCTTTGAG 3'；

3. gene mutation:

1> PCR reaction System

The following system was prepared in a 0.2ml PCR tube, the template was the constructed TUG1 plasmid, and 1. mu.L of the plasmid was diluted 50 times and used as the template:

note: KOD Plus neo DNApolymerase available from ToyoBo corporation under the trademark KOD 401;

2> amplification conditions

After mixing, the mixture is put into a GeneAmp PCR System model 2400 PCR amplification instrument for amplification.

Amplification conditions for mutTUG1-1 Gene:

3> the PCR product was digested with DpnI (to digest the methylated template DNA);

mu.L of LDpnI enzyme (product number: R6231 from Promega) was added to the PCR tube and digested at 37 ℃ for 4 hours.

4> transformation of the DpnI-treated PCR product, the procedure is identical to the first part of step 7.

5> picking 1 colony to extract plasmid, the same procedure as the first part 8.

6> sample presentation sequencing

4. Sequencing result report sheet

Sending the DNA sequence to Shanghai Producer company for sequencing, wherein the sequencing result is shown as SEQ ID NO. 7 in the sequence list, and the sequencing result is subjected to BLAST analysis: the TUG1 sequence has been successful in effecting mutations in the desired mutant region and, therefore, can be used in subsequent double-reporting experiments. The core binding site mutation sequencing peak map is shown in FIG. 5, and the mutation prediction Hsa-miR-4638-3p first binding site vector construction is successful according to the map 5.

And a third part: construction of mutation prediction Hsa-miR-4638-3p binding site vector

1. TUG1 sequence

The sequence of the second binding site is: tgtccag;

the mutated sequence of the second binding site is: gagttca;

2. amplification primer sequences: (Shanghai, Suzhou, PAGE purification of 2OD):

mutTUG1-2F：5'GAAGACCTGAGTTTCGAGTTCAACCCTCAGTGCAAACTGAGGATGCTCCATCCAAAG 3'；

mutTUG1-2R：5'GCACTGAGGGTTGAACTCGAAACTCAGGTCTTCTAATTCCCAGTAACAGTGCTGGTG 3'；

3. gene mutation:

1> PCR reaction System

The following system was prepared in a 0.2ml PCR tube, the template was the constructed TUG1 plasmid, and 1. mu.L of the plasmid was diluted 50 times and used as the template:

note: KOD Plus neo DNApolymerase available from ToyoBo corporation under the trademark KOD 401;

2> amplification conditions

After mixing, the mixture is put into a GeneAmp PCR System model 2400 PCR amplification instrument for amplification.

Amplification conditions for mutTUG1-2 Gene:

3> the PCR product was digested with DpnI (to digest the methylated template DNA);

mu.L of LDpnI enzyme (product number: R6231 from Promega) was added to the PCR tube and digested at 37 ℃ for 4 hours.

4> DpnI treated PCR product transformation, the procedure is identical to the first part of step 7

5> selecting 1 colony to extract plasmid, the steps are the same as the first part 8

6> sample presentation sequencing

4. Sequencing result report sheet

Sending the DNA sequence to Shanghai Producer company for sequencing, wherein the sequencing result is shown as SEQ ID NO. 10 in the sequence list, and the sequencing result is subjected to BLAST analysis: the TUG1 sequence has been successful in effecting mutations in the desired mutant region and, therefore, can be used in subsequent double-reporting experiments. The core binding site mutation sequencing peak map is shown in FIG. 6, and from FIG. 6, the mutation prediction Hsa-miR-4638-3p second binding site vector construction is successful.

The fourth part: construction of double-mutation prediction Hsa-miR-4638-3p binding site vector

1. TUG1 sequence

The sequence of the first binding site is: tgtccagg;

the mutated sequence of the first binding site is: gagttcaa;

the sequence of the second binding site is: tgtccag;

the mutated sequence of the second binding site is: gagttca;

2. amplification primer sequences: (Shanghai, Suzhou, PAGE purification of 2OD):

mutTUG1-2F：5'GAAGACCTGAGTTTCGAGTTCAACCCTCAGTGCAAACTGAGGATGCTCCATCCAAAG 3'；

mutTUG1-2R：5'GCACTGAGGGTTGAACTCGAAACTCAGGTCTTCTAATTCCCAGTAACAGTGCTGGTG 3'；

3. gene mutation:

1> PCR reaction System

The following system was prepared in a 0.2ml PCR reaction tube, the template was mutated mutTUG1-1 plasmid, and 1. mu.L of the plasmid was diluted 50-fold and used as template:

note: KOD Plus neo DNApolymerase available from ToyoBo corporation under the trademark KOD 401;

2> amplification conditions

After mixing, the mixture is put into a GeneAmp PCR System model 2400 PCR amplification instrument for amplification.

Amplification conditions for mutTUG1-3 Gene:

3> the PCR product was digested with DpnI (to digest the methylated template DNA);

mu.L of LDpnI enzyme (product number: R6231 from Promega) was added to the PCR tube and digested at 37 ℃ for 4 hours.

4> DpnI treated PCR product transformation, the procedure is identical to the first part of step 7

5> selecting 1 colony to extract plasmid, the steps are the same as the first part 8

6> sample presentation sequencing

4. Sequencing result report sheet

Sending the DNA sequence to Shanghai Production gene company for sequencing, wherein the sequencing result is shown as SEQ ID NO. 13 in the sequence list, and the sequencing result is subjected to BLAST analysis: the TUG1 sequence has been successful in effecting mutations in the desired mutant region and, therefore, can be used in subsequent double-reporting experiments. The core binding site mutation sequencing peak map is shown in fig. 7, and it can be seen from fig. 7 that: the double mutation predicts the successful construction of Hsa-miR-4638-3p binding site vector.

Second, the cell co-transfected by microRNA and plasmid

Cell transfection by cationic liposome method:

(1) one day before transfection, cells were at 2X 10⁴Inoculating the cells/well on a 24-well plate, wherein a culture medium is DMEM high-sugar containing 10% FBS;

(2) on the day of transfection, the confluency of cells was about 50-60%, the old medium was aspirated, washed twice with PBS, and 300. mu.L of OPTI-MEM (Invitrogen) medium was added to each well and placed in 5% CO₂37 ℃ incubator;

(3) each well was diluted with 1. mu.L of cellfectin II Reagent (Invitrogen) in OPTI-MEM medium to a final volume of 50. mu.L, and allowed to stand at room temperature for 5 min;

(4) adding 20 mu M hsa-miR-4638-3p1 mu L or hsa-miR-4638-3p inhibitor and 0.5ug plasmid into each well, adding OPTI-MEM to total volume of 50 mu L, and standing at room temperature for 5 min; (the concentration of hsa-miR-4638-3p in the final incubation solution is 50nM, and the concentration of hsa-miR-4638-3p inhibitor is 100nM)

(5) Compounding the diluent in the step (3) and the diluent in the step (4), and standing for 20min at room temperature;

(6) adding 100 mu L of the transfection complex solution in the volume ratio of 5 into each hole, shaking the 24-hole plate, and slightly and uniformly mixing;

(7) at 5% CO₂Incubate 5h at 37 ℃ in an incubator, replace the medium containing the transfection complex with fresh complete medium (containing serum).

Note: the Tip used has been treated with RNase removal.

Three, Lucifersae detection

The determination of the Luciferase activity in the sample was carried out by the Dual-Luciferase reporter assay System (E1910) of Promega.

After 48h of transfection, the old medium was aspirated, washed twice with PBS, 100. mu.L of PLB (Passive Lysis buffer) was added to each well of cells, and the cells were gently shaken at room temperature for 15 minutes to collect cell lysates.

1. Using a manual double fluorescence detector (Promega, GloMax bioluminescence detector)

1) After 20. mu.l of cell lysate was added to the plate, the background was read for 2s using a GloMax bioluminescence detector.

2) Add 100. mu.l LAR II working solution to each sample, mix them quickly and read for 2 s.

3) After reading, 100. mu.l of Stop was added to each sample&

Reagent, put into a luminescence detector after mixing rapidly, read the value for 2 s.

4) And saving the data.

Third, analysis of detection results

Firefly luciferase F

Renilla luciferase R

Delta fold activity (R/F) sample/(R/F) control

2> cell transfection assay set (each set of data set 3 duplicate wells)

FIG. 8 is a graph showing the luciferase expression activity of the co-transfected TUG1 and Hsa-miR-4638-3p, and the luciferase expression activity fold of the co-transfected TUG1 and Hsa-miR-4638-3p analyzed from FIG. 8 is 45%; the mutation predicts that the luciferase activity fold of the first binding site of miR-4638-3p is 81%; the mutation predicts 60% of the activity multiple of the miR-4638-3p second binding site luciferase; the results show that the two binding sites of miR-4638-3p can be regulated by combining the TUG 13' UTR, and the first binding site is slightly stronger in inhibition than the second binding site. Simultaneous mutation of the first/second binding site with a 100% fold increase in luciferase activity indicates complete mutation.

Fig. 9 is a graph comparing the activities of the groups transfected with the 3 'UTR plasmid cloned with the TUG1 gene, and it can be seen from fig. 9 that P <0.01 was very significantly different (P ═ 0.0009) in the miR group compared with the blank group and P <0.01 was very significantly different (P ═ 0.0006) in the miR group compared with the NC group, indicating that Hsa-miR-4638-3P can affect the change in the fluorescence activity thereof by binding to the 3' UTR region of the TUG1 gene. Compared with the Blank group, the hsa-miR-4638-3P inhibitor group has the advantages that the difference of P <0.01 is extremely obvious (P ═ 0.0052), the hsa-miR-4638-3P inhibitor group and the NC inhibitor group are compared, and the difference of P <0.01 is extremely obvious (P ═ 0.0022), so that the expression of endogenous miR-4638-3P in 293T cells inhibits the activity of TUG1, and the activity is obviously improved compared with Blank/NC inhibitor after the hsa-miR-4638-3P inhibitor is added.

Fig. 10 is a graph comparing the activities of the respective groups of plasmids transfected and cloned with the 3 ' UTR of mutTUG1-1 gene, and it can be seen from fig. 10 that P <0.01 difference is very significant (P ═ 0.0009) in the miR group compared with the blank group and P <0.05 difference is significant (P ═ 0.0123) in the miR group compared with the NC group in the experiment transfected and cloned with the 3 ' UTR of mutTUG1-1 gene, indicating that Hsa-miR-4638-3P can influence the change of the fluorescence activity by binding to the 3 ' UTR region of mutTUG1-1 gene. Compared with the Blank group, the hsa-miR-4638-3P inhibitor group has a remarkable difference of P <0.05 (P ═ 0.0197), and compared with the hsa-miR-4638-3P inhibitor group and the NC inhibitor group, the difference of P <0.01 is extremely remarkable (P ═ 0.0021), which indicates that the expression of miR endogenous-4638-3P in 293T cells inhibits the activity of mutTUG1-1, and the addition of the hsa-miR-4638-3P inhibitor results in a remarkable increase of the activity compared with Blank/NC inhibitor.

Fig. 11 is a graph comparing the activities of the respective groups of plasmids transfected and cloned with the 3 ' UTR of mutTUG1-2 gene, and it can be seen from fig. 11 that in the experiment transfected and cloned with the 3 ' UTR of mutTUG1-2 gene, P <0.01 difference is very significant (P ═ 0.0019) compared with the blank group, and P <0.01 difference is very significant (P ═ 0.0027) compared with the NC group in the miR group, indicating that Hsa-miR-4638-3P can influence the change of the fluorescence activity thereof by binding to the 3 ' UTR region of mutTUG1-2 gene. Compared with the Blank group, the hsa-miR-4638-3P inhibitor group has a remarkable difference of P <0.05 (P ═ 0.0158), and compared with the hsa-miR-4638-3P inhibitor group and the NC inhibitor group, the difference of P <0.05 (P ═ 0.0244) indicates that the expression of endogenous miR-4638-3P in 293T cells inhibits the activity of mutTUG1-2, and the addition of the hsa-miR-4638-3P inhibitor results in a remarkable increase of the activity compared with Blank/NC inhibitor.

FIG. 12 is a graph comparing the activities of the groups transfected with the mutTUG1-3 plasmid, and it can be seen from FIG. 12 that the miR group has no statistical difference (P ═ 0.9635) in P >0.05 compared with the blank group and no statistical difference (P ═ 0.0925) in P >0.05 compared with the NC group in the experiment transfected with the mutTUG1-3 plasmid compared with the blank group, indicating that hsa-miR-4638-3P cannot influence the change of the fluorescence activity by binding to mutTUG 1-3. The hsa-miR-4638-3P inhibitor group has no statistical difference (P is 0.3673) when compared with the blank group, and the hsa-miR-4638-3P inhibitor group has no statistical difference (P is 0.6597) when compared with the NC inhibitor group, when P is > 0.05; the mutTUG1-3 plasmid has achieved complete site-directed mutagenesis.

In the analysis of the results of FIGS. 9-12: is the significant difference, is the very significant difference.

Sequence listing

<110> king emperor

<120> method for targeted regulation of hsa-miR-4638-3p by LncRNA TUG1

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccgctcgagt ggtgctcacc aagtggtaca gccctaagc 39

<210> 2

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ataagaatgc ggccgcgaag aaatgaaatg cacactcatg gaac 44

<210> 3

<211> 1054

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cggcccgggg gctgagacga gcagtaattc taggcgatcg ctcgagtggt gctcaccaag 60

tggtacagcc ctaagcaagt gaacacaaac acatttaagt gtattttgtc tgattagatg 120

ttagccagtt atgctatttc attcaaatgt ctgaaaaaat caattgacta ttcccttttc 180

ctaaagggca gagacagata atctcacttc cagagaaatg acttggagaa aaaaaagtgt 240

tggtcttttt gctcttttgt aattaaatcc ggatgtacct caaaagactt aagactgtgg 300

tgataagatg ctttcctcag cagaaaggag ggaaaaaaaa caactggaac tcaaagcttg 360

aaattctgtg gcaaaacatg agatgtccag gattggaggt tgaaaagatt tcactacagt 420

gttctgcaat agttggagca gataactttc agtgtagcca cagccatgga ctccagattt 480

ccagattttc aagacctgga cctggaaccc gaaagagctt gtcacgatgc ggcaggaaca 540

ctggaggtag attttttttt atttttgaat tttgggactg ttgaccttgc tgtgagaaaa 600

gagacaacga ctgagcaagc actaccacca gcactgttac tgggaattag aagacctgag 660

tttctgtcca gaccctcagt gcaaactgag gatgctccat ccaaagtgaa ttatgtcctg 720

tgcctcctga ttgctgagtg ttcacctgga ccttctgact accttccctg tgctattcca 780

tcagcctaca gacctggtac ctggattttt gcccgagatg attcctacca ccttactact 840

gacgaagaca cccattccag tggaccactg tgacccagga ggcattcagc catcatgatg 900

tggcctttac ctccactcct gtcttgttct acccagattc agcacagccc tttatagtga 960

agtcagagtc ctcaagccaa atagctaaag ctgttttatc acaacaaagg cctagtttgt 1020

tccatgagtg tgcatttcat ttcttcgcgg ccgc 1054

<210> 4

<211> 1000

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tggtgctcac caagtggtac agccctaagc aagtgaacac aaacacattt aagtgtattt 60

tgtctgatta gatgttagcc agttatgcta tttcattcaa atgtctgaaa aaatcaattg 120

actattccct tttcctaaag ggcagagaca gataatctca cttccagaga aatgacttgg 180

agaaaaaaaa gtgttggtct ttttgctctt ttgtaattaa atccggatgt acctcaaaag 240

acttaagact gtggtgataa gatgctttcc tcagcagaaa ggagggaaaa aaaacaactg 300

gaactcaaag cttgaaattc tgtggcaaaa catgagatgt ccaggattgg aggttgaaaa 360

gatttcacta cagtgttctg caatagttgg agcagataac tttcagtgta gccacagcca 420

tggactccag atttccagat tttcaagacc tggacctgga acccgaaaga gcttgtcacg 480

atgcggcagg aacactggag gtagattttt ttttattttt gaattttggg actgttgacc 540

ttgctgtgag aaaagagaca acgactgagc aagcactacc accagcactg ttactgggaa 600

ttagaagacc tgagtttctg tccagaccct cagtgcaaac tgaggatgct ccatccaaag 660

tgaattatgt cctgtgcctc ctgattgctg agtgttcacc tggaccttct gactaccttc 720

cctgtgctat tccatcagcc tacagacctg gtacctggat ttttgcccga gatgattcct 780

accaccttac tactgacgaa gacacccatt ccagtggacc actgtgaccc aggaggcatt 840

cagccatcat gatgtggcct ttacctccac tcctgtcttg ttctacccag attcagcaca 900

gccctttata gtgaagtcag agtcctcaag ccaaatagct aaagctgttt tatcacaaca 960

aaggcctagt ttgttccatg agtgtgcatt tcatttcttc 1000

<210> 5

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggcaaaacat gagagagttc aaattggagg ttgaaaagat ttcactacag tgttctg 57

<210> 6

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttttcaacct ccaatttgaa ctctctcatg ttttgccaca gaatttcaag ctttgag 57

<210> 7

<211> 1054

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcggggcggg tctgagacga gcagtaattc taggcgatcg ctcgagtggt gctcaccaag 60

tggtacagcc ctaagcaagt gaacacaaac acatttaagt gtattttgtc tgattagatg 120

ttagccagtt atgctatttc attcaaatgt ctgaaaaaat caattgacta ttcccttttc 180

ctaaagggca gagacagata atctcacttc cagagaaatg acttggagaa aaaaaagtgt 240

tggtcttttt gctcttttgt aattaaatcc ggatgtacct caaaagactt aagactgtgg 300

tgataagatg ctttcctcag cagaaaggag ggaaaaaaaa caactggaac tcaaagcttg 360

aaattctgtg gcaaaacatg agagagttca aattggaggt tgaaaagatt tcactacagt 420

gttctgcaat agttggagca gataactttc agtgtagcca cagccatgga ctccagattt 480

ccagattttc aagacctgga cctggaaccc gaaagagctt gtcacgatgc ggcaggaaca 540

ctggaggtag attttttttt atttttgaat tttgggactg ttgaccttgc tgtgagaaaa 600

gagacaacga ctgagcaagc actaccacca gcactgttac tgggaattag aagacctgag 660

tttctgtcca gaccctcagt gcaaactgag gatgctccat ccaaagtgaa ttatgtcctg 720

tgcctcctga ttgctgagtg ttcacctgga ccttctgact accttccctg tgctattcca 780

tcagcctaca gacctggtac ctggattttt gcccgagatg attcctacca ccttactact 840

gacgaagaca cccattccag tggaccactg tgacccagga ggcattcagc catcatgatg 900

tggcctttac ctccactcct gtcttgttct acccagattc agcacagccc tttatagtga 960

agtcagagtc ctcaagccaa atagctaaag ctgttttatc acaacaaagg cctagtttgt 1020

tccatgagtg tgcatttcat ttcttcgcgg ccgc 1054

<210> 8

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaagacctga gtttcgagtt caaccctcag tgcaaactga ggatgctcca tccaaag 57

<210> 9

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcactgaggg ttgaactcga aactcaggtc ttctaattcc cagtaacagt gctggtg 57

<210> 10

<211> 1044

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctagctgaaa acgagcagta aattctaggc gatcgctcga gtggtgcaag tggtacagcc 60

ctaagcaagt gaacacaaac acatttaagt gtattttgtc tgattagatg ttagccagtt 120

atgctatttc attcaaatgt ctgaaaaaat caattgacta ttcccttttc ctaaagggca 180

gagacagata atctcacttc cagagaaatg acttggagaa aaaaaagtgt tggtcttttt 240

gctcttttgt aattaaatcc ggatgtacct caaaagactt aagactgtgg tgataagatg 300

ctttcctcag cagaaaggag ggaaaaaaaa caactggaac tcaaagcttg aaattctgtg 360

gcaaaacatg agatgtccag gattggaggt tgaaaagatt tcactacagt gttctgcaat 420

agttggagca gataactttc agtgtagcca cagccatgga ctccagattt ccagattttc 480

aagacctgga cctggaaccc gaaagagctt gtcacgatgc ggcaggaaca ctggaggtag 540

attttttttt atttttgaat tttgggactg ttgaccttgc tgtgagaaaa gagacaacga 600

ctgagcaagc actaccacca gcactgttac tgggaattag aagacctgag tttcgagttc 660

aaccctcagt gcaaactgag gatgctccat ccaaagtgaa ttatgtcctg tgcctcctga 720

ttgctgagtg ttcacctgga ccttctgact accttccctg tgctattcca tcagcctaca 780

gacctggtac ctggattttt gcccgagatg attcctacca ccttactact gacgaagaca 840

cccattccag tggaccactg tgacccagga ggcattcagc catcatgatg tggcctttac 900

ctccactcct gtcttgttct acccagattc agcacagccc tttatagtga agtcagagtc 960

ctcaagccaa atagctaaag ctgttttatc acaacaaagg cctagtttgt tccatgagtg 1020

tgcatttcat ttcttcgcgg ccgc 1044

<210> 11

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gaagacctga gtttcgagtt caaccctcag tgcaaactga ggatgctcca tccaaag 57

<210> 12

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gcactgaggg ttgaactcga aactcaggtc ttctaattcc cagtaacagt gctggtg 57

<210> 13

<211> 1044

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cggagaacga gcagtaattc taggcgatcg ctcgagtggt gctcaccaag tggtacagcc 60

ctaagcaagt gaacacaaac acatttaagt gtattttgtc tgattagatg ttagccagtt 120

atgctatttc attcaaatgt ctgaaaaaat caattgacta ttcccttttc ctaaagggca 180

gagacagata atctcacttc cagagaaatg acttggagaa aaaaaagtgt tggtcttttt 240

gctcttttgt aattaaatcc ggatgtacct caaaagactt aagactgtgg tgataagatg 300

ctttcctcag cagaaaggag ggaaaaaaaa caactggaac tcaaagcttg aaattctgtg 360

gcaaaacatg agagagttca aattggaggt tgaaaagatt tcactacagt gttctgcaat 420

agttggagca gataactttc agtgtagcca cagccatgga ctccagattt ccagattttc 480

aagacctgga cctggaaccc gaaagagctt gtcacgatgc ggcaggaaca ctggaggtag 540

attttttttt atttttgaat tttgggactg ttgaccttgc tgtgagaaaa gagacaacga 600

ctgagcaagc actaccacca gcactgttac tgggaattag aagacctgag tttcgagttc 660

aaccctcagt gcaaactgag gatgctccat ccaaagtgaa ttatgtcctg tgcctcctga 720

ttgctgagtg ttcacctgga ccttctgact accttccctg tgctattcca tcagcctaca 780

gacctggtac ctggattttt gcccgagatg attcctacca ccttactact gacgaagaca 840

cccattccag tggaccactg tgacccagga ggcattcagc catcatgatg tggcctttac 900

ctccactcct gtcttgttct acccagattc agcacagccc tttatagtga agtcagagtc 960

ctcaagccaa atagctaaag ctgttttatc acaacaaagg cctagtttgt tccatgagtg 1020

tgcatttcat ttcttcgcgg ccgc 1044

Claims (7)

1. A method for targeted regulation of hsa-miR-4638-3p by LncRNA TUG1 is characterized by comprising the following steps:

step 1, constructing a wild-type TUG1 double-report vector;

or constructing a vector for predicting the first binding site of Hsa-miR-4638-3p by mutation;

or constructing a second binding site vector for predicting Hsa-miR-4638-3p through mutation;

or constructing a double mutation prediction Hsa-miR-4638-3p binding site vector;

the sequence of the first binding site is: tgtccagg;

the mutated sequence of the first binding site is: gagttcaa;

the sequence of the second binding site is: tgtccag;

the mutated sequence of the second binding site is: gagttca;

step 2, cotransfecting the cell with the microRNA and the plasmid

Cell transfection is carried out by adopting a cationic liposome method;

step 3, Lucifersae detection

And (3) carrying out Luciferase activity detection on the sample obtained in the step (2).

2. The method of claim 1, wherein the wild-type TUG1 double reporter vector construction in step 1 is as follows:

1. the TUG1 sequence;

the sequence of the first binding site is: tgtccagg;

the sequence of the second binding site is: tgtccag;

2. amplification primer sequences:

TUG1-XhoIF：

5'CCGCTCGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGC 3'；

TUG1-NotIR：

5'ATAAGAATGCGGCCGCGAAGAAATGAAATGCACACTCATGGAAC 3'；

3. PCR fishing gene:

1> template cDNA preparation

1. Total RNA extraction

1) Centrifuging to collect 293T cells of human, adding 1mL Trizol solution, blowing, beating and mixing uniformly to fully crack the cells, and standing for 5 min;

2) adding 200 μ L chloroform, shaking and mixing for 30s to make the water phase and organic phase contact sufficiently, standing at room temperature for 15 min;

3) centrifuging at 4 deg.C for 15min at 10000g, and transferring RNA in the upper aqueous phase to another new RNase free EP tube;

4) and (3) RNA precipitation: adding 0.5mL of isopropanol, uniformly mixing, and standing at room temperature for 10 min;

5) centrifuging at 4 deg.C for 10min at 10000g, collecting RNA precipitate, and removing supernatant;

6) washing twice with 75% ethanol, and air drying on a super clean bench;

7) adding 15-50 mu L DEPC water to dissolve the precipitate;

2. total RNA purity and integrity assays

1) And (3) purity detection: taking 1 microliter of RNA sample for 50 times dilution, determining the OD value, wherein the ratio of OD260/OD280 is more than 1.8, which indicates that the prepared RNA is purer and has no protein pollution;

2) total RNA integrity test: taking 1 mu L of RNA sample, carrying out electrophoresis on 1% agarose gel for 80V multiplied by 20min, observing 5s rRNA, 18s rRNA and 28s rRNA bands of total RNA by using a gel imaging system after EB is stained for 10min, and if the three bands are complete, the total RNA extraction can be proved to be complete;

3. reverse transcription

1) The following solutions were placed in a PCR tube of RNase free: total RNA0.75 μ g, adding water to Total volume of 12 μ L;

2) blowing and beating the solution uniformly, and keeping the temperature at 65 ℃ for 5min to denature RNA; immediately followed by ice cooling to prevent RNA renaturation;

3) the following reagents were added to the PCR tube: oligo 0.5. mu.L, Random primer 0.5. mu.L, 10mM dNTP 2.0. mu.L, RNase inhibitor 0.5. mu.L, 5 XBuffer 4.0. mu.L, M-MLV 0.5. mu.L;

4) keeping the temperature of the 20 mu L reaction solution at 30 ℃ for 10 min;

5) keeping the temperature at 42 ℃ for 60 min;

6) keeping the temperature at 72 ℃ for 10 min;

7) storing at-20 deg.C;

2> PCR reaction system

The following system was prepared in a 0.2mL EP tube, and 0.5. mu.L of amplified TUG1 was taken after diluting the template stock solution 20-fold:

2mM dNTP mixture 2.5μL，10×KOD buffer 2.5μL，25mM MgSO₄1.5. mu.L, template 0.5. mu.L, primer TUG 1F 0.3. mu.L, primer TUG 1R 0.3. mu.L, KOD Plus Neo 0.3. mu.L, ddH₂O 17.1μL；

3> amplification conditions

Amplification after mixing, amplification conditions of the TUG1 gene: 94 deg.C, 1min, 98 deg.C, 15sec, 58 deg.C, 15sec, 68 deg.C, 1min, 68 deg.C, 5min, 30 cycles; storing at 16 deg.C;

4> PCR product recovery

8) After carrying out 1% gel electrophoresis on the PCR product, cutting a gel strip containing the target gene fragment into a clean 1.5mL EP tube by using a scalpel under an ultraviolet lamp, weighing, and adding the solution BD into a centrifuge tube according to the proportion of 100mg of gel to 100 mu L of the solution BD;

9) water bath at 60 deg.C for 10min until the gel is completely dissolved, and shaking and mixing for 3 times during the water bath period;

10) transferring the solution to a DNA purification column, standing for 2min, centrifuging at the room temperature of 12000rpm for 1min, and removing the filtrate;

11) adding 500 μ L of solution PE onto the column, centrifuging at 12000rpm for 1min at room temperature, and removing the filtrate;

12) repeating the last operation once;

13) centrifuging at 12000rpm for 1min to completely remove the residual liquid in the column;

14) the column was placed on a new 1.5mL EP tube, 30. mu.L of 60 ℃ preheated sterile water was added to the center of the column, and 13400g was centrifuged for 1min to elute the DNA;

4. PCR recovery product and vector double digestion

In 2 sterile 0.2mL EP reaction tubes, 15. mu.L each of the TUG1 PCR-recovered product and the psiCHECK-2 vector were separately digested with XhoI/NotI, as follows: XhoI 1.5. mu.L, NotI 1.5. mu.L, 10 XBuffer 5. mu.L, ddH₂O27 mu L; after mixing evenly, reacting for 2.5-3.5h at 37 ℃;

5. recovery of the digestion product

1) After carrying out 1% gel electrophoresis on the enzyme digestion product, respectively cutting gel strips containing target fragments and a carrier into a clean 1.5mL EP tube by using a scalpel under an ultraviolet lamp, and adding a solution BD into a centrifuge tube according to the proportion that 100mg of gel corresponds to 100 mu L of the solution BD;

2) water bath at 60 deg.C for 10min until the gel is completely dissolved, and shaking and mixing for 3 times during the water bath period;

3) transferring the solution to a DNA purification column, standing for 2min, centrifuging at the room temperature of 12000rpm for 1min, and removing the filtrate;

4) adding 500 μ L of solution PE onto the column, centrifuging at 12000rpm for 1min at room temperature, and removing the filtrate;

5) repeating the last operation once;

6) centrifuging the empty column at 12000rpm for 1min to completely remove the residual liquid in the purification column;

7) the column was placed on a new 1.5mL EP tube, 30. mu.L of 60 ℃ preheated sterile water was added to the center of the column, and 13400g was centrifuged for 1min to elute the DNA;

6. linking the target fragment with a vector:

to a 0.2mL EP tube were added the following reagents: mu.L of the recovered TUG1 PCR product by digestion, 2. mu.L of the recovered psiCHECK-2 vector by digestion, 1. mu.L of 10 XLigase Buffer, 1. mu.L of T4 DNA Ligase, ddH₂O3 mu L; connecting for 1h at 16 ℃;

7. conversion of ligation products

1) Respectively adding 5 mu L of the ligation product into 50 mu L of DH5 alpha competent cells in ice bath, rotating and uniformly mixing, and carrying out ice bath for 30 min;

2) water bath heat shock at 42 ℃ for 90 s;

3) the tube was transferred to an ice bath for 2 min;

4) respectively adding 200 μ L LB culture medium, mixing, and performing shaking culture at 37 deg.C and 200rpm for 1 h;

5) uniformly coating the bacterial liquid on an LB flat plate containing ampicillin in a superclean bench, and placing at room temperature until the liquid is absorbed;

6) inverting the plate, and transferring into a biochemical incubator at 37 ℃ for overnight culture;

8. positive clone for plasmid restriction identification

1, selecting a plurality of monoclonals from a flat plate, and carrying out shaking table overnight culture in a 3mL LB tube;

2> plasmid extraction

a) Collecting 3 mu L of bacterial liquid by using a 1.5mL EP tube, centrifuging at 12000rpm for 1min, and removing supernatant;

b) adding 250 mu L of solution I/RNaseA mixed solution, and re-suspending the thalli;

c) adding 250 μ L of solution II, gently and repeatedly reversing and mixing for 6 times, and standing at room temperature for 2 min;

d) adding 350 μ L of solution III, and gently and repeatedly reversing and mixing for 6 times;

e) centrifuging at 12000rpm for 10min, sucking out supernatant, introducing into DNA purification column, and standing for 2 min;

f) centrifuging at 12000rpm for 1min, and discarding the filtrate;

g) adding 500 μ L solution PB into the column, centrifuging at 12000rpm for 1min, and removing the filtrate;

h) adding 500 μ L of solution W into the column, centrifuging at 12000rpm for 1min, discarding the filtrate, and repeating once;

i) centrifuging the hollow column at 12000rpm for 3 min;

j) taking out the column, placing in a new 1.5mL EP tube, adding 50 μ L sterile water, standing for 2min, and centrifuging at 13400rpm for 1min to elute the plasmid;

3 enzyme digestion identification and extraction of plasmid

The enzyme digestion reaction system is as follows: extracted plasmids TUG13 μ L, XhoI0.4 μ L, NotI 0.4 μ L, 10 XBuffer 1 μ L, ddH₂O5.2 μ L; carrying out enzyme digestion for 2h at 37 ℃; carrying out electrophoresis separation on the enzyme digestion product by using 1% agarose gel containing ethidium bromide, and imaging by using a UVP (ultraviolet fluorescence) gel imaging system;

solution I: 50mMl glucose/10 mM EDTA/25mM Tris-HCl, pH 8.0, i.e. resuspension;

solution II: 0.2Ml NaOH/1% SDS, i.e., lysate;

solution III: 3Ml potassium acetate/2 Ml acetic acid, namely the neutralization precipitation solution.

3. The method as claimed in claim 1, wherein the step of mutational prediction of Hsa-miR-4638-3p first binding site vector construction in step 1 is as follows:

1. TUG1 sequence

The sequence of the first binding site is: tgtccagg;

the mutated sequence of the first binding site is: gagttcaa;

2. amplification primer sequences:

mutTUG1-1F：

5'GGCAAAACATGAGAGAGTTCAAATTGGAGGTTGAAAAGATTTCACTACAGTGTTCTG 3'；

mutTUG1-1R：

5'TTTTCAACCTCCAATTTGAACTCTCTCATGTTTTGCCACAGAATTTCAAGCTTTGAG 3'；

3. gene mutation:

1> PCR reaction System

The following system was prepared in a 0.2mL PCR reaction tube, the template was the constructed TUG1 plasmid, and 1. mu.L of the plasmid was diluted 50 times and used as the template:

2mM dNTP mixture 2.5μL，10×KOD buffer 2.5μL，25mM MgSO₄1.5. mu.L, primer mutTUG1-1F 0.3. mu.L, primer mutTUG1-1R 0.3. mu.L, KOD plus neo 0.3. mu.L, ddH₂O16.6μL；

2> amplification conditions

Amplification after mixing, the amplification condition of mutTUG1-1 gene: 94 deg.C, 1min, 98 deg.C, 15sec, 58 deg.C, 15sec, 68 deg.C, 4min30 sec, 68 deg.C, 5min, 20 cycles; storing at 16 deg.C;

3> the PCR product was digested with DpnI

Add 1. mu.L DpnI enzyme to PCR tube, digest for 4h at 37 ℃;

4> transformation of the PCR product treated by DpnI, step 7 of constructing a double report vector with wild type TUG 1;

5, selecting 1 colony to extract plasmids, and constructing the plasmids with a wild-type TUG1 double-reporting vector in the step 8;

and 6> sample sending and sequencing.

4. The method as claimed in claim 1, wherein the step of constructing the mutant predicted Hsa-miR-4638-3p second binding site vector in step 1 is as follows:

1. TUG1 sequence

The sequence of the second binding site is: tgtccag;

the mutated sequence of the second binding site is: gagttca;

2. amplification primer sequences:

mutTUG1-2F：

5'GAAGACCTGAGTTTCGAGTTCAACCCTCAGTGCAAACTGAGGATGCTCCATCCAAAG 3'；

mutTUG1-2R：

5'GCACTGAGGGTTGAACTCGAAACTCAGGTCTTCTAATTCCCAGTAACAGTGCTGGTG 3'；

3. gene mutation:

1> PCR reaction System

Configuring the following system in a 0.2mL PCR reaction tube, wherein a template is a constructed TUG1 plasmid, and taking 1 mu L of diluted plasmid as the template;

2mM dNTP mixture 2.5μL，10×KOD buffer 2.5μL，25mM MgSO₄1.5. mu.L, primer mutTUG1-2F 0.3. mu.L, primer mutTUG1-2R 0.3. mu.L, KOD plus neo 0.3. mu.L, ddH₂O 16.6μL；

2> amplification conditions

Amplification after mixing, the amplification conditions of mutTUG1-2 gene: 94 deg.C, 1min, 98 deg.C, 15sec, 58 deg.C, 15sec, 68 deg.C, 4min30 sec, 68 deg.C, 5min, 20 cycles; storing at 16 deg.C;

3> the PCR product was digested with DpnI

Add 1. mu.L DpnI enzyme to PCR tube, digest for 4h at 37 ℃;

4> transformation of the PCR product treated by DpnI, step 7 of constructing a double report vector with wild type TUG 1;

5, selecting 1 colony to extract plasmids, and constructing the plasmids with a wild-type TUG1 double-reporting vector in the step 8;

and 6> sample sending and sequencing.

5. The method as claimed in claim 1, wherein the construction of the double mutation prediction Hsa-miR-4638-3p binding site vector comprises the following steps:

1. the TUG1 sequence;

the sequence of the first binding site is: tgtccagg;

the mutated sequence of the first binding site is: gagttcaa;

the sequence of the second binding site is: tgtccag;

the mutated sequence of the second binding site is: gagttca;

2. amplification primer sequences:

mutTUG1-2F：

5'GAAGACCTGAGTTTCGAGTTCAACCCTCAGTGCAAACTGAGGATGCTCCATCCAAAG 3'

mutTUG1-2R：

5'GCACTGAGGGTTGAACTCGAAACTCAGGTCTTCTAATTCCCAGTAACAGTGCTGGTG 3'

3. gene mutation:

1> PCR reaction System

The following system was prepared in a 0.2ml PCR reaction tube, the template was mutated mutTUG1-1 plasmid, and 1. mu.L of the plasmid was diluted 50-fold and used as template:

2mM dNTP mixture 2.5μL，10×KOD buffer 2.5μL，25mM MgSO₄1.5. mu.L, primer mutTUG1-2F 0.3. mu.L, primer mutTUG1-2R 0.3. mu.L, KOD plus neo 0.3. mu.L, ddH₂O 16.6μL；

2> amplification conditions

Amplification after mixing, the amplification condition of mutTUG1-3 gene: 94 deg.C, 1min, 98 deg.C, 15sec, 58 deg.C, 15sec, 68 deg.C, 4min30 sec, 68 deg.C, 5min, 20 cycles; storing at 16 deg.C;

3> the PCR product was digested with DpnI

Add 1. mu.L DpnI enzyme to PCR tube, digest for 4h at 37 ℃;

4> transformation of the PCR product treated by DpnI, step 7 of constructing a double report vector with wild type TUG 1;

5, selecting 1 colony to extract plasmids, and constructing the plasmids with a wild-type TUG1 double-reporting vector in the step 8;

and 6> sample sending and sequencing.

6. The method according to claim 1, characterized in that step 2 comprises in particular the steps of:

(1) one day before transfection, cells were at 2X 10⁴Inoculating the cells/well on a 24-well plate, wherein a culture medium is DMEM high-sugar containing 10% FBS;

(2) on the day of transfection, the confluency of cells was about 50-60%, the old medium was aspirated off, washed twice with PBS, and 300. mu.L of OPTI-MEM medium was added to each well and placed in 5% CO₂37 ℃ incubator;

(3) diluting cellfectin II Reagent1 μ L with OPTI-MEM medium in each well to a final volume of 50 μ L, and standing at room temperature for 5 min;

(4) adding 20 mu M hsa-miR-4638-3p1 mu L or hsa-miR-4638-3p inhibitor and 0.5 mu g plasmid into each well, adding OPTI-MEM to total volume of 50 mu L, and standing at room temperature for 5 min;

(5) compounding the diluent in the step (3) and the diluent in the step (4), and standing for 20min at room temperature;

(6) adding 100 mu L of the transfection complex solution in the volume ratio of 5 into each hole, shaking the 24-hole plate and mixing uniformly;

(7) at 5% CO₂Incubate at 37 ℃ for 5h, replacing the medium containing the transfection complex with the complete medium.

7. The method according to claim 1, characterized in that step 3 comprises in particular the steps of:

after transfection for 48h, the old culture medium was aspirated, washed twice with PBS, 100. mu.L of PLB was added to each well of cells, shaken at room temperature for 15min, and cell lysates were collected; the determination of the Luciferase activity in the sample was carried out by the Dual-Luciferase Reporter Assay System of Promega.

Images