CN111455056A - lncRNA marker derived from adipose cell exosome and application and product thereof - Google Patents

Abstract

The invention discloses an lncRNA marker derived from an adipocyte exosome, and application and a product thereof, wherein the lncRNA marker is a long-chain non-coding RNA TUG1 gene or a homolog, mutation or an isoform thereof, and the lncRNA TUG1 is derived from an exosome or a body fluid exosome secreted by a breast cancer cell, a tumor interstitial adipocyte or a tumor interstitial fibroblast; lncRNA TUG1 is highly expressed in mast adipocytes and breast cancer, and can be transmitted from adipocytes to breast cancer cells via exosomes. The lncRNA marker derived from the adipose cell exosomes is a product for detecting tumor interstitial adipose cells and tumor self long-chain non-coding RNA TUG1, provides a basis for early diagnosis of breast cancer, takes long-chain non-coding RNA TUG1 as a treatment target, is applied to clinic as an index of disease treatment, and provides a theoretical basis for prevention and mechanism research of the breast cancer.

Description

lncRNA marker derived from adipose cell exosome and application and product thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to an lncRNA marker derived from an adipocyte exosome, and application and a product thereof.

Background

Breast cancer is one of the most common malignancies in women worldwide. In recent years, the morbidity and mortality of women with breast cancer in China have a rising trend, the current incidence rate is the first of the malignant tumors of women in China, and the incidence age has a youthful trend in recent years. At present, the treatment method for the breast cancer mainly comprises modes of operation treatment, (new) auxiliary chemotherapy, auxiliary radiotherapy, endocrine treatment, targeted treatment and the like, and a reasonable treatment mode is adopted at different stages to obtain a better treatment effect. However, some patients still have relapse and distant metastasis, which are the main cause of death of breast cancer patients and seriously affect the physical and mental health of women and even endanger life.

Recent studies have shown that only less than 2% of genes in the mammalian genome encode proteins, and about 98% of other genes encode non-coding RNAs, which are generally classified into two types, one type is Small non-coding RNAs (sncrnas), which are transcribed by less than 200 nucleotides, and the other type is long non-coding RNAs (L ong non-coding RNAs, lncrnas), which are broadly defined as RNAs, which are transcribed by more than 200 nucleotides and have no apparent coding ability, according to their lengths, L ncrnas have complex secondary and tertiary structures, and can bind to proteins, RNAs, and DNAs, and thus lncrnas provide a platform for complex interactions among mirnas, mrnas, proteins, or complexes thereof.

Long non-coding RNA TUG1 is located on human chromosome 22 with a gene ID of 55000 that produces a long non-coding RNA that plays a role in epigenetic regulation of transcription. This RNA promotes cell proliferation and is upregulated in tumor cells.

Patent application publication No. CN 108289906 a, entitled antitumor drug delivery preparation, discloses an antitumor drug delivery preparation for treating a subject having a tumor highly expressing the TUG1 gene compared to normal tissues or preventing metastasis of the tumor, characterized by containing, as an active ingredient, a polymeric micelle containing a nucleic acid that inhibits high expression of the TUG1 gene; the polymer micelle contains: a block copolymer having a cationic polyamino acid segment and a hydrophilic polymer segment, and the nucleic acid; the nucleic acid is combined with the cationic group of the cationic polyamino acid chain segment to form a complex and/or the nucleic acid is entrapped or attached inside the micelle; and the polymer micelle is accumulated in the tumor.

At present, most of TUG1 genes researched in the prior art are derived from tumor cells and act on the tumor cells, and no related research on TUG1 gene exosomes exists, and the invention provides an lncRNA marker derived from an adipocyte exosome and application and a product thereof by researching the expression conditions of lncRNA in breast cancer and tumor interstitial cell-derived exosomes and regulating and controlling the biological behavior of the breast cancer, and has important significance for realizing accurate diagnosis and personalized treatment of breast cancer.

Disclosure of Invention

The lncRNA marker from the adipose cell exosomes is a product for detecting tumor interstitial adipose cells and tumor self long-chain non-coding RNA TUG1, provides a basis for early diagnosis of breast cancer, takes long-chain non-coding RNA TUG1 as a treatment target, is applied to clinic as an index for disease treatment, and provides a theoretical basis for prevention and mechanism research of the breast cancer.

The technical scheme of the invention is that the lncRNA marker is derived from an adipocyte exosome, and application and a product thereof, wherein the lncRNA marker is a long-chain non-coding RNA TUG1 gene or a homolog, a mutation or an isoform thereof, and lncRNATUG1 is derived from an exosome or a body fluid exosome secreted by a breast cancer cell, a tumor interstitial adipocyte or a tumor interstitial fibroblast; lncRNA TUG1 is highly expressed in mast adipocytes and breast cancer, and can be transmitted from adipocytes to breast cancer cells via exosomes.

IncRNA TUG1 is located on human chromosome 22 with a gene ID of 55000. Including the lncRNA TUG1 gene and homologs, mutations, and isoforms thereof. The term encompasses full-length, unprocessed lncRNA TUG1, as well as any form of lncRNA TUG1 that results from processing in the cell, secretion outside the cell, and in exosomes. The term encompasses naturally occurring variants of lncRNA TUG 1. The term encompasses the gene sequence of human lncRNA TUG1, as well as lncrnaatug 1 gene sequences from any other vertebrate source. Currently, the incrna TUG1 disclosed in the genebank database has 8 transcripts, when the sequencing result is subjected to bioinformatics analysis, the sequencing result is usually compared with a known genome, and as long as the sequencing fragment can be compared with the related gene, the expression of the gene can be regarded, so that different transcription products of the incrna TUG1 are also included in the invention.

The application of the lncRNA marker derived from the fat cell exosome in preparing a product for diagnosing breast cancer, in particular to a product for in vitro detecting the expression level of lncRNA TUG1 in a sample, which is a preparation, a chip or a kit. The in vitro test sample comprises cells, tissues or body fluids, including but not limited to breast cancer, tumor stromal adipocytes, tumor stromal fibroblasts, cell-derived exosomes secreted by the above cells, body fluid-derived exosomes. Body fluids include blood, lymph, urine, saliva, nipple aspirates, gynecological fluids, or any other bodily exudate or derivative thereof. Blood may include whole blood, plasma, serum or any blood derivative.

The breast cancer diagnosis product comprises:

(1) a primer/primer set or probe that recognizes the lncRNA TUG1 sequence;

(2) a small molecule compound that recognizes the incrna TUG1 sequence or a biological macromolecule that recognizes the incrna TUG1 sequence, said biological macromolecule comprising: an RNA binding protein or a functional fragment thereof, a fluorescently labeled RNA binding protein or a functional fragment thereof.

The lncRNA marker derived from the fat cell exosome is applied to preparation of a product for treating breast cancer.

The product for treating breast cancer comprises at least one of the following components:

(1) a siRNA, shRNA, sgRNA or small interfering RNA probe with similar functions for inhibiting the lncRNA TUG1 sequence;

(2) an oligonucleotide fragment that inhibits the IncRNA TUG1 sequence, said oligonucleotide fragment comprising antisense oligonucleotide ASO, locked nucleic acid L NA or a functionally similar chemically modified oligonucleotide;

(3) a small molecule compound that inhibits the lncRNA TUG1 sequence;

(4) a biomacromolecule that inhibits the lncRNA TUG1 sequence;

(5) a tool molecule that knockdown or disrupts the lncRNA TUG 1.

The biomacromolecule in the step (4) is an enzyme with high substrate specificity or a functional fragment thereof.

The tool molecule for knocking out or destroying the lncRNA TUG1 in the step (5) comprises at least one of DNA homologous recombination plasmid, TA L EN-TA L EA targeted gene knockout plasmid system, Cre/L oxp plasmid system, inducible Cre/L oxp plasmid system such as tetracycline/interferon and CRISPR gene editing plasmid system such as CRISPR/Cas 9.

In the present invention, a "probe" in reference to a therapeutic agent refers to a molecule that is capable of binding to a specific sequence or subsequence or other portion of another molecule. Unless otherwise indicated, the term "probe" generally refers to a polynucleotide probe that is capable of binding to another polynucleotide (often referred to as a "target polynucleotide") by complementary base pairing.

The breast cancer comprises invasive ductal carcinoma and invasive lobular carcinoma as pathological types.

The breast cancer comprises four molecular types, namely L tubular A type, L tubular B type, three-negative type and HER-2 overexpression type.

An application of lncRNA marker derived from an adipocyte exosome in constructing a calculation model for predicting breast cancer prognosis.

A product for treating breast cancer is prepared by taking lncRNA TUG1 as a target sequence and designing 2 target site sequences aiming at lncRNA TUG1 according to shRNA design principle, and synthesizing corresponding sequences:

LV3-homo-shTUG1-1 GCTTGGCTTCTATTCTGAATCCTTT

LV3-homo-shTUG1-2 GCTCCATCCAAAGTGAATTAT；

these sequence linkers were designed to anneal to form sticky ends of BamHI and EcoRI; the shRNA lentiviral expression vector of the IncRNA TUG1 is constructed through the steps of enzyme digestion, linkage, identification, sequencing and the like.

In the present invention, the step of correlating the levels of lncRNA TUG1 with a certain likelihood or risk can be performed and realized in different ways. Preferably, the measured concentrations of the gene and one or more other markers are mathematically combined and the combined value is correlated to the underlying diagnostic problem. The determination of lncrnaatug 1 values can be combined by any suitable prior art mathematical method. Such values can be readily correlated to an individual's risk for breast cancer or to other diagnostic uses of interest that are helpful in assessing breast cancer patients, based on diagnostic questions. In a preferred manner, such a logarithmic function is obtained as follows: a) classifying individuals into groups, e.g., normal humans, individuals at risk for breast cancer, breast cancer patients, etc., b) identifying markers that differ significantly between these groups by univariate analysis, c) logistic regression analysis to assess independent difference values of the markers that can be used to assess these different groups, and d) constructing a logistic function to combine the independent difference values. In this type of analysis, the markers are no longer independent, but represent a combination of markers.

The invention has the beneficial effects that:

current epidemiological studies indicate that obesity can affect the occurrence, development and prognosis of a variety of tumors. In breast cancer, obesity is positively correlated with poor staging of the tumor, lymph node positivity and recurrence, or distant metastasis. The risk of metastasis and mortality in obese breast cancer patients is also significantly increased compared to normal weight patients.

Interstitial cells in the tumor microenvironment can be mutually regulated and controlled with tumor cells, so that the prognosis of the tumor is influenced. For example, tumor adipocytes are capable of secreting soluble cytokines and inflammatory chemokines that promote the localization of hematopoietic cells to distant organs, thus creating a metastasizing microenvironment for circulating tumor cells. In normal breast tissue, fat cells are the most abundant cells in the stroma, and are in direct contact with mammary epithelial cells, and participate in regulating the physiological activities of the mammary epithelial cells. During the occurrence and development of breast cancer, fat cells around the tumor are activated into tumor associated fat Cells (CAA), and the growth and metastasis of the tumor can be promoted by secreting various cytokines to form an inflammatory microenvironment. Therefore, the role of adipocytes in breast cancer metastasis is critical.

In addition to soluble cytokines, extracellular vesicles are also one of the important factors secreted by cells, wherein lipid bilayer membrane vesicles derived from a multivesicular body are currently considered as key factors for mediating the communication between tumor cells and microenvironment cells.

Besides carrying proteins in exosomes, lncRNA is also one of the important components in exosomes. The research on the expression conditions of lncRNA in the breast cancer and tumor interstitial cell-derived exosomes and the regulation and control of the lncRNA on the biological behavior of the breast cancer have important significance for realizing accurate diagnosis and personalized treatment of the breast cancer.

The invention can judge the breast cancer by detecting the expression level of the marker lncRNA TUG1 in tissues and body fluids through a molecular marker which is derived from an adipose cell exosome and can diagnose and treat the breast cancer, intervenes the breast cancer by using a targeting preparation and reduces the level of the breast cancer, thereby realizing early diagnosis and early treatment of diseases and improving the prognosis of patients.

The invention provides a calculation evaluation model for finding genes closely related to the occurrence and prognosis of breast cancer, and provides a theoretical basis for scientific research of breast cancer.

Description of the drawings:

FIG. 1 is a graph showing the staining of oil red O after Palmitic Acid (PA) induced hypertrophy after adipogenesis in 3T 3-L1 cells;

FIG. 2 is a graph showing staining of oil red O after adipogenesis induced by 3T 3-L1 cells, without fatty acid BSA induced hypertrophy;

FIG. 3 shows the electron microscope image of the adipocytes derived exosomes identified in the supernatant after PA induction;

FIG. 4 shows a diagram of the electron microscopy identification of adipocytes derived exosomes in the supernatant after BSA induction;

FIG. 5 is a diagram showing a particle size distribution diagram of exosome particles from adipocyte sources analyzed and identified by a nanometer particle size analyzer after exosomes are collected in supernatant after PA induction;

FIG. 6 is a diagram showing a particle size distribution diagram of exosome derived from adipocytes analyzed and identified by a nanometer particle sizer after exosomes are collected in supernatant after BSA induction;

FIG. 7 is a photograph showing staining of adipocytes derived exosomes into breast cancer cells;

FIG. 8 is a photograph showing the invasion and migration changes and blank control after the addition of exosomes to MDA-MB-231 cells;

figure 9 shows the invasion and migration changes of MDA-MB-231 cells after exosome addition and blank control histograms, where p, p <0.05, p, 0.01, p < 0.001;

FIG. 10 is a photograph showing the invasion and migration changes of 4T1 cells after addition of exosomes and a blank control;

FIG. 11 is a bar graph showing the change in invasion and migration of 4T1 cells after addition of exosomes and a blank control,

wherein p <0.05, p <0.01, p < 0.001;

FIG. 12 shows the results of exosome lncRNA chip analysis;

fig. 13 shows a histogram of lncRNA TUG1 expression in mast adipocyte cells, where, p < 0.05;

fig. 14 shows a histogram of lncRNA TUG1 expression in secreted exosomes, where, p < 0.05;

FIG. 15 shows a graph of IncRNA TUG1 expression in human mammary epithelial cells and breast cancer cells;

FIG. 16 shows the effect of human breast cancer cells MDA-MB-231 after knocking down lncTUG1 using target sequence L V3-homo-shTUG1-1, wherein, p <0.001, ns, has no meaning;

FIG. 17 shows the effect of human breast cancer cells MDA-MB-231 after knocking down lncTUG1 using target sequence L V3-homo-shTUG1-2, wherein, p <0.001, ns, has no significance;

FIG. 18 is a graph showing the change in migration and invasion capacity of human breast cancer cells MDA-MB-231 after knocking down lncRNA TUG 1;

FIG. 19 is a graph showing a comparison of the expression difference of IncRNA TUG1 in breast cancer tissue and normal tissue;

FIG. 20 is a graph showing the relationship between Kaplan-Meier Plotter analysis of TUG1 (Probe ID: 228397_ at) and total survival (OS) of breast cancer;

FIG. 21 is a graph showing the relationship between Kaplan-Meier Plotter analysis of TUG1 (probe ID: 212725_ at) and total survival (OS) of breast cancer;

FIG. 22 is a graph showing the relationship of Kaplan-Meier Plotter analysis of TUG1 (probe ID: 228397_ at) with breast cancer Distant Metastasis Free Survival (DMFS);

FIG. 23 shows the relationship of Kaplan-Meier Plotter analysis of TUG1 (probe ID: 212725_ at) with breast cancer metastasis free survival (DMFS).

The specific implementation mode is as follows:

for better understanding of the present invention, the technical solution of the present invention will be described in detail with specific examples, but the present invention is not limited thereto.

lncRNA TUG1, whose expression was increased in both breast cancer and mast adipocytes, suggested that it has characteristics for diagnosing breast cancer. Meanwhile, the lncRNA TUG1 can be transmitted into breast cancer cells from mast fat cells through exosomes, so that invasion and metastasis of the breast cancer cells are remarkably promoted, and the important potential of treating breast cancer metastasis is shown. The specific contents are as follows:

1) the method is characterized in that lipogenesis is induced in vitro, lipid drop enlargement is induced by using Palmitic Acid (PA), the fat cell hypertrophy process is simulated, and it is found that the secretion from the fat cell can enter breast cancer cells and obviously promote tumor metastasis.

2) lncRNA TUG1 was significantly upregulated in mast adipocyte-derived exosomes.

3) The expression of lncRNA TUG1 in breast cancer cells is obviously higher than that of normal mammary epithelial cells, and after the expression of lncRNA TUG1 is reduced by using lentivirus, the invasion and migration capacity of the breast cancer cells is obviously reduced.

4) The lncRNA TUG1 was found to be significantly associated with Distant Metastasis Free Survival (DMFS) in breast cancer patients by TCGA database analysis.

Therefore, the invention can judge the breast cancer by detecting the expression level of the marker lncRNA TUG1 in tissues and body fluids through a molecular marker which is derived from an adipose cell exosome and can diagnose and treat the breast cancer, intervenes the breast cancer by using a targeting preparation, and reduces the level of the breast cancer, thereby realizing early diagnosis and early treatment of diseases and improving the prognosis of patients.

The present invention will be further described with reference to the following examples.

The 3T 3-L1 fat precursor cell line, MDA-MB-231 cell, 4T1 cell, MCF-7 cell, SK-BR-3 cell and MCF-10A, HEK293T cell are all commercially available conventional cell lines.

Example 1

Induces adipocyte formation in vitro, stimulates lipid droplet hypertrophy by using PA, and simulates the adipocyte hypertrophy process in vitro.

1.3 induced differentiation of the T3-L1 adipogenic precursor cell line

1) Inoculating 3T 3-L1 lipo precursor cells in culture plate, culturing with high glucose DMEM containing 10% fetal calf serum at 37 deg.C and 5% CO₂And (5) culturing.

2) After the cells are fully grown to 80-90 percent and fused for 2 days (the fusion means that the cells are contacted and inhibited, namely, the cells are changed after being fully grown and are allowed to grow for two more days), 10 percent fetal calf serum high-sugar DMEM containing 0.5 mmol/L IBMX (storage solution concentration is 0.5 mmol/L) and 1 umol/L (storage solution concentration is 1mg/ml (2.5 mmol/L)) dexamethasone and 10 percent insulin with a final concentration of 10ug/ml is added for culturing for 48 hours, and the inducer is added into the culture solution and mixed evenly when being used.

3) And after 48 hours, changing 10% fetal calf serum high-sugar DMEM culture solution containing 10ug/ml insulin for culturing for 48 hours, changing 10% fetal calf serum high-sugar DMEM for continuous culture after 48 hours, changing the culture solution once after 2 days, inducing and differentiating for 8-12 days, wherein 90% of 3T 3-L1 cells are more in a mature adipocyte phenotype, and using the mature adipocyte phenotype for further experiments.

PA induced lipid droplet enlargement

1) 20mg of NAOH was weighed out on a balance and dissolved in 5ml of double distilled water to obtain a 0.1M NAOH solution. 12.8mg of Palmitic Acid (PA) was weighed, added to 0.1M NAOH 500ul and water-washed at 70 ℃ for 30min to dissolve the PA sufficiently, with the PA concentration being 100 mM.

2) 1g of fatty acid-free BSA powder was weighed and dissolved in 10ml of double distilled water to prepare a 10% BSA solution.

3) A pipette sucks 500ul of 100mM PA solution, adds the solution into 9.5ml of 10% BSA solution, carries out water bath at 55 ℃ for 10min to prepare a 5mM palmitic acid stock solution, and stores the palmitic acid stock solution at 4 ℃ for later use after being filtered by a 0.22um pore size filter.

4) To induce lipid droplet hypertrophy, adipocytes were treated for 24 hours with 10% fetal bovine serum high-glucose DMEM medium diluted with 5mM palmitic acid stock solution to a final concentration of 500 μ M and 1% BSA solution as a control.

3. Oil red O dyeing

The oil red O staining kit was purchased from Beijing Soilebao (cat # G1262).

1) The cell culture medium was removed, washed twice with PBS, and fixed for 20-30min with ORO Fixative Fixative.

2) The fixative was discarded and washed 2 times with distilled water.

3) Adding 60% isopropanol, and soaking and washing for 5 min.

4) Discarding 60% isopropanol, adding newly prepared ORO Stain, and dip-dyeing for 10-20 min.

5) The staining solution is discarded and washed with water for 2-5 times until there is no excess staining solution.

6) Adding Mayer hematoxylin staining solution, and counterstaining for 1-2 min. Discarding the dye solution, and washing with water for 2-5 times.

7) ORO Buffer is added for 1min and discarded.

8) Distilled water was added to cover the cells and observed under a microscope.

The experimental results are as follows:

as shown in the attached figures 1 and 2 of the specification, after oil red O staining, the number of lipid droplets induced by PA is obviously increased compared with that induced by BSA, and the lipid droplets are larger in size.

Example 2

And (4) identifying the exosome extracted from the adipocyte supernatant under an electron microscope.

1. Collection of supernatant

1) After adipogenesis of 3T 3-L1 lipo precursor cells, PA was used for induction for 24h, and BSA was used as a control.

2) After 24h, the culture solution is replaced by serum-free DMEM medium.

3) After 24h, the supernatant was collected and frozen in a-80 freezer for use.

2. Exosome extraction

1) Supernatants were removed from-80 freezer after equal volumes of PA and BSA induction and thawed on ice.

2) The supernatant was filtered through a 0.22um pore size filter and concentrated using a 100K ultrafiltration tube.

3) To the concentrated supernatant, ExoQuick-TC separation reagent was added at a ratio of 1:5, the mixture was inverted and mixed, and then the mixture was left to stand overnight in a refrigerator at 4 ℃.

4) The concentrated supernatant mixed with the separating agent was removed, centrifuged at 1500g for 30min, and carefully removed by pipette, and a white colloidal exosome precipitate was seen on the sidewall.

3. Identification of exosomes under electron microscope

1) Exosome glutaraldehyde fixation.

2) Washing with 1m L PBS for 3 times, and standing for 15min each time.

3) e acid fixation, 0.5m L2% e acid solution is added for 4 degree fixation for 2 h.

4) Washing with 1m L PBS for 3 times, and standing for 15min each time.

5) Dewatering by gradient dewatering with 50%, 70%, 80%, and 90% ethanol each 1m L for 15min, and dewatering with 1m L100% ethanol for 2 times, each for 20 min.

6) Replacement, 2 times of replacement with 1m L acetone, each time standing for 15 min.

7) And (4) dipping.

8) Embedding: the sample is placed in an embedding plate with pure embedding medium.

9) Polymerization: the embedding plate was polymerized for 48h at 65 ℃.

10) Dyeing: dyeing by uranyl acetate for 10min, and cleaning; and dyeing the lead acetate for 10min and then cleaning.

11) And (6) performing detection on the machine.

The experimental results are as follows:

as shown in the attached figures 3 and 4 of the specification, in the supernatant after PA and BSA induction, exosome images can be detected, and the diameter of each exosome is less than 200 nm.

Example 3

And (4) after the exosome is extracted from the adipocyte supernatant, tracking, analyzing and identifying the nanoparticle.

Exosome extraction method was the same as in example 2

Nanoparticle Tracking Analysis (NTA) is a method of tracking and analyzing brownian motion of each particle, and calculating the hydrodynamic diameter and concentration of the nanoparticles by combining the stokes-Einstein equation. The NTA technology has been recognized by the field of exosome research as one of the means of exosome characterization; this section is assisted by the university of Shandong chemical college.

The experimental results are as follows:

as shown in the attached figures 5 and 6 of the specification, after exosomes are collected in supernatant after PA and BSA induction, the nanoparticle size analysis shows that the peak value of the particle size distribution is within 200nm, and the particle size distribution accords with the physiological characteristics of exosomes.

Example 4

The adipose cell-derived exosomes may enter breast cancer cells.

Exosome extraction method was the same as in example 2

1. Cell culture

1) DMEM and 10% FBS serum are used for culturing MDA-MB-231 cells in a 6-well plate, a cell slide is placed in a six-well plate, and a part of MDA-MB-231 cells grow on the cell slide for later use.

2)1640+ 10% FBS serum was used to culture 4T1 cells in 6-well plates, six-well plates were used to place cell crawl plates, and a portion of 4T1 cells were grown on cell crawl plates for future use.

2. Exosome extraction method was the same as in example 2

3. Exosome staining

1) 100ul of diluent C (Catalog Number G8278) was added to the exosome pellet and gently pipetted and mixed to prepare an exosome suspension.

2) Immediately before staining, 0.4. mu. L PKH26 in ethanol was added to 100u L dilution C and mixed well.

3) The exosome suspension (step 1) was added rapidly to the staining solution (step 2) and immediately mixed well with a pipette.

4) The mixed dyed exosomes were incubated for 10 min.

5) The reaction was stopped by adding an equal volume of 1% BSA solution.

4. Co-cultivation and Observation

1) The stained exosomes were added to 6-well plates containing cell slides and co-cultured for 6 h.

2) The culture medium was aspirated and the 6 well plate was washed 3 times 5min each time using Hank's BSS.

3) Carefully remove the cell slide and place it on a glass slide.

4) And dropwise adding an anti-fluorescence quenching reagent containing DAPI.

5) Cover with glass, observe under fluorescence microscope, take pictures.

The experimental results are as follows:

as shown in figure 7 of the accompanying drawings of the specification, PKH26 can stain exosomes (red), DAPI stains cell nuclei (blue), and after the cells are co-cultured, the exosomes can be found around the cell nuclei through observation under a fluorescence microscope, so that the exosomes from the fat cells can enter the breast cancer cells. Since the drawings of the specification are provided in black and white, the Merge picture can be seen with reference to the PKH26 and DAPI separate staining pictures.

Example 5

The adipose cell-derived exosome obviously promotes invasion and migration of breast cancer cells.

Exosome extraction method was the same as in example 2

1. Cell culture

1) DMEM + 10% FBS serum was used to culture MDA-MB-231 for use.

2) 4T1 was cultured in 1640+ 10% FBS serum for use.

2. Exosome extraction method was the same as in example 2

3. Exosome protein quantification

Proteins in exosomes were quantified using the BCA method. The BCA kit is purchased from Biyuntian Biotech company (product number: P0010S)

1) Preparation of protein standards

0.8ml of the protein standard preparation solution was added to a tube of protein standard (20mg BSA), and after sufficient dissolution, 25mg/ml of the protein standard solution was prepared. Taking a proper amount of 25mg/ml protein standard, and diluting to a final concentration of 0.5 mg/ml.

2) Preparation of BCA working solution

According to the number of samples, a proper amount of BCA working solution is prepared by adding 50 volumes of BCA reagent A and 1 volume of BCA reagent B (50:1), and the mixture is fully mixed. And mixing the BCA reagent B uniformly to prepare 5.1ml of BCA working solution.

3) Protein concentration detection

Adding standard substance into standard substance well of 96-well plate in an amount of 0, 1, 2, 4,8, 12, 16, 20 μ l, and adding standard substance diluent to make up to 20 μ l, wherein the concentrations of the standard substance are 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5mg/ml respectively. Add the appropriate volume of sample to the sample well of a 96-well plate. If the sample is less than 20. mu.l, the standard dilution is added to make up to 20. mu.l. Add 200. mu.l BCA working solution to each well and leave at 37 ℃ for 20-30 minutes.

4) Reading and calculating

The absorbance at wavelengths between A562, or 540-595nm was measured with a microplate reader. The protein concentration of the sample was calculated from the standard curve and the sample volume used.

4. Cell migration and invasion Capacity assays

Cell migration and invasion capacity detection by transwell experiment

1) Invasion test

a. The matrigel was diluted at a concentration of 1:10 and spread on the upper layer of a transwell chamber and allowed to stand in an incubator at 37 ℃ for 6 h.

MDA-MB-231, 4T1 cells were plated in the upper layer, 8 × 10 cells per well⁴Cells were seeded on a tranwell plate having a pore size of 8 μm, and the cells were cultured in a normal medium containing 10% serum, after exosomes were added at about 20 ug/ml.

c. After 24h of cell culture, the cells were fixed with 4% paraformaldehyde for 30min, carefully removed from the upper chamber, and the matrigel and the cells on the upper surface of the polycarbonate membrane were gently wiped off with a wet cotton swab. Then stained with 0.5% crystal violet.

2) Migration experiment

MDA-MB-231, 4T1 cells were plated in the upper layer, 6 × 10 cells per well⁴Cells were seeded on a tranwell plate having a pore size of 8 μm, and the cells were cultured in a normal medium containing 10% serum, after exosomes were added at about 20 ug/ml.

b. After 24h of cell culture, the cells were fixed with 4% paraformaldehyde for 30min, carefully removed from the upper chamber, and the matrigel and the cells on the upper surface of the polycarbonate membrane were gently wiped off with a wet cotton swab. Then stained with 0.5% crystal violet.

3) Counting and statistical analysis

Cells attached to the lower surface of the polycarbonate membrane were counted in 6 fields at random under a high power microscope (200 times) and averaged.

The experimental results are as follows:

as shown in the attached drawings of the specification, such as figure 8, figure 9, figure 10 and figure 11, after the MDA-MB-231 cells and the 4T1 cells are selected and the PA-derived exosomes and the breast cancer cells are co-cultured, the invasion and migration capacity of the breast cancer cells are obviously enhanced. Meanwhile, compared with a blank control, the BSA source exosome can also enhance the invasion and migration capacity of cells.

Example 6

Results of the chip of the lncRNA of the exosome from the mast adipocyte show that the expression of the lncRNA TUG1 is obviously increased

1. Exosome extraction

Exosome extraction method was the same as in example 2

2. Chip analysis

1) RNA quality control

RNA quantity and quality was assessed using NanoDrop ND-1000. RNA integrity was assessed by standard denaturing gel electrophoresis.

2) RNA labeling and chip hybridization

Sample labeling and chip hybridization were performed according to the Agilent One-Color Microarray-Based Gene expression Analysis protocol (Agilent Technology).

a. After removing rRNA from the total RNA, mRNA was obtained (mRNA-ON L Y)^TMEukaryotic mRNA IsolationKit，Epicentre)。

b. Each sample was amplified and transcribed to fluorescent cRNA using a random primer method.

c. Labeled cRNAs were purified using the RNeasy Mini Kit (Qiagen) and assayed for concentration and activity using NanoDrop ND-1000.

d. Arraystar mouse L ncRNA chip V3.0 chip was designed to describe the global L ncRNAs and protein-encoded transcript profile of mice.A third generation L ncRNA chip was able to detect approximately 35,923L ncRNAs and 24,881 encoded transcripts.

e. The hybridization chip (Agilent DNA Microarray Scanner (part number G2505C)) was washed, fixed and scanned.

3. Data analysis

The raw data was subjected to Quantum normalization using GeneSpring GX v12.1 software (Agilent Technologies) and subsequent data processing after further analysis by screening high quality probes (at least 1 probe in 2 samples is labeled as Present or Marginal.) after raw data normalization L ncRNA or mRNA differentially expressed with statistical significance between two sets of samples was screened by P-value/FDR. L ncRNAs differentially expressed between two samples was screened by Fold Change screening.

The experimental results are as follows:

as shown in the attached figure 12 of the specification, in the exosomes derived from the mast adipocyte, the expression of the IncRNA TUG1 is obviously increased compared with the expression of the exosomes derived from the normal adipocyte, and the increase is up to 26.12 times.

Example 7

Human and mouse lncRNA TUG1 sequences.

1. Human lncRNA TUG1 is located on chromosome 22 with a gene ID of 55000. There are 8 transcripts of human lncRNA TUG1 currently disclosed in the genebank database.

2. Mouse lncRNA TUG1 is located on chromosome 11 with gene ID 544752. There are 3 transcripts of mouse lncRNA TUG1 currently disclosed in the genebank database.

Example 8

Analysis of lncRNA TUG1 expression in adipocytes cells and secreted exosomes.

1. Exosome extraction

Exosome extraction method was the same as in example 2

2. Exosome and RNA extraction in cells

Adding 1ml of Trizol and 1ml of Trizol lS reagent into a cell sample and an exosome sample, fully reacting, centrifuging at 12000g at 4 ℃ for 15min, and taking the upper aqueous phase in a new RNase-free EP tube. Adding chloroform 200 μ l/ml into EP tube, shaking by hand for 15-30s, standing on ice for 5min, and centrifuging at 4 deg.C 12000g for 15 min; carefully taking the upper water phase into a new tube, adding precooled isopropanol with the same volume, uniformly mixing, standing in a refrigerator at the temperature of-20 ℃ for 20min, and centrifuging at the temperature of 4 ℃ for 10min at 12000 g; discarding the supernatant, adding 1-2ml ethanol diluted with 75% DEPC water, mixing, centrifuging at 4 deg.C 7500g for 5min, discarding the supernatant, drying at room temperature for 5-10min, and adding 10-20 μ l DEPC water to dissolve RNA. The concentration and the quality of RN are measured by a spectrophotometer, the ratio of 0D260/280 is between 1.8 and 2.0, and the RN is stored at the temperature of minus 80 ℃.

Reverse transcription of IncRNA TUG1

The RN sample collected above was subjected to PrimeScript from Takara^TThe RT reagent Kit with gDNEraser (Perfect Real Time) performs reverse transcription on the extracted RNA sample according to the standard operation steps specified by the Kit operation instruction to obtain cDNA.

1) Reactions for removing genomic DNA

The system as shown in Table 1 is configured:

TABLE 1

Reagent	Amount of the composition used
		5×gDNA Eraser Buffer	2.0μl
gDNA Eraser	1.0μl
		Total RNA	＊1
RNase Free dH2O	up to 10μl

42℃2min

The reaction was terminated at 4 deg.C

2) Reverse transcription to obtain cDNA

Is configured according to the system described in Table 2

TABLE 2

Reagent	Amount of the composition used
		Reaction solution of step 1	10.0μl
PrimeScript RT Enzyme Mix l	1.0μl
		RT Primer Mix＊4	1.0ul
5×PrimeScript Buffer 2(for Real Time)	4.0μl
		RNase Free dH2O	4.0μl
Total	20μl＊5

37℃15min

85℃5sec

The reaction was terminated at 4 deg.C

4. Real-time fluorescent quantitative PCR

1) Configured according to the system as shown in Table 3

TABLE 3

Component (A)	Dosage/tube
		SYBR Premix Ex Taq	10ul
Forward Primer(10um)	0.4ul
		Reverse Primer(10um)	0.4ul
cDNA	2ul
		Enzyme-free water	To 20ul

2) Real-time fluorescent quantitative PCR reaction program

a.95 ℃ Pre-denaturation for 5min

b. Cycle 40 times as follows:

denaturation at 95 ℃ for 30s

Annealing at 60 ℃ for 30s

Extension at 72 ℃ for 30s

c.72 ℃ extension for 5min

3) The primer sequences are shown in table 4:

gene	Sequence of
		Mouse LncRNA TUG1 Forward Primer	GAGACACGACTCACCAAGCA
Mouse LncRNA TUG1 Reverse Primer	GAAGGTCATTGGCAGGTCCA
		Mouse GAPDH Forward Primer	GGACACTGAGCAAGAGAGGC
Mouse GAPDH Reverse Primer	TTATGGGGGTCTGGGATGGA

5. Data analysis

-2^ΔΔCTMeasurement of the index: the experimental data were analyzed by a relatively quantitative analysis method using GAPDH as an internal reference gene and using GraphPad Prism software.

The experimental results are as follows:

as shown in the accompanying figure 13 of the specification, in the mast adipocytes after PA induction, the expression of lncRNA TUG1 was significantly enhanced compared to normal adipocytes. As shown in the attached figure 14 of the specification, in exosomes of mast adipocytes after PA induction, lncRNATUG1 expression is obviously higher than that of exosomes derived from normal adipocytes, and the result is consistent with lncRNA chip results.

Example 9

Expression of lncRNA TUG1 was significantly higher in breast cancer cells than in normal breast epithelial cells.

1. Cell culture

1) DMEM + 10% FBS serum was used to culture MDA-MB-231 cells for use.

2) MCF-7 cells were cultured in MEM + 10% FBS serum + bovine insulin serum for use.

3) McCoy's 5A + 10% FBS serum was used to culture SK-BR-3 cells for use.

2. Cellular RNA extraction and reverse transcription

Cellular RNA extraction and reverse transcription the same as in example 8

4. Real-time fluorescent quantitative PCR

1) The system configuration and reaction conditions were the same as those in example 8

2) The primer sequences are shown in table 5:

TABLE 5

Gene	Sequence of
		Homo LncRNA TUG1 Forward Primer	AGGTCACTGGACCCTGTTT
Homo LncRNA TUG1 Reverse Primer	AAGTCGGTCACAAAATGCATAGA
		Homoβ-actin Forward Primer	CATGTACGTTGCTATCCAGGC
Homoβ-actin Reverse Primer	CTCCTTAATGTCACGCACGAT

5. Data analysis

-2^ΔΔCTThe measurement of the index is that the experimental data adopts a relatively quantitative analysis method, β -actin is used as an internal reference gene, and the data is analyzed by using software GraphPad Prism.

The experimental results are as follows:

as shown in figure 15 of the attached drawings, the expression of lncRNATUUG 1 in the breast cancer cells (MDA-MB-231, MCF-7 and SK-BR-3) is obviously increased compared with that in the normal breast epithelial cells (MCF-10A).

Example 10

Construction and effect verification of knockout of lncRNA TUG1 breast cancer cells

1. Lentiviral vector construction

According to shRNA design principle, taking lncRNA TUG1 as a target sequence, 2 target site sequences aiming at lncRNA TUG1 are designed, corresponding forward and reverse sequences are synthesized (the sequence is synthesized by Shanghai Jima organism company), and the sequence joints are designed and annealed to form sticky ends of Bam H I and EcoR I. The shRNA lentiviral expression vector of the lncRNATUG1 is constructed through the steps of enzyme digestion, linkage, identification, sequencing and the like. The target sequences are shown in table 6:

TABLE 6

Name (R)	Sequence of
		LV3-homo-shTUG1-1	GCTTGGCTTCTATTCTGAATCCTTT
LV3-homo-shTUG1-2	GCTCCATCCAAAGTGAATTAT
		LV3-NC	TTCTCCGAACGTGTCACGT

2. Lentiviral packaging

HEK293T cells were plated into T25 flasks and transfected when the cell density reached 80-90%. Collecting cell culture solution for 48h and 72h, filtering, subpackaging, concentrating, measuring titer, and storing in a refrigerator at-80 ℃.

3. Screening for stable cell lines with IncRNA TUG1 knockdown

The breast cancer cells MDA-MB-231 in the logarithmic growth phase are spread on a flat plate, when the cell density reaches about 80%, a fresh 10% FBS DMEM culture medium is replaced, a proper amount of virus stock solution is added, 5ug/m L of Polybrene is added to promote the infection efficiency of the virus, the infection efficiency of the lentivirus can be demonstrated by observing the efficiency that the cells carry GFP through a fluorescence microscope, and meanwhile, the cells expressed by the lentivirus are screened by applying puromycin drugs to the cells.

RT-PCR was performed to examine the knockdown effect of IncRNA TUG 1.

RNA extraction, IncRNA TUG1 inversion, real-time fluorescence quantitative PCR, and data analysis were performed in the same manner as in example 9.

The experimental results are as follows:

as shown in figure 16 of the attached drawings of the specification, L V3-homo-shTUG1-1 can obviously reduce the expression of IncRNA TUG1, and the knocking effect is low and good.

As shown in figure 17 in the accompanying drawing of the specification, L V3-homo-shTUG1-1 can obviously reduce the expression of IncRNA TUG1, and the knocking effect is low and good.

Example 11

The knock-down L ncRNA TUG1 can obviously inhibit the migration and invasion of the breast cancer.

1. Cell culture

1) DMEM + 10% FBS serum is used for culturing MDA-MB-231 cells and control cells after the IncRNA TUG1 is knocked down for later use.

2. Cell migration and invasion assay

The method for measuring the invasion and migration ability of cells was the same as in example 5.

The experimental results are as follows:

as shown in the attached figure 18 of the specification, the MDA-MB-231 cell invasion and migration capacity after the IncRNA TUG1 is knocked down is obviously reduced compared with that of a control cell, and the promotion effect of TUG1 on cell invasion and migration is suggested.

Example 12

Public database analysis found that lncRNA TUG1 is related to DMFS

1) The expression of TUG1 in breast cancer tissue was examined using the Starbase 3.0 database.

2) Analysis of TUG1 using Kaplan-Meier Plotter (probe ID: 228397_ at, 212725_ at) is associated with total survival (OS) of breast cancer.

3) Analysis of TUG1 using Kaplan-Meier Plotter (probe ID: 228397_ at, 212725_ at) in relation to breast cancer Distant Metastasis Free Survival (DMFS).

The experimental results are as follows:

as shown in FIG. 19, the results show that the expression of IncRNA TUG1 was not significantly different between breast cancer tissue and normal tissue.

Further, Kaplan-Meier Plotter analysis shows that the expression of TUG1 is irrelevant to the total survival of breast cancer patients (as shown in the attached figures 20 and 21 of the specification), but the expression increase of lncRNA TUG1 is found to be inversely relevant to the survival without Distant Metastasis (DMFS) (as shown in the attached figures 22 and 23 of the specification), thereby indicating that the high expression of TUG1 can promote the breast cancer metastasis, and is consistent with the cell biology experiment.

Claims (10)

1. An lncRNA marker derived from an adipocyte exosome, wherein the lncRNA marker is a long-chain non-coding RNA TUG1 gene or a homolog, mutation or isoform thereof, and the lncRNA TUG1 is derived from an exosome or a humoral exosome secreted by a breast cancer cell, a tumor stromal adipocyte or a tumor stromal fibroblast;

lncRNA TUG1 is highly expressed in mast adipocytes and breast cancer, and can be transmitted from adipocytes to breast cancer cells via exosomes.

2. The use of the incRNA marker derived from an adipocyte exosome according to claim 1 in the preparation of a product for diagnosing breast cancer.

3. The use according to claim 2, wherein said product for diagnosing breast cancer comprises:

(1) a primer/primer set or probe that recognizes the lncRNA TUG1 sequence;

(2) a small molecule compound that recognizes the incrna TUG1 sequence or a biological macromolecule that recognizes the incrna TUG1 sequence, said biological macromolecule comprising: an RNA binding protein or a functional fragment thereof, a fluorescently labeled RNA binding protein or a functional fragment thereof.

4. The use of the incRNA marker derived from an adipocyte exosome according to claim 1 in the preparation of a product for treating breast cancer.

5. The use of claim 4, wherein the breast cancer treatment product comprises at least one of the following components:

(1) s iRNA, shRNA, sgRNA or small interfering RNA probe with similar functions for inhibiting the lncRNA TUG1 sequence;

(2) an oligonucleotide fragment that inhibits the IncRNA TUG1 sequence, said oligonucleotide fragment comprising antisense oligonucleotide ASO, locked nucleic acid L NA or a functionally similar chemically modified oligonucleotide;

(3) a small molecule compound that inhibits the lncRNA TUG1 sequence;

(4) a biomacromolecule that inhibits the lncRNA TUG1 sequence;

(5) a tool molecule that knockdown or disrupts the lncRNA TUG 1.

6. The use according to claim 5, wherein the biomacromolecule of step (4) is a high substrate-specific enzyme or a functional fragment thereof;

the tool molecule for knocking out or destroying the lncRNA TUG1 in the step (5) comprises at least one of a DNA homologous recombination plasmid, a TA L EN-TA L EA targeted gene knockout plasmid system, a Cre/L oxp plasmid system, an inducible Cre/L oxp plasmid system and a CRISPR gene editing plasmid system.

7. The use of claim 2 or 4, wherein the breast cancer comprises invasive ductal carcinoma and invasive lobular carcinoma as pathological types.

8. The use of claim 2 or 4, wherein the breast cancer comprises four molecular classifications, L tubular A, L tubular B, tripartite, and HER-2 overexpression.

9. An application of lncRNA marker derived from an adipocyte exosome in constructing a calculation model for predicting breast cancer prognosis.

10. A product for treating breast cancer is characterized in that 2 target site sequences aiming at lncRNA TUG1 are designed by taking lncRNA TUG1 as a target sequence according to shRNA design principle, and corresponding sequences are synthesized, namely L V3-homo-shTUG1-1GCTTGGCTTCTATTCTGAATCCTTT

LV3-homo-shTUG1-2 GCTCCATCCAAAGTGAATTAT；

These sequence linkers were designed to anneal to form sticky ends of BamHI and EcoRI; the shRNA lentiviral expression vector of the IncRNA TUG1 is constructed through the steps of enzyme digestion, linkage, identification, sequencing and the like.

Images