CN114134162B - Application of Slmmp-2 gene in agricultural pest prevention and control - Google Patents

Abstract

The invention belongs to the technical field of agricultural pest prevention and control, and particularly relates to application of Slmmp-2 gene in agricultural pest prevention and control, expression conditions of Slmmp-2 gene in tissues of spodoptera litura 6-4-day old and 6-day old are detected, and after the Slmmp-2 gene is knocked out by using a CRISPR/Cas9 system, the aim of preventing and controlling the spodoptera litura is achieved by discovering that normal mating of spodoptera litura imagoes is influenced and the imagoes cannot be subjected to normal passage after the Slmmp-2 gene is knocked out, and the Slmmp-2 gene can be used as a new target gene for preventing and controlling the spodoptera litura.

Description

Application of Slmmp-2 gene in agricultural pest prevention and control

Technical Field

The invention belongs to the technical field of agricultural pest prevention and control, and particularly relates to an application of Slmmp-2 gene in agricultural pest prevention and control.

Background

Spodoptera litura (Spodoptera litura) belongs to Spodoptera of Lepidoptera, has extremely strong reproductive capacity, has the characteristics of both omnivory and overeating, and can harm nearly 100 and 300 crops, wherein Cruciferae plants are the main hosts of the Spodoptera litura. In addition, flowers and tobacco are also damaged. At present, the mode of preventing and controlling prodenia litura is mainly to use insecticide, and the drug resistance of the prodenia litura is improved due to long-term use of the insecticide, so that the prodenia litura becomes one of pests with serious drug resistance and difficult prevention and control. With the development of CRISPR-based genome editing technology, it becomes possible to control harmful populations by precisely guiding male sterile individuals by using CRISPR technology, and the pest control method combining pest reproductive characteristics is likely to become a control means with smaller harm and larger effect in the future.

Matrix Metalloproteinases (MMPs) are a class of multifunctional zinc ion-dependent endopeptidases belonging to the Metzincin protease superfamily, which have the properties of collagenases, stromelysins and the like to degrade almost all Extracellular Matrix (ECM) and Basement Membrane (BM) and participate in various physiological and pathological immune response processes and the regulation and control of various signal pathways in living organisms, such as tissue dissociation and remodeling, angiogenesis, immune response caused by inflammation, various traumatic repair and the like.

The whole development period of lepidoptera insects is mainly regulated by two hormones, namely Juvenile Hormone (JH) and 20-hydroxyecdysone (20E), and the expression of MMPs is also regulated by the two hormones. JH is dominant in the larval stage of the insect and can activate the expression of Timp protein through a downstream transcription factor to inhibit the expression of MMPs, and the expression quantity of 20E is increased in the prepupation stage of the insect and activates the expression of MMPs through a downstream series of transcription factors (such as DHR3, beta ftz-F1 and the like), so that the insect enters the pupal stage to complete metamorphosis development. The cardiac morphogenesis of drosophila begins from the stages of cell polarization migration, fusion in the middle of cardiac cells and cavitary formation, during which drosophila mmp1 and mmp2 promote the dynamics of the myocardium's anterior membrane during collective migration, where Dmmmp2 is crucial for the formation of cardiac cavitary. In addition, after two Mmp genes are knocked out respectively in the drosophila melanogaster body, the fact that the germ tube development of the Dmmmp1 mutant drosophila melanogaster larva is defective, the head of the Dmmmp2 mutant drosophila melanogaster is turned outwards in the pupal stage, and the defect occurs when the tissues of the Dmmmp2 mutant drosophila melanogaster are separated and the epithelium of the drosophila melanogaster is fused in the metamorphosis process is found, and the fact that the MMPs have a very important effect in the drosophila melanogaster development process is shown. Silkworm has identified 3 mmps genes, their expression level and enzyme activity and pupa early stage fat body cell step by step dissociation consistent. Through function loss and function acquisition experiments, the Bmmmps are proved to be functionally necessary in fat body cell separation and ovary development of female pupae. When the function of MMPs in the silkworm is researched, the finding that after the silkworm is injected with the MMP inhibitor GM6011, the separation of silkworm fat body cells can be delayed, the development of ovaries is obviously influenced, and finally, the lethality of the silkworm from a pupal stage to an adult is obviously increased. 3 MMPs genes are also identified in prodenia litura, in order to research the effect of Slmmps in the fusion of the spermary of prodenia litura, a MMP broad-spectrum inhibitor GM6001 is injected into the fifth abdominal segment of L6D6 prodenia litura, then nearly half of larvae in an inhibitor treatment group are found to be incapable of normally developing to the pupal stage in the later stage of L6D6, the fusion of spermary tissues is found to be incapable of occurring through dissection, most of the larvae enter the pupal stage in a DMSO-treated control group, and the spermary can be normally adhered and fused. At present, researches on whether MMPs influence the mating of adults are few, and the specific action mechanism is not clear.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides the application of the Slmmp-2 gene in agricultural pest control, when the Slmmp-2 gene is inhibited, the normal mating of the spodoptera litura imagoes is influenced, and the imagoes cannot be passaged normally, so that the purpose of controlling the spodoptera litura is achieved.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

the invention provides application of Slmmp-2 gene as a target spot in prevention and control of agricultural pests.

The invention also provides a medicament for preventing and treating agricultural pests, which comprises an inhibitor of Slmmp-2 genes.

Preferably, the agricultural pest is prodenia litura.

Preferably, the inhibitor of the Slmmp-2 gene includes sgRNA and Cas9 protein designed for the Slmmp-2 gene.

The invention provides a gene sequence (NCBI accession number is XM _022958284.1) and a protein sequence (NCBI accession number is XP _022814052.1) of prodenia litura Slmmp-2, and the gene and protein structure are simply analyzed; detecting the expression conditions of Slmmp-2 genes in tissues of spodoptera litura 6 th 4 days and 6 th 6 days; and finally, editing the Slmmp-2 gene by using a CRISPR/Cas9 system, and researching the influence of the Slmmp-2 gene on mating of prodenia litura adults. The research result shows that. After the Slmmp-2 gene is knocked out by using the CRISPR/Cas9 technology, the normal mating of prodenia litura imagoes is influenced, so that the imagoes cannot be normally passaged, and the aim of preventing and controlling the prodenia litura is fulfilled. The Slmmp-2 gene can be used as a new target gene for preventing and treating prodenia litura.

More preferably, the using concentration of the sgRNA is 1000-1500ng/μ L, the using concentration of the Cas9 protein is 1000ng/μ L, and the mass ratio of the sgRNA to the Cas9 protein is 1-2: 1.

specifically, the mass ratio of the sgRNA to the Cas9 protein is 1: 1 or 2: 1.

specifically, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 9.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides application of Slmmp-2 gene in agricultural pest control, which is characterized in that expression conditions of the Slmmp-2 gene in tissues of spodoptera litura 6-old 4-day and 6-old 6-day are detected, and the Slmmp-2 gene is knocked out by using a CRISPR/Cas9 system, so that when the Slmmp-2 gene is knocked out, normal mating of adult spodoptera litura is influenced, and the adult spodoptera litura can not be subjected to normal passage, and the purpose of preventing and controlling the spodoptera litura is achieved, and the Slmmp-2 gene can be used as a new target gene for preventing and controlling the spodoptera litura.

Drawings

FIG. 1 shows mRNA (XM) and protein (XP) patterns for Slmmp-2;

FIG. 2 shows the expression of Slmmp-2 in various tissues of Spodoptera litura (A is the expression of Slmmp-2 in various tissues of L6D 4; B is the expression of Slmmp-2 in various tissues of L6D 6);

in FIG. 2, MG is Midgut, Midgut; HE Hemolymph, Hemolymph; TE, Testis; FB-Fat body; EP Epidermis, Epidermis; HD: Head, Head; different letter representations have significant differences.

FIG. 3 is the structure of Spodoptera litura Slmmp-2 protein;

FIG. 4 is a schematic diagram of the target site location design of the sgRNA (sequences in panel A represent target site sequences; red stars in panel B represent target site sequence insertion sites);

FIG. 5 shows the detection result of G0 generation mutant of Slmmp-2 (the first and second figures from top to bottom are sequence alignments, the third figure is the sequencing peak near the target site sequence);

FIG. 6 shows the result of detection of the egg 1 homozygous mutant sequence (A is sequence alignment; B is the sequencing peak near the target site sequence);

FIG. 7 shows the result of detecting the homozygous mutant sequence of egg mass 7 (A is the sequence alignment; B is the sequencing peak near the target site sequence);

FIG. 8 shows the result of detecting the homozygous mutant sequence of egg mass 11 (A is the sequence alignment; B is the sequencing peak near the target site sequence);

FIG. 9 is a video screenshot of the mating abnormality of Slmmp-2 homozygous mutant.

Detailed Description

The following further describes the embodiments of the present invention. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

The experimental procedures in the following examples were carried out by conventional methods unless otherwise specified, and the test materials used in the following examples were commercially available by conventional methods unless otherwise specified.

Example 1Slmmp-2 Gene and protein Structure analysis

The NCBI accession number of Slmmp-2 gene is XM _022958284.1, and the accession number of its coding protein is XP _ 022814052.1.

As shown in FIG. 1, the Slmmp-2 gene has only 1 mRNA spliceosome. As shown in FIG. 3, the Spodoptera litura SlMMP-2 protein has a Zinc finger protein binding domain (ZnMc, Zinc-dependent metalloprotease), a heme repeat domain (HX, Hemopexin-like peptides), and a Low complexity domain (LCRs, Low complexity regions).

Example 2 expression of Slmmp-2 Gene in various tissues of Spodoptera litura

1. Materials and methods

1.1 Experimental insects

Spodoptera litura insects used in the experiments were purchased from Taobao "science and technology", and were bred in the laboratory. The average growth cycle of prodenia litura is 30 days per generation (the larvae are divided into 6 instars, which requires about 15 days, the pupal stage is usually about 10 days, the adult stage is 5 to 7 days, the mating of male and female insects generally can be carried out within 2 to 5 days after the adult, the spawning peak stage is usually 2 to 3 days after mating), the growth environment temperature is 26 +/-2 ℃, the relative humidity is 40-50%, and the illumination condition is illumination: dark ═ 14h: and (5) 10 h. All experimental insects are fed with artificial synthetic feed in an artificial constant-temperature constant-humidity incubator, when adult insects are transferred to a self-made paper box, male and female adult insects are mated and lay eggs, the adult insects are fed with 10% honey water, egg masses are collected after the male and female adult insects are mated, the egg masses are soaked in 10% formaldehyde solution for 10min for disinfection, and finally the egg masses are washed with distilled water and transferred to an insect-feeding box for next-generation larva feeding.

The formula and the preparation process of the artificial culture medium are as follows:

dissolving 14g of agar powder in 900mL of water, boiling, adding 40g of yeast powder, 150g of wheat germ powder, 4g of sorbic acid, 4g of vitamin C4g, 4g of sucrose and 4g of methylparaben, uniformly stirring, adding linoleic acid, continuously stirring for about one minute, finally pouring the culture medium into a container, cooling, and storing at 4 ℃.

1.2 Experimental reagent and apparatus

1.2.1 Experimental reagents

The related reagents for RNA extraction and reverse transcription comprise: RNA isoPlus, Reverse Transcriptase M-MLV Reverse transcription kit (from TaKaRa).

The fluorescence quantitative PCR related reagents comprise: a 96-well plate dedicated for quantification, a 96-well PCR optical film, and a fluorescent quantitative 2 XPCR Mix reaction reagent (purchased from Yesheng).

1.2.2 instrumentation

7300 Real Time PCR System (available from ABI, USA); QuantStudio 6 Flex (from Life company, usa); NanoDrop ND-2000 Spectrophotometer (available from GE, USA); power PAC Basic electrophoresis apparatus (available from BIORAD, USA); ImageQuant300 gel imaging System (available from GE Healthcare Co., USA).

1.3 Experimental methods

1.3.1 tissue selection of Spodoptera litura

Preparing a dissecting tool for an experiment in advance, sterilizing at the high temperature of 120 ℃ for 2 hours, then putting the dissecting tool into an oven to dry overnight, and preparing a gun head and an EP tube in advance to sterilize.

The spodoptera litura used for material taking should be bred in the same batch for 4 days (L6D4) and 6 days (L6D6) at 6 ages, and the growth environment and state are similar. Before material taking, the insect is frozen on ice for 15min, then fixed on a dissecting wax tray by a dissecting needle, then each tissue of the insect, such as spermary, ovary, epidermis, fat body, hemolymph, midgut and the like, is separated and washed clean by scissors and tweezers (in the step, the tissue can be placed in a glass dish filled with sterilized DEPC-water for separating and washing clean), and finally placed in an EP tube filled with RNA extract, if the RNA can not be extracted in time, the tissue is frozen by liquid nitrogen and stored at-80 ℃.

Separating sperm cells and surrounding membranes in the spodoptera litura spermary according to specific experimental requirements, so that in the material taking process, firstly, taking out the complete spodoptera litura spermary tissue and placing the complete spodoptera litura spermary tissue in a first glass culture dish (containing sterilized DEPC water), cleaning impurities such as organs, fat bodies and the like on the surface of the spodoptera spermary tissue, then placing the tissue in a second glass dish, using a tip forceps under a microscope to puncture each sperm cell of the spodoptera spermary, allowing the sperm cells to flow out of the glass dish, in the process, paying attention to the condition that the membrane structure is not damaged as much as possible so as to prevent membrane fragments from being mixed into the sperm cells, then washing the separated spodoptera spermary and surrounding membranes in the sterilized DEPC water for 3 times, then collecting the sperm cells in the culture dish, removing the upper clear collected sperm cells through low-speed centrifugation, finally placing the sperm cells in an EP tube containing RNA extracting solution, if the RNA cannot be extracted in time, the tissue was frozen in liquid nitrogen and stored at-80 ℃.

1.3.2 RNA extraction

The reagent bottle, the measuring cylinder, the EP tube, the gun head and the like used in the RNA extraction experiment are sterilized at high temperature and high pressure in advance.

The RNA extraction uses RNAiosolplus extract, and comprises the following steps:

(1) adding 500 μ L RNA iso Plus extractive solution into each tissue material for RNA extraction, then filling to 1mL, adding RNA grinding beads into EP tube, placing into a grinder precooled to 4 deg.C, grinding for 120s under 60Hz condition, taking out, and placing on ice for 10 min.

(2) To an EP tube was added 200 μ L of sterile chloroform: isoamyl alcohol (24:1), shaking vigorously up and down for about 15s, and then standing on ice for 15 min.

(3) Centrifuging at 2000rpm for 10min, sucking the upper layer liquid to another EP tube, adding 2.5 times volume of isopropanol, mixing, and standing at-20 deg.C for 2-3h (the step can be carried out at-80 deg.C for 30min-1 h).

(4) Centrifuging at 12000rpm for 10min, sucking out the liquid in the EP tube to obtain white precipitate as RNA, and adding 500 μ L75% DEPC-ethanol to wash the RNA precipitate twice. The washed RNA precipitate was dried under a fume hood for 5-10 min.

(6) When the edge of the precipitate is slightly bright, adding a proper amount of RNase free water according to the amount of the precipitate to dissolve RNA.

(7) And (2) measuring the purity and concentration of RNA by using NanoDrop ND-2000, wherein the purity of 260/280 is greater than 2, the concentration of 300 ng/uL is qualified, sucking 1 mu L of RNA sample, adding the RNA sample into 9 mu L of RNase free water for gel running verification, judging that an RNA band is complete and is not degraded to be qualified, and finally storing the RNA sample at-80 ℃ for a long time for later use or immediately performing reverse transcription.

1.3.3 reverse transcription

First strand cDNA was synthesized following reverse transcription kit instructions:

(1) the following reaction system reagents were added to the PCR tube in a total volume of 6. mu.L:

note: oligo (dT) is: TTTTTTTTTTTTTTTTTT (SEQ ID NO. 1).

(2) And (3) uniformly mixing the bottom of the PCR tube by using fingers to flick, centrifuging at a low speed for 10s, and placing the mixed solution into a PCR amplification instrument, wherein the program is as follows: keeping the temperature at 70 ℃ for 10min and 4 ℃.

(3) Taking out the PCR tube in the above step, and adding the following reagents into the reaction system:

and (3) uniformly mixing the PCR tubes, centrifuging at a low speed, placing the mixed solution in a PCR amplification instrument, and setting the program as follows: 30min at 37 ℃ and 10min at 75 ℃ (for the purpose of removing genomic DNA from the sample).

(4) Taking out the PCR tube in the previous step, and adding the following reagents into the reaction system:

and (3) uniformly mixing the PCR tubes, centrifuging at a low speed, placing the mixed solution in a PCR amplification instrument, and setting the program as follows: 42 ℃ for 1h, and 72 ℃ for 15 min.

(5) After the procedure was completed, the PCR tube was taken out, and 190. mu.L of sterilized ultrapure water was added to the cDNA sample of 10. mu.L in total volume to dilute it, and stored at-20 ℃ for further use.

1.3.4 real-time fluorescent quantitative PCR (qRT-PCR)

The template used in qRT-PCR is usually reverse transcription cDNA, and the specificity of the primer is generally required to be verified before qRT-PCR is carried out, namely the primer is used for ordinary PCR amplification, and the primer is qualified if the band is single and has no difference in size.

The quantitative expression primers of Slmmp-2 gene (target gene) and SlRP49 gene (reference gene) are shown in the following table;

the qRT-PCR reaction system is as follows:

(1) preparing a mixed solution according to the volume of each reagent in the following reaction system according to the specific sample number:

(2) reaction procedure (this procedure requires different reaction temperatures and times depending on the kit used):

pre-denaturation: 5min at 95 ℃ for 1 cycle;

and (3) PCR reaction: 10s at 95 ℃; 60 ℃ for 30s, for 40 cycles.

(3) And (3) data analysis:

after the completion of the program, a data table is derived, and a method of relative quantitative analysis is usually employed for the analysis of the relative expression level of the target gene with respect to the reference gene (2) ^-ΔΔCt ，LivakKJ,Schmittgen T.Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCt method[J]Methods,2001,25(4): 402-. Experimental results differential comparative analysis was typically performed using independent sample T-tests (comparison between two samples). When the P value is less than 0.05, the difference is significant, and when the P value is less than 0.01, the difference is very significant.

2. Results of the experiment

Total RNA of each tissue (epidermis, midgut, fat body, head, hemolymph, testis and the like) of male prodenia litura with age of 6 days (L6D4) and age of 6 days (L6D6) is extracted and is reversely transcribed into cDNA to carry out qRT-PCR analysis, and primers used are mmp-2-qPCR-F and mmp-2-qPCR-R. The results shown in fig. 2 indicate that Slmmp-2 is expressed in each of the tissues of male prodenia litura L6D4 and L6D6, with lower expression levels in epidermal tissues and relatively higher expression levels in adipose tissue, particularly in adipose tissue of L6D4, but higher expression levels in haemolymph at L6D6 than in adipose tissue.

Example 3 mating of Slmmp-2 Gene on Prodenia litura adults

1. Materials and methods

1.1 Experimental insects

All the insects for the experiment are fed with artificial synthetic feed in an artificial constant temperature and humidity incubator (the feeding conditions are the same as the example 2), the insects are transferred to a self-made paper box when adult insects are formed, so that male and female adults mate and lay eggs, the adult insects are fed with 10% honey water, egg masses are collected after the male and female adults mate, and the eggs are soaked in 10% formaldehyde solution for 10min for disinfection.

1.2 Experimental reagent and apparatus

1.2.1 Experimental reagents

Common PCR-related reagents are: TaqDNA polymerase (from TaKaRa), 10 XPCR buffer, 10mM dNTP, 2 XPCR Mix (from Vazyme).

DNA extraction-related reagents: DNA extract (purchased from Biotech, Beijing ancient cooking).

Other reagents are: cas9 protein (purchased from PNABio, USA), MEGAScript T7 kit in vitro transcription kit (purchased from Thermo Fisher Scientific, USA).

1.2.2 instrumentation

DNA Engine Filter Thermal Cycler (available from BIORAD, USA); NanoDrop ND-2000 Spectrophotometer (available from GE, USA); power PAC Basic electrophoresis apparatus (available from BIORAD, USA); bulk microscope (available from Olympus, japan); microinjector (available from EPpendorf, germany); ImageQuant300 gel imaging System (available from GE Healthcare, USA).

1.3 Experimental methods

1.3.1 design and Synthesis of sgRNA

In order to explore the functions of Slmmp-2 gene, firstly, according to the technical principle of CRISPR/Cas9, a proper 5 '-GG- (N) 18-NGG-3' sequence is selected on Slmmp-2 genomic DNA, and site-directed knockout is carried out by taking the sequence as a target site. Typically the target site is not set within an intron, but may be selected to span both intron and exon regions. The first exon region of Slmmp-2 was selected for targeting of the target site (FIG. 4). The sgRNA sequence includes a T7 promoter sequence (TAATACGACTCACTATAGG, SEQ ID No.6), a target site sequence (AAGAAGGGTCGGCCGGAGGT, SEQ ID No.7), and a guidearna (grna) sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAA GTGGCACCGAGTCGGTGCT, SEQ ID No. 8). When synthesizing the sgRNA primer sequence, PAM (NGG) at the 3 'end in the sequence of the target site should be removed, and GG sequence at the 5' end should cross the T7 promoter region, so the sgRNA sequence (TAATACGACTCACTATAGGAAGAAGGGTCGGCCGGAGGTGTTTTAGAGCTAGAAATAG CAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT, SEQ ID NO.9) has a total of 116 bp. The specific synthesis method comprises the following steps:

(1) in vitro transcription template sgDNA purification

1) Before sgRNA synthesis, a corresponding forward primer (SEQ ID No.2) and a reverse primer (SEQ ID No.3) need to be designed, and then amplification of template DNA (refer to step 1.3.3 of this example) is performed through a general PCR reaction (refer to step 1.3.4 of this example), wherein the reaction system is usually 50 μ L, and in order to obtain as many templates as possible, usually 5 parts of template DNA are amplified.

2) The amplified template DNA was collected in the same EP tube, and after adding 250. mu.L of nucleic free water to 500. mu.L, the template DNA was purified (see step 1.3.3 in this example, beginning with step (2)).

(2) In vitro transcription of sgRNA and purification

According to the in vitro transcription kit, sgDNA is taken as a template for in vitro transcription, and the reaction system is as follows:

the mixture was placed in a PCR amplificator overnight at 37 ℃ and after transcription was complete 390. mu.L of nucleic free water was added to the product to a total volume of 400. mu.L, and the sgRNA was purified (see step 1.3.2 of example 2, beginning with step (2)).

1.3.2 microinjection

Sterile EP tubes, tips and needles were prepared prior to the experiment. The microinjection experiment was performed as follows:

(1) the concentration of the purified sgRNA was diluted to 1000-1500 ng/. mu.L and the concentration of the Cas9 protein was diluted to 1000 ng/. mu.L, and then the sgRNA and the Cas9 protein were mixed together, typically in a ratio of 1: 1/2: 1.

(2) the spodoptera litura eggs used for injection are within 2 hours after the female eggs are laid as much as possible. And taking out the eggs, washing the surface scale hairs of the egg masses with sterile water, and arranging the eggs on a glass slide under a microscope by using a fine hair brush and an ovulation needle.

(3) Injecting 9.6nL of mixed solution of sgRNA and Cas9 protein into eggs by using a microinjector, putting the eggs into an insect breeding box after injection, placing a piece of filter paper soaked with sterilized water below a glass slide to ensure the humidity (the filter paper needs to be replaced or added with water in time), and feeding the injected G0 generation larvae to a pre-pupation stage, wherein the culture temperature is 26 ℃, the relative humidity is 55 +/-5%, and the light cycle is 14h:10h (day: night).

1.3.3 genomic DNA extraction

(1) The skin sloughed when the prodenia litura became pupa was collected and placed in an EP tube, 400. mu.L of digest [ 250. mu.L of 50mM Tris-HCl (pH8.0), 200. mu.L of 100mM EDTA (pH8.0), 250. mu.L of 5% SDS and 5. mu.L of 2 mg/mL proteinase K ] was added, the volume was adjusted to 1mL with distilled water, stored at-20 ℃ and a DNA grinding bead, and the beads were ground thoroughly with a grinder at 60Hz for 120s (care was taken after grinding to get the impurities as far as possible to the bottom of the EP tube for the subsequent water bath digestion process). The mixture is then placed in a 55 ℃ water bath for at least 5 hours (typically overnight for digestion), during which time the mixture may also be mixed by inversion until the mixture becomes clear.

(2) Adding equal volume of DNA extract (taking the lower layer and the upper layer of Tris-hydrochloric acid) into the mixed solution after digestion is finished, slowly inverting the EP tube from top to bottom for about ten times, centrifuging at 12000rpm for 15min, taking the supernatant, transferring the supernatant to another clean EP tube (not absorbing the middle impurity layer as much as possible), and repeating the step until no obvious white protein layer can be seen at the interface between the upper layer and the lower layer.

(3) The supernatant from the above step was pipetted into a new EP tube and an equal volume of chloroform was added: isoamyl alcohol (24:1), the EP tube was slowly inverted from top to bottom about ten times, centrifuged at 12000rpm for 15min, and the supernatant was collected.

(4) Adding 2/2.5 times volume of anhydrous ethanol (precooling at 4 deg.C in advance), turning upside down, mixing, standing at-20 deg.C for 2-3h (this step can be placed at-80 deg.C for 30min-1h), centrifuging at 12000rpm in 4 deg.C centrifuge for 20min, and removing supernatant to obtain precipitate as DNA.

(5) The liquid centrifuged in the above step was poured out, 1mL of 75% ethanol pre-cooled in advance was added to the resulting suspension, DNA was suspended by blowing, centrifuged at 12000rpm for 10min in a centrifuge, and the supernatant was discarded (this step can be divided into two steps, each of which was performed by adding 500. mu.L of 75% ethanol). And drying the washed DNA precipitate for 5-10min in a fume hood.

(6) After the edge of the precipitate is slightly transparent, adding a proper amount of sterilized ultrapure water (generally 10-100uL) according to the amount of the precipitate to dissolve DNA.

(7) After the DNA concentration is determined, a 1 mu LDNA sample is sucked and added into 9 mu L of ultrapure water for gel running verification, the condition that the strip is complete and not degraded is qualified, and the DNA sample is stored for a long time at the temperature of 20 ℃ below zero for standby.

1.3.4 general PCR reaction

The PCR reaction template is a genome DNA sample, the total volume is 20uL, and the reaction system is as follows:

slmmp-2 mutant detection primers:

and (3) PCR reaction system:

the mixture was placed in a PCR tube, gently flicked with a finger at the bottom of the PCR tube and mixed, centrifuged at low speed for 10 seconds, and then placed in a PCR vessel according to the procedure in the following table:

the steps 2-4 are repeated, and the cycle number is set according to the experimental conditions (different primers and amplified fragments with different lengths can change the Tm value and the time according to the actual conditions).

After the PCR amplification is finished, the PCR product is detected by agarose gel electrophoresis, and is sent to the company Limited in Biotechnology engineering (Shanghai) for sequencing.

2. Results of the experiment

2.1 Slmmp-2 mutant detection results

Feeding the injected G0 larvae to a pre-pupation stage, independently extracting pupa ecdysis genome DNA of each head worm, performing PCR amplification by using a detection primer, sequencing, and comparing the obtained sequence with a Slmmp-2 original sequence to find 7 mutation types: cexu-1, cexu-2, cexu-3, cexu-5, cexu-7, cexu-9, and cexu-10 (shown in FIG. 5). The resulting G0 generation mutant was mated and spawned, and individually raised as individual egg masses until adult. And breeding a plurality of eggs of Slmmp-2 mutant G1 generation separately, extracting a small part of genome DNA from each egg before the larva hatches (refer to step 1.3.3 in the embodiment), detecting whether each egg has mutation at the site, and reserving the mutant egg for breeding. After the larvae grow to 6 years old, 3 egg masses with good growth vigor are selected to continue the following screening work, and the rest larvae are discarded.

The numbers of the finally remained 3 mutant egg blocks are 1(cexu-1), 7(cexu-7) and 11(cexu-11), after the mutant larvae grow to 6 years old, 15 male and female larvae are respectively selected from the three mutant egg blocks and placed in a separation box for single-head feeding, and the rest insects are placed in the same box for feeding so as to facilitate spawning and passage. Collecting pupa slough of each head of worm selected at pupal stage for mutation site detection, finding that the egg mass 1 has 1 head of prodenia litura, the sequencing result is a single peak (figure 6), and may be a homozygous mutant, but most sequences are different when the sequence is compared with that of wild insects, and the mutation type is only 1 head, and carrying out detection analysis after the egg mass is passed to G2 generation. In addition, the egg mass 7 has 1 female worm (figure 7), the egg mass 11 has 2 male worms and 1 female worm (figure 8), the sequencing result is a single peak, and the mutation type is the same as that of the deletion of 24 bases. Finally, 4 homozygous mutants of both egg masses (egg mass 7 and egg mass 11) were placed individually in the same box and observed for mating behavior and mutant phenotype.

2.2 abnormal mating of Slmmp-2 mutants

The detected homozygous mutants (4 homozygous mutants in 2.1) were placed under an infrared camera (Haikangwei, China) and the behavior changes were recorded for 5 days. Abnormal behavior of puppet and mating is observed, and normal mating is not completed. Among them, the mutant males have strong mating desire, and produce a series of coupling behaviors, including continuously waving the diptera, approaching the females continuously, and raising the tails to try to mate with the female moths, while the females do not respond to the various coupling behaviors of the males, even flying elsewhere. On day 4 post-adult, only one pair of male and female mutants underwent copulation for about 10 seconds, followed by immediate separation, and at the rest time, no copulation occurred (see in particular the video screenshot of fig. 9).

It can be seen from the above examples that after the Slmmp-2 gene is knocked out by using the CRISPR/Cas9 technology, the normal mating of the prodenia litura imagoes is influenced, so that the imagoes cannot be subjected to normal passage, and the Slmmp-2 gene can be used as a new target gene for preventing and treating the prodenia litura.

The embodiments of the present invention have been described in detail, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, and still fall within the scope of the invention.

Sequence listing

<110> university of south China

Application of <120> Slmmp-2 gene in prevention and control of agricultural pests

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Oligo(dT)(Artificial Sequence)

<400> 1

tttttttttt tttttttt 18

<210> 2

<211> 20

<212> DNA

<213> mmp-2-qPCR-F(Artificial Sequence)

<400> 2

cgaccacgac tccttcagac 20

<210> 3

<211> 20

<212> DNA

<213> mmp-2-qPCR-R(Artificial Sequence)

<400> 3

gcgtccatga gctcctatcc 20

<210> 4

<211> 23

<212> DNA

<213> SlRP49-F(Artificial Sequence)

<400> 4

cgtgagctgg agatcctgat gat 23

<210> 5

<211> 23

<212> DNA

<213> SlRP49-R(Artificial Sequence)

<400> 5

ctctacaatg gtcttgcgct tct 23

<210> 6

<211> 19

<212> DNA

<213> T7 promoter Sequence (Artificial Sequence)

<400> 6

taatacgact cactatagg 19

<210> 7

<211> 20

<212> DNA

<213> target site Sequence (Artificial Sequence)

<400> 7

aagaagggtc ggccggaggt 20

<210> 8

<211> 77

<212> DNA

<213> gRNA Sequence (Artificial Sequence)

<400> 8

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgct 77

<210> 9

<211> 116

<212> DNA

<213> sgRNA Sequence (Artificial Sequence)

<400> 9

taatacgact cactatagga agaagggtcg gccggaggtg ttttagagct agaaatagca 60

agttaaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgct 116

<210> 10

<211> 24

<212> DNA

<213> MMP-2-2-jiance-F(Artificial Sequence)

<400> 10

agtaagttga tctatgtgac tgtg 24

<210> 11

<211> 22

<212> DNA

<213> MMP-2-2-jiance-R(Artificial Sequence)

<400> 11

gtgatagacc agtttgtggt ac 22

Claims (4)

1. A method for interfering mating of prodenia litura is characterized by firstly aiming atSlmmp-2Gene design of sgRNA, followed by injection of sgRNA and Cas9 protein knock-out into Trichoplusia niSlmmp-2A gene ofSlmmp-2The NCBI accession number of the gene is XM _022958284.1, which in turn affects normal mating of spodoptera litura.

2. The method for interfering mating of prodenia litura, according to claim 1, wherein the nucleotide sequence of sgRNA is shown as SEQ ID No. 9.

3. The method for interfering mating of prodenia litura, which is characterized in that the sgRNA is used at a concentration of 1000-1500ng/μ L, the Cas9 protein is used at a concentration of 1000ng/μ L, and the mass ratio of the sgRNA to the Cas9 protein is 1-2: 1.

4. the method for interfering mating of prodenia litura according to claim 1, wherein the sgRNA to Cas9 protein mass ratio is 1: 1 or 2: 1.

Images