CN102618528B - Deleting system for long fragments in genome based on TALEN (transcription activator-like effector Nuclease) and ssODNs (single stranded oligonucleotides) and application thereof - Google Patents

Abstract

The invention discloses a deleting system for long fragments in a genome based on TALEN and ssODNs. The deleting system is composed of a transcription activator-like effector nuclease (TALEN) and a single stranded oligonucleotides (ssODNs) of a shearing objective gene target sequence. The deleting system can accurately distinguish target sequences with the T(Nn) structure, can realize the deletion of the long fragments in the genome. The invention also discloses the application of the deleting system for the long fragments in the genome; and the deleting system has high deleting efficiency and completely changes the genetic information of the genome, thereby obtaining varieties with great hereditary variation and providing rich genetic resources for breeding.

Description

Genome long segment deletion system and application thereof based on TALEN and ssODNs

technical field

The present invention relates to biological technical field, particularly relate to the genome long segment deletion system based on TALEN and ssODNs, also relate to the application of genome long segment deletion system.

Background technology

Silkworm is that the raising and the domestication that have had more than 5000 year of important economic insects and lepidopterous insects model animals ， China is historical.Silk Industry in history Yu Nong Bing Mao，Wei Chinese nation expanding economy always has all been made huge contribution with carrying forward of culture.Silk has the gloss of natural, graceful and poised elegance, slim and graceful comfortable sense of touch, good dress material drape and curve, moderate water-absorbent and the intrinsic good characteristics such as affinity to human skin, all deeply be subject to for a long time liking of consumers in general, therefore silk be also described as " fiber queen ".China's silk textile industry gross annual output value reaches 1,350 hundred million yuan at present, accounts for the more than 10% of the textile industry gross output value; Silk output and export volume account for respectively the more than 70% and 80% of world's total value, earn foreign exchange in year and surpass 5,000,000,000 dollars, are specialty industries in absolute predominance in the international market.Sang Yangcan peasant household more than 2,000 ten thousand families, total kind of the whole nation, spread all over more than 20 provinces and regions.Silkworm industry is the important component part in current China rural economy, and within its year, foreign exchange earning volume ranks among the best in agricultural-food, is the important sources of farmers' income.Silk industry is solving agriculture, rural areas and farmers problem, particularly increases farmers' income, adjusts and in the structure of rural undertaking, bringing into play more and more important effect.

Yet, as ancient conventional industries, silkworm and mulberry silk production technology and level over nearest 60 years all in a plateau.The variety source problems such as the Major Economics such as the robustness of silkworm kind, spun silk quality, output are poor never obtain great breakthrough, and the inherent defects such as silk clothes easily turn to be yellow, crumple do not obtain basic solution.Variety source upgrades and does not catch up with need of production far away, and Silk Industry integral production benefit is low.This be mainly because: the 1) excavation of a century in process, the yield potential based on traditional breeding method means has performed to ultimate attainment, the singularity of natural condition and limitation are in addition difficult to the limitation of breakthrough variety source itself at present.Although existing cultivated silkworm breed variety kind and quantity are a lot of, its genetic background is single, and economic characters each other and biological character do not have significant difference.Cultivated silkworm breed variety alternates through century-old, all there is no significant improvement on economic characters and biological character.2) as textile fibres, silk makes numerous human consumers hope to halt because it is expensive, and silk has easy jaundice, wrinkling shortcoming in addition, makes it in various textile fibress, not occupy the very large market share.In the nearly decades of almost stagnating at silk industry, the research of the textile fibress such as cotton, hair and utilization progress are good, and various regenerated fibers are a dark horse, and silk industry has been caused to larger impact.3) for a long time, the main purpose of mankind's domestication and raising silkworm is that filature is knitted silk fabric, so existing cultivated silkworm breed variety is nearly all machine-made multifibres amount kind, what difference the composition of its silk and characteristic there is no.In silkworm industry science and technology today with rapid changepl. never-ending changes and improvements, silk is more and more re-recognized as a kind of multi-functional biomaterial.

Silkworm is idealized model biology and the important bio-reactor of research lepidopterous insects.Particularly important contribution is found to make in the basis that family's silkworm genetics and physiological early stage achievement in research are the aspects such as insect pheromone, hormone, anatomy, physiology and genetics; After silkworm genome frame diagram, the meticulous figure of domestic silkworm gene group, domestic silkworm gene chip and heritable variation figure resolve in succession, domestic silkworm gene group and functional genomics research also play a part very important in modern insect biology research.As unique organ synthetic and secretion silk-protein, domestic natural silk gland is the strongest biologic-organ of protein synthesis capacity in insect, more than a boss silkworm can produce true protein 0.5g.No matter be in fundamental research, or at medicine, makeup development field, the albumen of extraction or expression and purification is all being played the part of extremely important role.Raise cost less than 1 mao of a silkworm, but can tell the silk-protein of 0.5g, and if can allow the silkworm 0.5g pure protein that spues by genetic engineering means, this will be for silk industry, even biological industry all will produce revolutionary pushing effect.Also this peculiar biological phenomena and application prospect are attracting numerous biologists since molecular biology is made a start, to be just devoted for years in the exploitation of expression regulation and the silkworm biological reactor of By Juvenile Hormone just.

The limitation of Gonna breakthrough traditional breeding method, the revolutionary character that obtains breed breeding breaks through; Thoroughly overcome the inherent defect of silk, life in the textile fibres market of recovery silk; The multi-functional silk material of development of new, promotes single silk industry to more wide non-spun silk industry expansion, and these are all the key issues that need solve in modern silkworm industry.In the molecular farming epoch, the solution of these problems be unable to do without biological function explore and the genetic modification to silkworm important economical trait genes involved.To farthest bring into play the model function of silkworm in lepidopterous insects research, promote the further development and application of silkworm biological reactor, also be unable to do without the important molecular tools such as transgenosis, genome editor and genetic modification.Although the molecular improvement instrument of the widespread use at present such as transgenosis and RNAi has obtained good application in silkworm, but transgenosis and RNAi can not thoroughly delete the nucleotide sequence in genomic, and the technology that can directly silkworm native gene be edited and be transformed at present have not been reported, the relevant report that does not more have Long fragment gene group sequence to delete.

Summary of the invention

The object of the present invention is to provide a kind of genome long segment deletion system based on TALEN and ssODNs and the application of application and this deletion system thereof, utilize this deletion system can in genome, delete goal gene long segment, obtain the large kind of heritable variation, for breeding provides abundant genetic resources.

For achieving the above object, technical scheme is:

1. the genome long segment deletion system based on TALEN and ssODNs, described deletion system is comprised of the transcriptional activation increment effector nuclease TALEN and the single stranded oligonucleotide ssODNs that shear goal gene target sequence, and described restriction endonuclease TALEN is comprised of with the nuclease TALEN-R that shears described target sequence 3 ' end the nuclease TALEN-L that shears described target sequence 5 ' end; Described single stranded oligonucleotide ssODNs is comprised of at least 10 continuous nucleotides of the target sequence of described goal gene and at least 10 continuous nucleotides of distance described target sequence upstream or at least 1 base in downstream.

Further, described target sequence is the nucleotide sequence of T (Nn) A, and N is A, G, and the arbitrary base in T and C, n is the arbitrary numeral between 24 to 65.

Further, described goal gene is silkworm oily silkworm gene bmBlos2, described target sequence is nucleotide sequence as shown in SEQ ID NO.2.

Further, the protein of described nuclease TALEN-L nucleotide coding as shown in SEQ ID NO.3; The protein of described nuclease TALEN-R nucleotide coding as shown in SEQ ID NO.4.

Further, described single stranded oligonucleotide ssODNs is comprised of continuous 60 Nucleotide of 795 bases of continuous 40 Nucleotide and distance described target sequence upstream of described target sequence.

Further, described single stranded oligonucleotide ssODNs Nucleotide as shown in SEQ ID NO.17.

2. described in, genome long segment deletion system is transformed the application of goal gene in target cell genome.

Further, described target cell is silkworm egg cell.

Further, described goal gene is silkworm oily silkworm gene bmBlos2.

Beneficial effect of the present invention is: the present invention utilizes TALEN and ssODNs technology, the feature by TALEN with special shearing nucleic acid target sequence, in goal gene indoor design, contain the protein of identifying target sequence, and be equipped with nuclear localization signal NLS and nuclease FokI in the provided upstream of identification target sequence protein, target protein can be positioned in nucleus, and identify target sequence place and shear by nuclease FokI; Also utilize single stranded oligonucleotide ssODNs to there is repairing effect to nucleotide sequence simultaneously, by ssODNs, be combined with target sequence upstream or downstream sequence, in genome, complete and delete and repair, finally can realize long segment deletes, it is simple to operate, can realize arbitrary sequence is deleted, and can also utilize DNA homolog principle to realize the disposable deletion of polygene simultaneously, can obtain the kind that heritable variation is large, abundant genetic resources is provided.

Accompanying drawing explanation

Fig. 1 has shown silkworm oily silkworm gene bmBlos2structural representation and shear the recognition site of the restriction endonuclease TALEN of goal gene target sequence, the length of numeral exon or intron wherein, ATG and TAA represent respectively initial sum terminator codon, underscore represents the identification module of TALEN.

Fig. 2 has shown silkworm oily silkworm gene bmBlos2the phenotype of silkworm after knocking out, wherein WT represents that the silkworm of wild-type is individual, mutant represents mutant.

Fig. 3 shown and injected the mutant nucleotide sequence producing after B3, and wherein a figure represents silkworm oily silkworm gene bmBlos2part-structure schematic diagram, the arrow of top represents the position of PCR and sequencing primer, b figure represents the sequence from the mutated individual from different moth circles, sign with " > " beginning represents different moth circle numberings, that " △ ", " M " and " I " represent respectively disappearance, Substitution and insertion, thereafter numeral disappearance, the base number of replacing or inserting, the number of " X " and numeral corresponding sequence below, the recognition site that the sequence of underscore is TALEN.

Fig. 4 has shown silkworm oily silkworm gene bmBlos2structural representation and goal gene delete result.Wherein a figure has shown silkworm oily silkworm gene bmBlos2structural representation, black line represents the design of ssODNs; B figure has shown the PCR result after TALEN and ssODNs after common injection, and the size of object band is 556bp, the efficiency of the numeral sudden change of bottom.

embodiment:

In order to make the object, technical solutions and advantages of the present invention clearer, below in conjunction with accompanying drawing, the present invention is described in further detail.These embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in embodiment, conventionally according to normal condition, for example condition described in molecular cloning experiment guide (third edition, the work such as J. Pehanorm Brooker), or the condition of advising according to manufacturer.

The cultivated silkworm breed variety using in embodiment is for " N4”，You Southwest China university domestic silkworm gene resources bank provides.

one, silkworm oily silkworm gene bmBlos2sequential analysis

From silkDB database, download silkworm oily silkworm gene bmBlos2sequence (being numbered BGIBMGA002101).Sequential analysis shows that this gene comprises four long 180bp of being respectively, 131bp, the exon of 112bp and 608bp and three long 2465bp that are respectively, the intron of 663bp and 2703bp, First Exon comprises the coding region of non-translational region and the 55bp of 125bp, and its structure as shown in Figure 1.According to the rule of gene knockout, the second and the 3rd exon of this gene is desirable target site, and it is target sequence that the present embodiment be take Second Exon and the 3rd exon.

two, the design of the 3rd exon TALEN sequence

According to silkworm oily silkworm gene bmBlos2sequence signature, we select sequence on the 3rd exon as the target sequence of TALEN effect, silkworm silkworm oily silkworm gene bmBlos2the 3rd exon nucleotide sequence is as shown in SEQ ID NO.1, and the nucleotides sequence that is T (Nn) A by structure according to TALEN principle is classified TALEN identification target sequence as, and wherein N is A, G, and the arbitrary base in T and C, n is the arbitrary numeral between 24 to 65.According to the target site of above-mentioned principle design TALEN identification be 5 '- tcaccaagtacgcagatcta aggagcctagccgcg aacctgaacaagaccctta-3 ' (SEQ ID NO.2), line part is TALEN identification module, black matrix partly represents intervening sequence, wherein 5 ' end line nucleotides sequence is classified 5 ' end recognition sequence as, 1-20 position Nucleotide shown in corresponding SEQ ID NO.2,3 ' end line nucleotides sequence is classified 3 ' end recognition sequence, the 36-54 position nucleotide sequence shown in corresponding SEQ ID NO.2 as.Hold recognition sequence according to A=NI 5 ' end recognition sequence and 3 ' respectively, T=NG, G=NN, the variable sequence of the protein of C=HD rule design identification target sequence, and at protein upstream coupling nuclear localization signal NLS, downstream coupling nucleic acid enzyme FokI, obtains being respectively composed in series successively nuclease TALEN-R by nuclear localization signal NLS, the protein of identifying 5 ' end recognition sequence and nuclease TALEN-L that nuclease FokI is composed in series successively with by nuclear localization signal NLS, the protein and the nuclease FokI that identify 3 ' end recognition sequence.According to the aminoacid sequence design coding nucleic acid enzyme TALEN-L of nuclease TALEN-L and nuclease TALEN-R and the nucleotide sequence of nuclease TALEN-R, the nucleotide sequence of coding nucleic acid enzyme TALEN-L is as shown in SEQ ID NO.3, 82-102 position nucleotide coding nuclear localization signal NLS wherein, the protein of 120-2826 position nucleotide coding identification 5 ' recognition sequence, 2833-3420 position nucleotide coding endonuclease FokI, the nucleotide sequence of coding nucleic acid enzyme TALEN-R is as shown in SEQ ID NO.4, 76-96 position nucleotide coding nuclear localization signal NLS wherein, the protein of 114-2820 position nucleotide coding identification 3 ' recognition sequence, 2826-3414 position nucleotide coding nuclease FokI.

three, the preparation of the mRNA of coding TALEN-L and TALEN-R

The nucleotide sequence (SEQ ID NO.3 and SEQ ID NO.4) of difference synthetic coding nucleic acid enzyme TALEN-L and nuclease TALEN-R, again with restriction enzyme KpnI and the prokaryotic expression carrier pET28a being connected after BamHI double digestion through enzyme is cut equally, then transform intestinal bacteria, and screening positive clone, obtain recombinant plasmid pair, called after pET28a-B3L and pET28a-B3R.Gained recombinant plasmid is carried out to in-vitro transcription with MessageMax T7 mRNA in-vitro transcription test kit (purchased from Epicentre) after cutting digestion with Xho I enzyme respectively, in-vitro transcription condition is: in temperature, be to hatch 30 minutes under 37 ℃ of conditions, add 1 μ L DNA enzyme, then continue to hatch 15 minutes.Then reaction solution is added to A reaction with Epicentre A-plus tailing test kit (purchased from Epicentre), reaction conditions is: in temperature, be to hatch 30 minutes under 37 ℃ of conditions, then use MEGAClear test kit (purchased from Ambion) to carry out purifying, obtain the mRNA of coding nucleic acid enzyme TALEN-L and nuclease TALEN-R, mRNA mixture name B3 by the mRNA of gained nuclease TALEN-L and nuclease TALEN-R, saves backup in-80 ℃.

four, B3 microinjection

Selecting polyvoltinism cultivated silkworm breed variety " N4 ", is that 25 ℃, relative humidity 75% ± 5%, photoperiod are that the condition that 12 hours illumination+12 are hour dark is lower in temperature, with mulberry leaf, raises.After sprouting wings, the female male Bombycis mori of moth is changed in collection simultaneously, in temperature, is that 25 ℃, light intensity are mating separation of copulating moth after 4 hours under the condition of 50 ~ 155 μ mol/m2/s, and the silkworm that female moth is invested in starching is connected to laying eggs on paper, and gained silkworm seed is directly used in microinjection.With the microinjection instrument for B3 (FemtoJet 5247 microinjection instruments, purchased from Eppendorf) that concentration is 700ng/ μ L, inject 521 silkworm seeds in gained silkworm seed, every about 10nL of silkworm seed injection volume.Silkworm seed after injection seals injection port with nontoxic glue, and in the formaldehyde vapors that is 35% by volume percent, sterilize 5 minutes, be placed in 25 ℃, relative humidity and be 85%, the photoperiod is the hatching of hastening the hatching of silkworms of 12 hours illumination+12 hour dark environment, and the G0 of hatching is collected to raising to changing moth for newly-hatched silkworm artificial diet.

five, mutated individual screening

In 521 injection silkworm seeds, through artificial breeding, obtain 126 five-age larvas, wherein 28 show chimeric phenotype, as shown in Figure 2.126 G0 that obtain, for silkworm moth, by selfing or backcross and obtain 41 moth circle G1 for silkworm seed, are hastened the hatching of silkworms 41 moth circles and raise separately to G1 and observe for third-instar larvae, in 6 moth circles therein, find that 277 have the silkworm mutant that phenotype is oily silkworm.

six, sequencing analysis that can genetic mutation individuality

51 of silkworm mutant choosing phenotype and be oily silkworm, extract genome, choose mutational site near sequences Design PCR primer carry out pcr amplification.PCR primer: upstream primer is B3-F364:5 '-tccaatttgagggcaatgctac-3 ' (SEQ ID NO.5), downstream primer is B3-R315:5 '-atttcaccacctcattcaactaagat-3 ' (SEQ ID NO.6); Pcr amplification condition is: 94 ℃ of denaturation 4 min; 94 ℃ of sex change 30s, 59 ℃ of annealing 30s, 72 ℃ are extended 45s, 30 circulations; 72 ℃ are extended 10 min.Choose near sequences Design sequencing primer mutational site, sequencing primer is as shown in SEQ ID NO.6 simultaneously.PCR product, through electrophoresis detection, purifying, then checks order.Sequencing result shows that 51 selected silkworm mutated individuals, at the 3rd exon target sequence place, sudden change have all occurred, and sudden change comprises the insertion of variation, disappearance or small segment, and sequencing result is as SEQ ID NO.7-16, and partial results as shown in Figure 3.

seven, the design of ssODNs sequence is with synthetic

According to the 3rd exon target sequence and deletion fragment upstream sequence, it is Second Exon, design a single stranded oligonucleotide (Single-stranded oligonucleotides, ssODNs), ssODNs is comprised of 60 continuous nucleotides of 792 of 3 ' recognition sequence of the 3rd exon target sequence and distance 3 ' recognition sequence upstreams, and specifically sequence is: 5 '-tgtcaccgagctgttcgagtttcgaagtcctggatccacatgatcctgtgatcagt cggt gccgcgaacctgaacaagacccttaatgaatacaacgaga-3 ' (SEQ ID NO.17), wherein 1-60 position Nucleotide is to form according to TALEN cleavage site downstream sequence for deleting fragment upstream sequence and 61-100 position Nucleotide, and underscore is partly 3 ' the end recognition site of transcriptional activation increment effector nuclease TALEN.

eight, the micro-injection altogether of ssODNs and B3

Utilize the above-mentioned method of preparing silkworm seed to prepare silkworm seed, get 402 silkworm seeds and carry out microinjection, be specially: the ssODNs that the B3 that by concentration is 700ng/ μ L is 100mM with concentration is by volume for 1:1 mixes, then use microinjection instrument (FemtoJet 5247 microinjection instruments, Eppendorf) injection, every about 10nL of silkworm seed injection volume.Silkworm seed after injection seals injection port with nontoxic glue, and in the formaldehyde vapors that is 35% by volume percent, sterilize 5 minutes, then be placed in the hatching of hastening the hatching of silkworms of 25 ℃, the high humidity environment of relative humidity 85%, hatching obtains 61 G0 for newly-hatched silkworm, through artificial diet collect obtain altogether 35 five age silkworm, wherein 1 phenotype is mosaic (part epidermis shows transparent phenotype, and part epidermis is normal oyster white), is mutant.Extraction gained chimeric mutational body and 20 individual genomes design primers of acting normally carry out pcr amplification, and PCR primer upstream primer is 5 '-ttggtccagtaggtttgaagtaggt-3 ' (SEQ ID NO.18), and downstream primer is as SEQ ID NO.10; Pcr amplification condition is: 94 ℃ of denaturation 4 min; 94 ℃ of sex change 30s, 59 ℃ of annealing 30s, 72 ℃ are extended 45s, 30 circulations; 72 ℃ are extended 10 min, 1% agarose gel electrophoresis analysis for PCR product, detecting gained PCR band is 556bp, compare with the 1351bp not undergoing mutation, deleted 795bp fragment in goal gene, hence one can see that, in the silkworm individuality of mosaic phenotype, there is long segment deletion, delete sequence and be goal gene in the disappearance part of ssODNs, its ratio is 2.2%, and result as shown in Figure 4.

Finally explanation is, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although by with reference to the preferred embodiments of the present invention, invention has been described, but those of ordinary skill in the art is to be understood that, can to it, make various changes in the form and details, and not depart from the spirit and scope of the present invention that appended claims limits.

<110> Southwestern University

Genome long segment deletion system and the application thereof of <120> based on TALEN and ssODNs

<160> 18

<210> 1

<211> 112

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm oily silkworm gene bmBlos2the 3rd exon nucleotide sequence

<400> 1

gaacactaca tgctgcttga ggagatcaac agactcgcga tcaccaagta cgcagatcta 60

aggagcctag ccgcgaacct gaacaagacc cttaatgaat acaacgagat gt 112

<210> 2

<211> 54

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> the 3rd exon TALEN binding site

<400> 2

tcaccaagta cgcagatcta aggagcctag ccgcgaacct gaacaagacc ctta 54

<210> 3

<211> 3426

<212> DNA

<213> artificial sequence

<220>

<223> coding TALEN-L nucleotide sequence

<400> 3

atgagatctg actacaaaga ccatgacggt gattataaag atcatgacat cgattacaag 60

gatgacgatg acaagatggc ccccaagaag aagaggaagg tgggcattca tggggtaccc 120

atgatgagca gaaccagact ccccagccca ccagcgccct cgccagcgtt ttcggcaggc 180

agcttttcgg acttgttacg tcagtttgac ccaagcttat tcaacactag cctttttgat 240

tccctgcctc cattcggtgc tcaccataca gaagctgcca ctggagaatg ggacgaggtt 300

caatccggac tgagggcagc agatgcacca ccacctacca tgcgtgtggc agttacggct 360

gccaggccac cgagagctaa accagcacca agaaggcgtg cagcacaacc atcagacgct 420

tctccggctg cccaggtgga tctccgcacc ttaggttact cacaacagca acaggaaaaa 480

attaagccga aagttcgttc tacagtcgcc caacaccatg aggcattggt gggacacggc 540

tttactcacg cgcatatagt tgctctgtcg caacatccgg cagcgttggg aaccgtcgct 600

gtaaagtatc aggacatgat cgctgccctc cctgaagcca cacacgaggc aattgtgggt 660

gttggaaaac agtggtcagg tgctcgcgcc ttggaagcgc tgttgacagt ggctggagag 720

ctccgtggtc cacctttaca acttgatacc ggacagctct taaagatcgc taaaaggggt 780

ggagtcacgg cagtagaagc ggtgcacgct tggagaaacg cgttaacagg agctcccctg 840

aatttgactc ctgaacaagt ggttgcaatt gcgtcgcacg acggcggtaa acaagctctt 900

gagaccgtac agaggcttct gccagtgttg tgccaagcac atggactcac gccagcacag 960

gtcgtagcta tcgccagtaa tattggaggc aaacaagcgt tagaaacagt tcagagattg 1020

ctccccgtct tatgtcaagc tcacggtctt actcctgacc aggtggttgc aatagcgtca 1080

catgatggtg gaaagcaagc tttggagacc gtacagcgct tacttccagt gctgtgccaa 1140

gcgcacggat tgacgccggc tcaagttgta gctatcgcct ctcatgatgg cggtaaacaa 1200

gccctcgaaa cagttcagcg tctgttgccc gtcctctgtc aagcacacgg cttaactcct 1260

gaacaggttg tcgcaatagc gagcaacatc ggaggcaagc aagcgctgga gaccgtacag 1320

aggctcttac cagtgctttg ccaagctcat ggtctgacgc cggaccaggt cgtagctatt 1380

gcctccaata taggtggaaa acaagccttg gagacagttc agagacttct gcccgtcttg 1440

tgtcaagcac acggactcac tcctgatcag gttgtcgcaa ttgcgtcgaa caatggcggt 1500

aaacaagcgc tcgaaaccgt acagcgcttg ctcccagtgt tatgccaagc acatggcctt 1560

acgccggaac aggtcgtagc tatagccagt aacggaggcg gtaaacaagc cctggagaca 1620

gttcagcgtt tacttcccgt cctgtgtcaa gctcacggtt tgacaccaga ccaggtggtt 1680

gcaatcgcgt caaatattgg aggcaagcaa gccttagaaa ccgtacagag gctgttgcca 1740

gtgctctgcc aagctcacgg attaactcct gagcaagtcg ttgcaatcgc ctctcatgat 1800

ggtggaaaac aagccctcga gacagttcag agactcttac ccgtcctttg tcaagctcac 1860

ggcctgactc ctcaacaggt ggttgcaatt gcgagcaata acggtggtaa acaggccctg 1920

gaaaccgtac agcgccttct gccagtcttg tgccaagctc acggtctcac tcctgagcaa 1980

gtcgtagcta tagcctccca tgacggaggc aaacaggctt tggagacagt gcagcgtttg 2040

ctccccgttt tatgtcaagc tcatggactt actcctgatc aagttgttgc aatagcgtcg 2100

aacatcggtg gaaagcaagc tctggagacc gtccagaggt tgttgccagt gctgtgccaa 2160

gcacacggat tgactcctgc acaagttgta gctattgcca gtaataacgg cggtaaacaa 2220

gccttggaaa cagttcagcg cttgctgcct gttctctgtc aagctcatgg tttaactcct 2280

gagcaagttg tcgcaattgc gtcaaacata ggtggcaagc aggccctgga gaccgtgcag 2340

cgtctcttac cagttctttg ccaagctcac ggactgacgc cgcaacaagt ggtagctatt 2400

gcctctaatg gtggaggcaa acaagccctg gaaacagtcc agagacttct gcccgtgttg 2460

tgtcaagctc acggcctcac tcctgaacag gttgtggcaa tcgcgagcca tgacggtgga 2520

aagcaggctt tggagaccgt tcagcgcttg ctcccagtct tatgccaagc tcacggattg 2580

actcctgagc aggtcgtagc tatagcatcc aacggaggtg gaaggccagc actcgagtcg 2640

atcgtggctc aattaagtag acccgaccct gcccttgcag cgctgactaa tgatcacttg 2700

gtcgcactcg cgtgcttagg cggtagaccc gcccttgatg cagtgaaaaa gggtctgcca 2760

catgctccag cactcatcaa aagaaccaat cgtcgtattc ccgagaggac atcacacagg 2820

gtggcgggat cccagctggt gaagagcgag ctggaggaga agaagtccga gctgcggcac 2880

aagctgaagt acgtgcccca cgagtacatc gagctgatcg agatcgccag gaacagcacc 2940

caggaccgca tcctggagat gaaggtgatg gagttcttca tgaaggtgta cggctacagg 3000

ggaaagcacc tgggcggaag cagaaagcct gacggcgcca tctatacagt gggcagcccc 3060

atcgattacg gcgtgatcgt ggacacaaag gcctacagcg gcggctacaa tctgcctatc 3120

ggccaggccg acgagatgca gagatacgtg aaggagaacc agacccggaa taagcacatc 3180

aaccccaacg agtggtggaa ggtgtaccct agcagcgtga ccgagttcaa gttcctgttc 3240

gtgagcggcc acttcaaggg caactacaag gcccagctga ccaggctgaa ccacaaaacc 3300

aactgcaatg gcgccgtgct gagcgtggag gagctgctga tcggcggcga gatgatcaaa 3360

gccggcaccc tgacactgga ggaggtgcgg cgcaagttca acaacggcga gatcaacttc 3420

tgataa 3426

<210> 4

<211> 3414

<212> DNA

<213> artificial sequence

<220>

<223> coding TALEN-R nucleotide sequence

<400> 4

atggactaca aagaccatga cggtgattat aaagatcatg acatcgatta caaggatgac 60

gatgacaaga tggcccccaa gaagaagagg aaggtgggca tccacggggt acccatgatg 120

tctcgcactc gtctccctag ccctccagca ccgtcaccag cattctcggc aggttccttc 180

tcggacttat tacgccagtt tgacccgagc ttattcaata ctagcctttt tgattccctg 240

cctccattcg gtgctcacca tacagaagct gccactggcg aatgggacga ggttcaatcc 300

ggtctgaggg cagcagatgc accaccacct accatgagag tggctgttac ggctgccagg 360

ccaccgagag ctaaaccagc accaagaagg cgtgcagcac agccatcaga cgcttctccg 420

gctgcccaag tggatctcag gaccttaggt tactcacaac agcaacagga aaaaatcaaa 480

ccaaaagtta gatctacagt cgcccagcac catgaggcat tggtgggcca cggttttact 540

cacgcgcata tcgttgctct gtcgcagcat ccggcagcgt tgggaaccgt cgctgtaaag 600

tatcaagaca tgattgctgc cctccccgaa gccacacacg aggcaatagt gggagttggc 660

aaacaatggt caggagctag ggccttggaa gcgctgttga cagtggctgg agagctcaga 720

ggaccccctt tacaacttga taccggccag ctcttaaaga ttgctaaacg cggtggagtc 780

acggcagtag aagcggtgca cgcttggcgt aacgcgttaa caggagctcc cctgaatttg 840

actcctgaac aggtggttgc aatagcgtcg cacgacggcg gtaaacaagc ccttgagacc 900

gtacagcgcc ttctgccagt gttgtgccaa gcacatggtc tcacgccgca acaggtcgta 960

gctatcgcca gtaacattgg aggcaaacaa gcgttagaaa cagttcagcg tttgctcccc 1020

gtcttatgtc aagctcacgg acttactcct caacaggtgg ttgcaatcgc gtcaaacaat 1080

ggtggaaagc aagccttgga gaccgtacag aggttacttc cagtgctgtg ccaagcacat 1140

ggcttgacgc cggaacaggt cgtagctatt gcctctaata agggcggtaa acaagcgctc 1200

gagacagttc agagactgtt gcccgtcctc tgtcaagcac acggtttaac accagagcaa 1260

gtggttgcaa tagcgagcaa caatggaggc aaacaagccc tggagaccgt acaggcactc 1320

ttaccagtgc tttgccaagc ccatggactt actcctgagc aagttgtagc tatcgcctcc 1380

aacggtggag gcaagcaagc gttggagaca gttcaggctc ttctgcccgt cttgtgtcaa 1440

gctcacggcc tcacaccaga acaggtggtt gcaattgcgt cgcatgatgg tggaaaacaa 1500

gccctcgaga ccgtacaggc attgctccca gtgttatgcc aagctcacgg tcttactcct 1560

gaacaggtcg tagctatagc cagtaacggc ggtggaaagc aagctctgga gacagttcag 1620

cgcttacttc ccgtcctgtg tcaagcccat ggactgacac ccgagcaagt tgttgcaatc 1680

gcgtcaaatg gcggtggaaa acaagcattg gagaccgtac agcgtctgtt gccagtgctc 1740

tgccaggctc acggcttaac tcctcagcaa gttgttgcta ttgcctctaa caatggcggt 1800

aaacaagccc tcgaaacagt tcagaggctc ttacccgtcc tttgtcaagc tcatggtctc 1860

acacccgagc aggttgtcgc aatagcgagc aacggaggcg gtaaacaagc gctggagacc 1920

gtacaggctc ttctgccagt cttgtgccaa gctcacggac tcactccaga gcaagtcgta 1980

gctatcgcct ccaatggagg cggtaaacaa gccttggaga cagtgcagag attgctcccc 2040

gttttatgtc aagctcacgg ccttacaccc gagcaggttg tggctattgc gtcgcatgac 2100

ggtggcaaac aggccctgga gaccgtccag cgcttgttgc cagtgctgtg ccaagctcat 2160

ggtctgactc cagagcaggt tgttgctata gccagtaaca tcggaggaaa gcaggccttg 2220

gagacagttc agcgtttgct gcctgttctc tgtcaagctc acggattaac acccgagcag 2280

gttgttgcaa tagcgtcaaa taacggtggt aaacaggctt tggagaccgt gcagagactc 2340

ttaccagttc tttgccaagc tcatggcctg actcctcagc aagtggttgc tatcgcctct 2400

aacaaaggag gccgccccgc cctggaaaca gtccaacgtc ttctgcctgt gttgtgtcag 2460

gctcacggtc tcactccaga acaagtggtt gcaattgcga gcaatggagg tggcaaacaa 2520

gctttggaga ccgttcagcg cttgctcccg gtcttatgcc aggctcacgg acttacgccc 2580

cagcaagtgg tcgctatcgc atccaacggt ggaggaaggc ctgcactcga atcgattgtg 2640

gcacaattaa gtcgtcccga ccctgccctt gcagcgctga ctaatgatca cttggtcgca 2700

ctcgcgtgct taggtggaag acctgccctt gatgcagtga aaaagggtct gccacatgct 2760

cccgcactca tcaagagaac taatagacgc atacccgaga gaaccagcca ccgtgttgct 2820

ggatcccagc tggtgaagag cgagctggag gagaagaagt ccgagctgcg gcacaagctg 2880

aagtacgtgc cccacgagta catcgagctg atcgagatcg ccaggaacag cacccaggac 2940

cgcatcctgg agatgaaggt gatggagttc ttcatgaagg tgtacggcta caggggaaag 3000

cacctgggcg gaagcagaaa gcctgacggc gccatctata cagtgggcag ccccatcgat 3060

tacggcgtga tcgtggacac aaaggcctac agcggcggct acaatctgcc tatcggccag 3120

gccgacgaga tggagagata cgtggaggag aaccagaccc ggaataagca cctcaacccc 3180

aacgagtggt ggaaggtgta ccctagcagc gtgaccgagt tcaagttcct gttcgtgagc 3240

ggccacttca agggcaacta caaggcccag ctgaccaggc tgaaccacat caccaactgc 3300

aatggcgccg tgctgagcgt ggaggagctg ctgatcggcg gcgagatgat caaagccggc 3360

accctgacac tggaggaggt gcggcgcaag ttcaacaacg gcgagatcaa cttc 3414

<210> 5

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> the 3rd exon upstream detection primer B3-F364

<400> 5

tccaatttga gggcaatgct ac

<210> 6

<211> 26

<212> DNA

<213> artificial sequence

<220>

<223> the 3rd exon detected downstream primer B3-R315

<400> 6

atttcaccac ctcattcaac taagat 26

<210> 7

<211> 674

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Bb-1-01 sequencing result

<400> 7

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 360

aaccgcgaac ctgaacaaga cccttaatga atacaacgag atgtgtgagt ttttaactgg 420

aaccatcaat tttttaatga atgtattgcc agcaaatgtg tcataataca aagcaacttg 480

tgtttcagtt atcaaataat ttgataaaca ctgtggctag cttatgtgtc atttgttttt 540

gtgaaggcat agaattgaaa taatccctca tatcaactat tgctataatc tctaaattgc 600

attctgtcaa cgcctggcct attagaattt aggcctaact aacacaagat cttagttgaa 660

tgaggtggtg aaat 674

<210> 8

<211> 673

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Bb-1-05 sequencing result

<400> 8

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 360

agcgcgaacc tgaacaagac ccttaatgaa tacaacgaga tgtgtgagtt tttaactgga 420

accatcaatt ttttaatgaa tgtattgcca gcaaatgtgt cataatacaa agcaacttgt 480

gtttcagtta tcaaataatt tgataaacac tgtggctagc ttatgtgtca tttgtttttg 540

tgaaggcata gaattgaaat aatccctcat atcaactatt gctataatct ctaaattgca 600

ttctgtcaac gcctggccta ttagaattta ggcctaacta acacaagatc ttagttgaat 660

gaggtggtga aat 673

<210> 9

<211> 680

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Bb-1-07 sequencing result

<400> 9

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 360

agcagaagcc gcgaacctga acaagaccct taatgaatac aacgagatgt gtgagttttt 420

aactggaacc atcaattttt taatgaatgt attgccagca aatgtgtcat aatacaaagc 480

aacttgtgtt tcagttatca aataatttga taaacactgt ggctagctta tgtgtcattt 540

gtttttgtga aggcatagaa ttgaaataat ccctcatatc aactattgct ataatctcta 600

aattgcattc tgtcaacgcc tggcctatta gaatttaggc ctaactaaca caagatctta 660

gttgaatgag gtggtgaaat 680

<210> 10

<211> 678

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Be-4-02 sequencing result

<400> 10

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatgaaagg 360

agctagccgc gaacctgaac aagaccctta atgaatacaa cgagatgtgt gagtttttaa 420

ctggaaccat caatttttta atgaatgtat tgccagcaaa tgtgtcataa tacaaagcaa 480

cttgtgtttc agttatcaaa taatttgata aacactgtgg ctagcttatg tgtcatttgt 540

ttttgtgaag gcatagaatt gaaataatcc ctcatatcaa ctattgctat aatctctaaa 600

ttgcattctg tcaacgcctg gcctattaga atttaggcct aactaacaca agatcttagt 660

tgaatgaggt ggtgaaat 678

<210> 11

<211> 673

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Be-4-04 sequencing result

<400> 11

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 360

agccgcgaac ctgttaagac ccttattgaa tacaacgaga tgtgtgagtt tttaactgga 420

accatcaatt ttttaatgaa tgtattgcca gcaaatgtgt cataatacaa agcaacttgt 480

gtttcagtta tcaaataatt tgataaacac tgtggctagc ttatgtgtca tttgtttttg 540

tgaaggcata gaattgaaat aatccctcat atcaactatt gctataatct ctaaattgca 600

ttctgtcaac gcctggccta ttagaattta ggcctaacta acacaagatc ttagttgaat 660

gaggtggtga aat 673

<210> 12

<211> 669

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Be-4-06 sequencing result

<400> 12

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 360

agcgcctgaa caagaccctt aatgaataca acgagatgtg tgagttttta actggaacca 420

tcaatttttt aatgaatgta ttgccagcaa atgtgtcata atacaaagca acttgtgttt 480

cagttatcaa ataatttgat aaacactgtg gctagcttat gtgtcatttg tttttgtgaa 540

ggcatagaat tgaaataatc cctcatatca actattgcta taatctctaa attgcattct 600

gtcaacgcct ggcctattag aatttaggcc taactaacac aagatcttag ttgaatgagg 660

tggtgaaat 669

<210> 13

<211> 669

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Be-4-09 sequencing result

<400> 13

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 360

agcacctgaa caagaccctt aatgaataca acgagatgtg tgagttttta actggaacca 420

tcaatttttt aatgaatgta ttgccagcaa atgtgtcata atacaaagca acttgtgttt 480

cagttatcaa ataatttgat aaacactgtg gctagcttat gtgtcatttg tttttgtgaa 540

ggcatagaat tgaaataatc cctcatatca actattgcta taatctctaa attgcattct 600

gtcaacgcct ggcctattag aatttaggcc taactaacac aagatcttag ttgaatgagg 660

tggtgaaat 669

<210> 14

<211> 678

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Be-4-12 sequencing result

<400> 14

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 360

agctagccgc gaacctgaac aagaccctta atgaatacaa cgagatgtgt gagtttttaa 420

ctggaaccat caatttttta atgaatgtat tgccagcaaa tgtgtcataa tacaaagcaa 480

cttgtgtttc agttatcaaa taatttgata aacactgtgg ctagcttatg tgtcatttgt 540

ttttgtgaag gcatagaatt gaaataatcc ctcatatcaa ctattgctat aatctctaaa 600

ttgcattctg tcaacgcctg gcctattaga atttaggcct aactaacaca agatcttagt 660

tgaatgaggt ggtgaaat 678

<210> 15

<211> 667

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Be-4-17 sequencing result

<400> 15

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 60

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 120

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 180

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 240

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 300

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 360

aacctgaaca agacccttaa tgaatacaac gagatgtgtg agtttttaac tggaaccatc 420

aattttttaa tgaatgtatt gccagcaaat gtgtcataat acaaagcaac ttgtgtttca 480

gttatcaaat aatttgataa acactgtggc tagcttatgt gtcatttgtt tttgtgaagg 540

catagaattg aaataatccc tcatatcaac tattgctata atctctaaat tgcattctgt 600

caacgcctgg cctattagaa tttaggccta actaacacaa gatcttagtt gaatgaggtg 660

gtgaaat 667

<210> 16

<211> 667

<212> DNA

<213> silkworm ( bombyx moril.)

<220>

<223> silkworm mutant Bc-21-11 sequencing result

<400> 16

tccaatttga gggcaatgct acaatattag aactgcacta ttaaaaataa tcgatttaat 61

gaatgaaaga ttaataaatc tacagtttat ttcgaaataa atagtatcag atctttgttt 121

tgtataaatt tttttatgaa tatctataac cagtttagag aaaatctgta agaataataa 181

atccttaagc aaattgttgc aagggactga ttgttgtatc acaccaaggt acttaagacc 241

cagagaatta ccagaaacaa gacccatatg gttatttcaa gtaaatattt gatacaggaa 301

cactacatgc tgcttgagga gatcaacaga ctcgcgatca ccaagtacgc agatctaagg 361

agccgcgaac ctgaacaaga cccttaatga atacaacgag atgtgtgagt ttttaactgg 421

aaccatcaat tttttaatga atgtattgcc agcaaatgtg tcataataca aagcaacttg 481

tgtttcagtt atcaaataat ttgataaaca ctgtggctag cttatgtgtc atttgttttt 541

gtgaaggcat agaattgaaa taatccctca tatcaactat tgctataatc tctaaattgc 601

attctgtcaa cgcctggcct attagaattt aggcctaact aacacaagat cttagttgaa 661

tgaggtggtg aaat 674

<210> 17

<211> 100

<212> DNA

<213> artificial sequence

<220>

<223> ssODNs nucleotide sequence

<400> 17

tgtcaccgag ctgttcgagt ttcgaagtcc tggatccaca tgatcctgtg atcagtcggt 60

gccgcgaacc tgaacaagac ccttaatgaa tacaacgaga 100

<210> 18

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> mutant amplification upstream primer

<400> 18

ttggtccagt aggtttgaag taggt 25

Claims (2)

1. the genome long segment deletion system based on TALEN and ssODNs, it is characterized in that: described deletion system is comprised of the transcriptional activation increment effector nuclease TALEN and the single stranded oligonucleotide ssODNs that shear goal gene target sequence, described transcriptional activation increment effector nuclease TALEN is comprised of with the nuclease TALEN-R that shears described target sequence 3 ' end the nuclease TALEN-L that shears described target sequence 5 ' end; At least 10 continuous nucleotide of described single stranded oligonucleotide ssODNs in described target sequence and at least 10 continuous nucleotides of distance described target sequence upstream or at least 1 base in downstream form;

Described goal gene is silkworm oily silkworm gene bmBlos2, described target sequence is nucleotide sequence as shown in SEQ ID NO.2; The protein of described nuclease TALEN-L nucleotide coding as shown in SEQ ID NO.3; The protein of described nuclease TALEN-R nucleotide coding as shown in SEQ ID NO.4; Described single stranded oligonucleotide ssODNs is Nucleotide as shown in SEQ ID NO.17.

2. described in claim 1, genome long segment deletion system is transformed silkworm oily silkworm gene in silkworm egg cellular genome bmBlos2application.

Images