CN114107238B - Application of CYP710A1 gene or protein thereof - Google Patents

Abstract

The invention relates to the technical field of genetic breeding, in particular to application of CYP710A1 gene or protein thereof. The invention discloses application of CYP710A1 gene in improving plant insect resistance, wherein sterol C-22 dehydrogenase-1 (AtCYP 710A 1) gene from Arabidopsis is introduced into Arabidopsis acceptor material by agrobacterium-mediated genetic transformation method, and a plurality of transgenic positive lines are obtained. Indoor insect-resistant experiments show that compared with a control group, the cotton bollworms fed by transgenic plants have remarkably reduced cholesterol content in bodies, the weight of larvae of one age is remarkably reduced, and the generation period is remarkably prolonged. Compared with the control group, the survival rate of 3-and 4-year-old insects is obviously reduced when the transgenic plant is fed with lygus lucorum. Thus, over-expression of the CYP710A1 gene in plants can significantly affect the growth and development of plant pests, thereby reducing damage to the plants by the plant pests.

Description

Application of CYP710A1 gene or protein thereof

Technical Field

The invention relates to the technical field of genetic breeding, in particular to application of CYP710A1 gene or protein thereof.

Background

The grain production is guaranteed to be a fundamental condition for national survival and prosperity, and is also one of the fundamental national policies of China. Insect damage is one of the main reasons for plant yield reduction, global climate warming aggravates the damage of phytophagous insects to plants, and the global plant yield loss caused by insect damage is expected to be as high as 15-25% each year. Chemical pesticides are the main method for controlling insect pests at present, but the large amount of chemical pesticides can cause great pollution to the environment, and although Bt insect-resistant plants are widely applied, the insect-resistant spectrum is narrow: only effective on lepidoptera insects, and the Bt gene is only expressed in mesophyll tissues, so that the Bt gene can only control leaf eating insects, but has no effect on sucking insects. More notably, the chemical herbicide is greatly reduced due to the production process of Bt plants, which aggravates the harm of non-target pests. In addition, due to the large area of Bt plants, the resistance to Bt toxins that insects develop gradually becomes "super pests" due to long term planting. Therefore, finding new and effective insect-resistant methods is an urgent problem to be solved.

Insects, like all other animals, require cholesterol as an integral part of their cell membranes to regulate the permeability of animal cell membranes and to maintain cell membrane fluidity. Cholesterol is also a precursor compound for synthesizing steroid hormone, ecdysone and the like which are necessary for the growth and development of insects. Therefore, the damage of harmful insects to plants can be effectively controlled by breaking the dynamic balance of cholesterol in the insect bodies. Unlike most animals, cholesterol is a nutrient essential to insects, but insects cannot synthesize cholesterol themselves and is taken from their food. Herbivorous insects must then obtain cholesterol from the plant material they ingest.

However, the sterol synthesis of plants and animals is greatly different: the cholesterol content in the plant body is extremely low, and is insufficient for the herbivorous insects to meet the cholesterol requirement. Thus, herbivores have evolved specific sterol metabolic pathways that can convert ingested plant sterols into their essential cholesterol to meet their needs for growth and reproduction. However, insects are not transformable so that plant sterols have extremely stringent requirements on their chemical structure, and according to this characteristic, plant sterols can be classified into two categories, insect "available sterols" and "unavailable sterols". Obviously, the cholesterol balance of pests feeding on the target plant can be broken through by reducing the content of available sterols in the target plant through a bioengineering method, and the normal growth, development and reproduction of the pests are affected, so that the transgenic plant has the characteristic of resisting the pests.

Among the grain and economic plants planted at present, the phytosterol mainly comprises sitosterol (sitosterol) 70% -90%; campesterol (Campesterol), 5% -25% and Stigmasterol (Stigmasterol), 0% -5%. All insect feeding experiments to date have shown that sitosterol can be utilized by the insects tested, is an insect-utilizable sterol, and that stigmasterol, as opposed to the former, cannot be effectively utilized by the opposite portion of the insects, and thus can be categorized as an insect-unavailable sterol. By utilizing the characteristic, more new varieties of insect-resistant plants are hopefully developed, but no related report is yet available so far.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide an application of the CYP710A1 gene or its protein in breeding insect-resistant plants.

The invention provides the use of at least one of the following I) to V) for increasing the insect resistance of plants;

i) CYP710A1 protein;

II), a protein having one or more amino acids substituted, deleted or added in the amino acid sequence of the CYP710A1 protein and having the same or similar function as that of the CYP710 A1;

III) a nucleic acid molecule encoding the protein of I) or II);

IV), a nucleic acid molecule which is substituted, deleted or added with one or more nucleotides in the nucleotide sequence of said nucleic acid molecule of III) and which is capable of encoding the same or a similar functional protein;

v) a substance capable of modulating the level or activity of at least one of I) to V).

In the phytosterol synthesis pathway, stigmasterol is derived from sitosterol by removing two hydrogen atoms at C22 and C23, and this reaction is accomplished by catalysis of CYP710 A1. Therefore, by over-expressing CYP710A1 gene, the acceptor plant can generate stigmasterol exceeding the constant quantity, and the content of sitosterol is reduced, so that the purpose of insect resistance is achieved.

In the present invention, the plant is a plant capable of metabolizing to produce stigmasterol. In an embodiment of the present invention, the plant comprises at least one of arabidopsis thaliana, tobacco, cotton, maize, rice, sorghum, wheat, soybean, potato, barley, tomato, kidney bean, peanut, or sugarcane.

In the present invention, the insect resistance is resistance to agricultural pests that increase plant sensitivity to sterol composition. For example, resistance to lepidopteran and/or hemipteran pests is included. In the embodiment of the invention, the lepidopteran pests are cotton bollworms and the hemipteran pests are lygus lucorum. In the present invention, the insect resistance includes reducing the weight of the insect, extending the period of the insect's age, and/or reducing the survival rate of the insect.

In the invention, the amino acid sequence of the CYP710A1 protein is shown in SEQ ID NO. 1;

in some embodiments, the nucleic acid molecule encoding the protein shown in SEQ ID NO. 1 has the sequence shown in SEQ ID NO. 2.

The invention also provides a preparation for improving the resistance of plants to insect pests, comprising at least one of the following i) to v):

i) A CYP710A1 protein or a nucleic acid molecule encoding a CYP710A1 protein;

ii) an expression vector comprising a nucleic acid encoding a CYP710A1 protein;

iii) A recombinant host comprising ii);

iv) a promoter or enhancer that enhances the expression of the CYP710A1 gene;

v) an inducer that promotes CYP710A1 gene expression;

vi) an agent that increases the activity of the CYP710A1 protein.

The invention also provides a method for improving insect resistance of plants by increasing the level and/or activity of the CYP710A1 protein endogenous to the plants or by allowing plants not containing CYP710A1 or CYP710A1 inactivated to express the CYP710A1 protein with the formulation of the invention.

In some embodiments, a method of expressing a CYP710A1 protein in a plant that does not contain CYP710A1 or a plant that inactivates CYP710A1 comprises: constructing a vector containing CYP710A1 gene, and transforming into agrobacterium; infecting seeds or explants of a plant with said agrobacterium.

The invention also provides a preparation for screening insect-resistant plants, which comprises the following components:

an agent that detects the level of CYP710A1 gene transcription;

and/or detecting the expression level of the CYP710A1 protein or an active agent.

The preparation provided by the invention is applied to insect-resistant plant breeding.

The invention also provides a method for breeding insect-resistant plants, which uses the preparation of the invention to detect the CYP710A1 gene transcription level of plants or detect the expression level or activity of CYP710A1 protein.

The detection of the present invention includes detection of the expression level or activity level. For example, the CYP710A1 gene transcription level can be detected by means of real-time PCR or by means of qPCR. The detection of CYP710A1 protein expression level adopts a Western blot method. By using the identification method disclosed by the invention, only plant seeds, tender tissues and mature tissues are detected, and whether the plant can convert sitosterol into stigmasterol or not is judged by analyzing the CYP710A1 gene transcription level or the CYP710A1 protein expression level or activity, so that the insect resistance of the plant is judged.

The invention discloses an application of CYP710A1 gene in reducing insect damage to plants. The invention introduces a gene driven by a CaMV 35S promoter into an Arabidopsis acceptor material by an Agrobacterium-mediated genetic transformation method of a sterol C-22 dehydrogenase-1 (AtCYP 710A 1) gene from Arabidopsis, and obtains a plurality of transgenic positive lines through PCR and sterol content identification, wherein sitosterol is almost completely replaced by a product of the AtCYP710A1, stigmasterol and plants grow normally. Indoor insect-resistant experiments show that compared with a control group, the cotton bollworms fed by transgenic plants have remarkably reduced cholesterol content in bodies, the weight of larvae of one age is remarkably reduced, and the generation period is remarkably prolonged. Compared with the control group, the survival rate of 3-and 4-year-old insects is obviously reduced when the transgenic plant is fed with lygus lucorum. Thus, over-expression of the CYP710A1 gene in plants can significantly affect the growth and development of plant pests, thereby reducing damage to the plants by the plant pests.

Drawings

FIG. 1 shows the conversion of sitosterol to stigmasterol;

FIG. 2 shows the overexpression of AtCYP710A1 in plants, transgenic plants (L2, L4), empty vector control plants (C2, C4) after Agrobacterium-mediated transformation of the AtCYP710A1 gene;

FIG. 3 shows that the sitosterol ratio in transgenic plants L2 and L4 was significantly reduced, while the stigmasterol ratio was significantly increased, transgenic plants (L2, L4), empty vector control plants (C2, C4);

FIG. 4 shows the growth of transgenic plants and control plants; transgenic plants (L2, L4), empty vector control plants (C2, C4);

FIG. 5 shows the effect of over-expressing CYP710A transgenic plants on cotton bollworm growth (a) and hatching (b), transgenic plants (L2, L4), empty vector control plants (C2, C4);

FIG. 6 shows the effect of transgenic Arabidopsis plants on the growth and development of bollworm larvae, transgenic plants (L2), empty vector control plants (C2), average body weight of a.age; b. total sterols in insects;

figure 7 shows the effect of transgenic arabidopsis plants on survival of lygus lucorum larvae, transgenic plants (L2, L4), empty vector control plants (C2, C4).

Detailed Description

The invention provides application of CYP710A1 gene or protein thereof, and one skilled in the art can properly improve the process parameters by referring to the content of the invention. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that the invention can be practiced and practiced with modification and alteration and combination of the methods and applications herein without departing from the spirit and scope of the invention.

The CYP710A1 protein is a CYP710A1 protein from plants, and can be from monocots or dicots. For example, it may be from arabidopsis, tobacco, cotton, maize, rice, sorghum, wheat, soybean, potato, barley, tomato, kidney bean, peanut, or sugarcane, etc. In the embodiment of the invention, the influence of the arabidopsis thaliana-derived AtCYP710A1 gene on the insect resistance of plants is taken as an example.

The AtCYP710A1 gene is cloned from Arabidopsis, codes sterol C-22 dehydrogenase, and can catalyze sitosterol in Arabidopsis to be converted into stigmasterol (figure 1). The invention introduces the AtCYP710A1 gene driven by the CaMV 35S promoter into an Arabidopsis acceptor material by an agrobacterium-mediated genetic transformation method, obtains a plurality of transgenic positive strains through PCR and GC/MS identification, and carries out further analysis on two selected stigmasterol transgenic strains L2 and L4; GC-MS analysis results show that the plant sterol composition of the transgenic plants is significantly changed. Indoor insect-resistant experiments show that the transgenic plants have remarkable inhibition effect on cotton bollworms and lygus lucorum. Thus, over-expression of the CYP710A1 gene in plants can increase the resistance of transgenic plants to pests.

The nucleic acid molecule for encoding the CYP710A1 protein comprises genome DNA, cDNA, recombinant DNA or mRNA for encoding the CYP710A1 protein and hnRNA; or a nucleic acid molecule which is complementary in reverse to the above DNA, cDNA, recombinant DNA or mRNA.

The nucleic acid molecules can be modified or optimized according to actual needs, so that the gene expression is more efficient; for example, (1) the codon may be changed to conform to the preference of the recipient plant while maintaining the amino acid sequence of the CYP710A1 gene of the invention, according to the codon preferred by the recipient plant. (2) Or modifying the gene sequence adjacent to the initiation methionine to allow efficient initiation of translation; for example, modifications are made using sequences known to be effective in plants. (3) Ligating to promoters expressed by various plants to facilitate expression thereof in plants; the promoter may include constitutive, inducible, chronologically regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space of expression requirements and will also depend on the target species; (4) enhancer sequences such as intron sequences (e.g., derived from Adhl and bronzel) and viral leader sequences (e.g., derived from TMV, MCMV and AMV) are introduced.

The invention further discloses a recombinant plant expression vector containing the AtCYP710A1 gene and a recombinant host cell containing the recombinant plant expression vector. In the present invention, the vector may be a plasmid, cosmid, phage or viral vector. The host may be a fungus, bacterium, algae or cell. The bacteria are preferably agrobacteria. Operably linking the CYP710A1 gene with an expression control element to obtain a recombinant plant expression vector; the recombinant plant expression vector can consist of a 5 'end non-coding region, a CYP710A1 gene and a 3' non-coding region; wherein, the 5' non-coding region can comprise a promoter sequence, an enhancer sequence or/and a translation enhancing sequence; the promoter may be a constitutive promoter, an inducible promoter, a tissue or organ specific promoter; the 3' non-coding region may comprise a terminator sequence, an mRNA cleavage sequence, and the like.

For plants not containing CYP710A1 protein, the gene segment encoding CYP710A1 can be introduced into plant cells by chemical methods, bird gun methods, microinjection, electroporation and the like, or the gene segment encoding CYP710A1 can be introduced into plant cells by homologous recombination, zinc finger nucleases, TALENs, CRISPR and the like.

Transformation protocols and protocols for introducing the gene (or polynucleotide) into plants can vary depending on the type of plant (monocot or dicot) or plant cell used for transformation. Suitable methods for introducing the gene polypeptides (or nucleotides) into plant cells include: microinjection, electroporation, agrobacterium-mediated transformation, direct gene transfer, high-velocity ballistic bombardment, and the like. In particular embodiments, the gene (or polynucleotide) may be provided to a plant using a variety of transient transformation methods. The transformed cells can be regenerated into stably transformed plants by conventional methods

According to the invention, through an agrobacterium-mediated genetic transformation method, an AtCYP710A1 gene driven by a CaMV 35S promoter is introduced into a upland cotton receptor material Arabidopsis, and a plurality of transgenic positive strains are obtained through GC/MS analysis, and further research is carried out on two selected stigmasterol transgenic strains L2 and L2, so that the following results are obtained: the GC-MS result shows that the sterol component in the transgenic line is changed obviously, the sitosterol proportion in L2 and L4 is reduced obviously, and the stigmasterol proportion is increased obviously. The transgenic lines have no significant difference in growth traits from the control plants.

After the cotton bollworms eat the transgenic arabidopsis leaves, the cholesterol content in the bodies of the cotton bollworms is obviously reduced, meanwhile, the growth and development processes of the insects are obviously delayed, and the survival rate, pupation weight and eclosion rate of the larvae are obviously reduced. Apolygus lucorum fed on transgenic Arabidopsis leaves grows slowly and has higher mortality. .

According to the test results of the invention, the sterol composition of the transgenic plant is changed, the cholesterol content of the insect can be obviously reduced by increasing the content of unavailable sterols of the insect, the growth and development processes of the insect are influenced, and the plant has obvious effects on the insect of two different families. Among the pests identified by the resistance of the invention, cotton bollworms belong to the genus lepidoptera, although cotton bollworms are sensitive to Bt toxins, they are also sensitive to changes in phytosterols; lygus lucorum belongs to the family of lygus lucorum, is insensitive to Bt toxins and is today the main pest in transgenic cotton fields. The transgenic cotton in the test shows better resistance to the pests of two different families, and according to the dependence of the insect on the plant sterol and the conservation of the insect on the synthesis of steroid hormone, the pest-resistant strategy for changing the sterol composition can be reasonably presumed to be effective to other pests. Therefore, this broad-spectrum insect-resistant strategy, which is environmentally friendly without adverse effects on the recipient plant, is considered to be effective for use in many plants in the future.

The test materials adopted by the invention are all common commercial products and can be purchased in the market. The invention is further illustrated by the following examples:

EXAMPLE 1 CYP710A1 Gene transgenic Arabidopsis thaliana improved plant resistance to insects

1. Test material

1. Test insects

All insects tested were supplied by the university of Hainan animal sciences.

2. Vectors and strains

The vector was pGreenII0029-62SK and Agrobacterium LBA4404 was from university of Hainan.

3. Primer(s)

SEQ ID NO.3:ATGGTTTTCTCTGTTTCTATA

SEQ ID NO.4:TTAGGAAAAGTTGGGATACTTTG

4. Preparation of common culture medium

Plant culture medium: MS culture medium+8g/L plant gel;

bacterial culture medium: LB (LB)

2. Experimental method

1. Genetic transformation of Arabidopsis thaliana

(1) Arabidopsis plants: 1ml of 75% alcohol+0.1% Tween-20 (w/v) was added to a centrifuge tube containing Arabidopsis seeds, sterilized by shaking up and down for 5min, and then 1ml of 100% alcohol was added thereto for 30 seconds, and the excess alcohol was removed and repeated three times. The centrifuge tube was opened and placed in a sterile hood until all the alcohol had evaporated and seeds were spread evenly on MS solid medium. After the MS culture medium with treated seeds is placed at 4 ℃ for vernalization for 3 days, the seeds are cultured in a tissue culture chamber. The conditions are as follows: light is irradiated for 12 hours at 22 ℃ and darkness is achieved for 12 hours; four leaves are arranged on the arabidopsis, the arabidopsis seedlings are transplanted into a nutrition pot (nutrition soil: vermiculite: pearl salt=6:3:1), a preservative film is covered, water is poured through, and after dark culture is carried out for 1-2 days, the preservative film is removed for normal illumination culture. When the arabidopsis grows to a bolting state, stem tissues are cut off, and the whole disc of arabidopsis grows for a period of time, so that the whole disc of arabidopsis is bolting completely, flower buds remained after seed setting are cut off, and an agrobacterium infection experiment is carried out.

(2) And (3) preparation of agrobacterium. The coding region of AtCYP710A1 was inserted into pGreenII0029-62SK plasmid and transferred into Agrobacterium. Streaking positive agrobacterium in LB (rif+Gent+Kan) solid medium, at 28deg.C in darkness for 2-3 days; the single colony of the plate is picked, inoculated in 4ml of liquid LB (Rif+Gent+Kan) culture medium, and shaken at 220rpm/min for overnight under the condition of dark culture at 28 ℃. 1ml of overnight bacteria is taken and inoculated into 100ml of liquid (Rif+Gent+Kan) LB culture solution with three antibiotics, and the culture is carried out at 220rpm/min under the condition of 28 ℃ dark culture for overnight; the OD value of the bacteria (OD 600 is between 1.2 and 2.0) is detected by an ultraviolet spectrophotometer, the bacteria are poured into a sterilized 250ml sterilized centrifugal bottle, the bacteria are collected after centrifugation for 8min at the temperature of 28 ℃ at 5000rpm, and the supernatant culture solution is discarded. The collected Agrobacterium cells were suspended in the transformation permeate (100 ml:1/2MS+5% sucrose+20. Mu.l silwet).

(3) Plant transformation. Placing the bud part of Arabidopsis thaliana in the permeate containing agrobacterium for 0.5min, taking out, watering, keeping moisture, culturing under dark 1 condition for 24h, and culturing normally. T1 seeds were collected after plant maturation.

2. Positive plant identification

After T1 seed sterilization, it was spread on SM plates containing kan antibiotics. And (5) picking 20 surviving plants and continuously culturing in a nutrition pot until the plants are mature. Seeds of each plant were individually stored to obtain T1 seeds. After T1 seeds were sterilized, they were spread on SM plates (200 grains per strain) containing kan antibiotics, respectively. And (3) the T1 seeds are all survived on the flat plate, namely the positive pure plants and the plants. And (5) selecting pure-hybrid plants to culture in soil, and obtaining pure-hybrid seeds after the pure-hybrid plants are ripe. T1 seeds on the flat plate have no survival, namely the control plants

GC-MS determination of sterol content

From the greenhouse, approximately 20mg to 2mLEP of Arabidopsis thaliana leaves (or insect biological specimen tissue) of consistent growth were removed, and 0.5mL of 10% KOH/methanol solution was added. The sample was heated at 80 degrees celsius for 30 minutes and cooled to room temperature. 0.5ml of n-hexane was added, shaken for 30 seconds, centrifuged at 5000r/min for 3min, and 0.4 ml of supernatant was transferred to a new 1.5 ml EP tube. After the nitrogen blower was blown dry, 10. Mu.l of BSTFA-TMCS and 10. Mu.l of anhydrous pyridine were added, and after 30 minutes at room temperature, GC/MS analysis was performed.

4. Investigation of plant growth traits

Comparison of plant growth and development was performed at 28.+ -. 2 ℃ for control plants (C2, C4) and T2 transgenic lines (L2 and L4) both grown in the greenhouse, 16/8 day/light.

5. Insect feeding experiment

5.1. Experiment of resistance to Helicoverpa armigera

The tender leaves of the plants were placed on a petri dish with wet filter paper laid thereon, and each plant was repeated 3 times, 40 heads of the initially hatched larvae were inoculated each time, and cultured in an incubator (16/8 h light/dark, 25.+ -. 2 ℃ C., 60% relative humidity). Fresh leaves are replaced every day, and pupation rate, emergence rate and generation period are recorded. In another parallel experiment, one-instar larvae (20 heads) were weighed and subjected to sterol analysis.

5.2. Lygus lucorum feeding experiment

The tender leaves of the plants were placed in glass bottles with moistened filter paper, each plant was repeated 3 times, 40 heads of the larvae were inoculated at each time, and the plants were placed in an incubator for cultivation (16/8 h light/dark, 25.+ -. 2 ℃ C., 60% relative humidity). Fresh leaves were replaced daily and insect growth was recorded.

3. Test results

1. Agrobacterium-mediated genetic transformation

The cDNA sequence of the AtCYP710A1 gene (SEQ ID NO: 2) is transferred into Agrobacterium under the drive of the CaMV 35S promoter, and the Agrobacterium infects the transgenic Arabidopsis plants of the Arabidopsis inflorescence.

2. Gene expression analysis

PCR analysis confirmed the overexpression of AtCYP710A1 (FIG. 2)

3. Analysis of Arabidopsis sterol content

The sterol composition in the transgenic lines was significantly changed compared to control and wild arabidopsis plants. The sitosterol ratio in L2 and L4 was significantly reduced (from 70% to around 5% of total sterols) while the stigmasterol ratio was significantly increased (from 3% to around 80% of total sterols) (fig. 3). At the same time, the transgenic plants had no obvious difference from the control plants in growth and development (FIG. 4)

4. Identification of insect resistance of transgenic plants

(1) Effect of transgenic Arabidopsis plants on the growth and development of Helicoverpa armigera

Feeding experiments demonstrated that the age of cotton bollworms fed with transgenic arabidopsis leaves (L2, L4) was prolonged by 39.3 days (L2) and by 38.2 (L4) days from 31.7 (C2) days, respectively, compared to the corresponding control group plants (C2, C4) (fig. 5 a); the pupation rate is obviously reduced: from 36.1% of C2 to 18.4% of L2, and from 35.6% of C4 to 19.7% of L4 (fig. 5 b). The average body weight of the other age was reduced from 0.82mg per head (C2) to 0.48mg per head (L2) (FIG. 6 a). In response thereto, the total sterols, as well as cholesterol levels, in the insects fed the transgenic plants were also significantly reduced (fig. 6 b). Experiments show that the transgenic plant has obvious inhibition effect on the growth of cotton bollworms.

(2) Effect of transgenic Arabidopsis plants on Apolygus lucorum growth and development

Feeding experiments show that the survival rate of lygus lucorum larvae fed with transgenic arabidopsis leaves (L2, L4) is very different from that of corresponding control plants (C2, C4), and the survival rate of 3-instar insects is respectively reduced from 93.9 percent (C2) to 12.7 percent (L2) and from 96.1 percent (C4) to 1.01 percent (L4); survival of 4-instar insects was also significantly reduced by 87.1% (C2) to 11.1% (L2) and from 95.1% (C4) to 1.0% (L4) (fig. 7). The result shows that CYP710A1 transgenic plant can effectively control the damage of lygus lucorum, can be used together with the existing Bt transgenic technology, and can better reduce the damage of insect pests.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> university of Hainan

<120> application of CYP710A1 gene or protein thereof

<130> MP21027479

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 495

<212> PRT

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

Met Val Phe Ser Val Ser Ile Phe Ala Ser Leu Ala Pro Tyr Leu Ile

1 5 10 15

Ser Ala Phe Leu Leu Phe Leu Leu Val Glu Gln Leu Ser Tyr Leu Phe

20 25 30

Lys Lys Arg Asn Ile Pro Gly Pro Phe Phe Val Pro Pro Ile Ile Gly

35 40 45

Asn Ala Val Ala Leu Val Arg Asp Pro Thr Ser Phe Trp Asp Lys Gln

50 55 60

Ser Ser Thr Ala Asn Ile Ser Gly Leu Ser Ala Asn Tyr Leu Ile Gly

65 70 75 80

Lys Phe Ile Val Tyr Ile Arg Asp Thr Glu Leu Ser His Gln Ile Phe

85 90 95

Ser Asn Val Arg Pro Asp Ala Phe His Leu Ile Gly His Pro Phe Gly

100 105 110

Lys Lys Leu Phe Gly Asp His Asn Leu Ile Tyr Met Phe Gly Glu Asp

115 120 125

His Lys Ser Val Arg Arg Gln Leu Ala Pro Asn Phe Thr Pro Lys Ala

130 135 140

Leu Ser Thr Tyr Ser Ala Leu Gln Gln Leu Val Ile Leu Arg His Leu

145 150 155 160

Arg Gln Trp Glu Gly Ser Thr Ser Gly Gly Ser Arg Pro Val Ser Leu

165 170 175

Arg Gln Leu Val Arg Glu Leu Asn Leu Glu Thr Ser Gln Thr Val Phe

180 185 190

Val Gly Pro Tyr Leu Asp Lys Glu Ala Lys Asn Arg Phe Arg Thr Asp

195 200 205

Tyr Asn Leu Phe Asn Leu Gly Ser Met Ala Leu Pro Ile Asp Leu Pro

210 215 220

Gly Phe Ala Phe Gly Glu Ala Arg Arg Ala Val Lys Arg Leu Gly Glu

225 230 235 240

Thr Leu Gly Ile Cys Ala Gly Lys Ser Lys Ala Arg Met Ala Ala Gly

245 250 255

Glu Glu Pro Ala Cys Leu Ile Asp Phe Trp Met Gln Ala Ile Val Ala

260 265 270

Glu Asn Pro Gln Pro Pro His Ser Gly Asp Glu Glu Ile Gly Gly Leu

275 280 285

Leu Phe Asp Phe Leu Phe Ala Ala Gln Asp Ala Ser Thr Ser Ser Leu

290 295 300

Leu Trp Ala Val Thr Leu Leu Asp Ser Glu Pro Glu Val Leu Asn Arg

305 310 315 320

Val Arg Glu Glu Val Ala Lys Ile Trp Ser Pro Glu Ser Asn Ala Leu

325 330 335

Ile Thr Val Asp Gln Leu Ala Glu Met Lys Tyr Thr Arg Ser Val Ala

340 345 350

Arg Glu Val Ile Arg Tyr Arg Pro Pro Ala Thr Met Val Pro His Val

355 360 365

Ala Ala Ile Asp Phe Pro Leu Thr Glu Thr Tyr Thr Ile Pro Lys Gly

370 375 380

Thr Ile Val Phe Pro Ser Val Phe Asp Ser Ser Phe Gln Gly Phe Thr

385 390 395 400

Glu Pro Asp Arg Phe Asp Pro Asp Arg Phe Ser Glu Thr Arg Gln Glu

405 410 415

Asp Gln Val Phe Lys Arg Asn Phe Leu Ala Phe Gly Trp Gly Pro His

420 425 430

Gln Cys Val Gly Gln Arg Tyr Ala Leu Asn His Leu Val Leu Phe Ile

435 440 445

Ala Met Phe Ser Ser Leu Leu Asp Phe Lys Arg Leu Arg Ser Asp Gly

450 455 460

Cys Asp Glu Ile Val Tyr Cys Pro Thr Ile Ser Pro Lys Asp Gly Cys

465 470 475 480

Thr Val Phe Leu Ser Arg Arg Val Ala Lys Tyr Pro Asn Phe Ser

485 490 495

<210> 2

<211> 1488

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 2

atggttttct ctgtttctat atttgcctct cttgcaccat acttaatctc agcatttctt 60

cttttccttc tcgtcgagca actctcttac cttttcaaga aacgaaacat ccctggccct 120

ttcttcgtcc ctccaatcat cggaaacgcc gttgcactcg ttcgtgaccc cacttccttc 180

tgggacaagc aatcctccac ggcgaacatc tcaggcctct ccgccaacta cctcatcgga 240

aaattcatcg tctatatcag agacactgag ctttcccatc aaatcttctc aaacgttcgt 300

cccgatgcct tccaccttat cggacatccc tttggtaaga agctcttcgg tgaccacaac 360

cttatataca tgttcggcga ggatcacaaa tccgttcgcc gtcagctagc acctaacttc 420

actcccaagg cactgtccac ttactctgcc ctccagcaat tagttattct ccgtcatcta 480

cggcagtggg aggggagtac ctccggcgga tctcgtccag tgtcactgcg acagcttgtc 540

cgtgaactca acctagaaac ttcgcagacg gtttttgttg gaccctacct tgacaaggaa 600

gccaagaaca ggttccgtac tgattataat ttgttcaatc tcggatccat ggctctcccc 660

atagacctcc ctggctttgc gttcggcgag gctcgcaggg ctgtaaagag gctaggggag 720

acgctcggca tttgcgcggg aaaatccaaa gcgaggatgg cagcaggaga agaaccagca 780

tgcctaatcg atttctggat gcaggcgatc gtcgcggaga atccgcagcc accgcactcg 840

ggagacgaag agatcggtgg tttgctcttc gattttctct ttgccgctca agacgcgtcc 900

acgtcatcac tcctctgggc cgtgacgctt cttgattcag agccagaggt gctgaacaga 960

gtaagagaag aagtagccaa gatctggtca cctgagtcca acgccttgat caccgttgat 1020

cagctcgcag agatgaagta tacacgctcc gtggcgcgtg aggtcattag atacaggcct 1080

cctgcaacta tggtcccaca cgtcgctgct atagacttcc ctctcacgga aacgtacact 1140

atcccaaaag gtacaattgt ctttccttcg gttttcgact cctcgttcca agggtttact 1200

gaaccggacc ggtttgatcc tgaccggttt agcgagacaa gacaagagga ccaggtgttc 1260

aaacgcaact tcctagcttt tggatggggg cctcaccaat gcgtaggcca gcgttacgcg 1320

ttgaaccacc tcgtactctt cattgcaatg ttctcgtcgt tgttggattt caagaggctt 1380

cgatcagacg gttgtgatga gatcgtgtac tgccctacta tatcgcccaa ggatgggtgc 1440

accgtgttct tgtctaggcg cgtcgcaaag tatcccaact tttcctaa 1488

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atggttttct ctgtttctat a 21

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ttaggaaaag ttgggatact ttg 23

Claims (5)

1. Use of the cyp710a1 protein for increasing plant insect resistance;

   the insect resistance is against lygus lucorum;

   the amino acid sequence of the CYP710A1 protein is shown in SEQ ID NO. 1.
2. 2. The use according to claim 1, wherein the plant is a plant capable of metabolically producing stigmasterol.
3. 3. The use according to claim 1 or 2, wherein the plant comprises at least one of arabidopsis thaliana, tobacco, cotton, maize, rice, sorghum, wheat, soybean, potato, barley, tomato, kidney bean, peanut, or sugarcane.
4. 4. The use according to claim 1 or 2, characterized in that,

   the sequence of the nucleic acid molecule encoding the protein shown in SEQ ID NO. 1 is shown in SEQ ID NO. 2.
5. 5. A method for increasing insect resistance in a plant, wherein the level and/or activity of a CYP710A1 protein endogenous to the plant is increased in a formulation or the CYP710A1 protein is expressed by a plant that does not contain CYP710A1 or CYP710A1 inactivation;

   the formulation comprises a CYP710A1 protein or a nucleic acid molecule encoding a CYP710A1 protein;

   the amino acid sequence of the CYP710A1 protein is shown in SEQ ID NO. 1;

   the insect resistance is against lygus lucorum.

Images