CN114058562B - Recombinant Serratia expressing dsRNA and application thereof - Google Patents
Recombinant Serratia expressing dsRNA and application thereof Download PDFInfo
- Publication number
- CN114058562B CN114058562B CN202111375847.4A CN202111375847A CN114058562B CN 114058562 B CN114058562 B CN 114058562B CN 202111375847 A CN202111375847 A CN 202111375847A CN 114058562 B CN114058562 B CN 114058562B
- Authority
- CN
- China
- Prior art keywords
- serratia
- dsrna
- recombinant
- gene
- alr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y501/00—Racemaces and epimerases (5.1)
- C12Y501/01—Racemaces and epimerases (5.1) acting on amino acids and derivatives (5.1.1)
- C12Y501/01001—Alanine racemase (5.1.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y504/00—Intramolecular transferases (5.4)
- C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
- C12Y504/99005—Chorismate mutase (5.4.99.5)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
The invention discloses recombinant Serratia expressing dsRNA and application thereof. The recombinant Serratia is obtained by transferring a dsRNA coding gene sequence into the Serratia nematophila in an exogenous way, wherein the dsRNA can carry out gene silencing on the root knot nematode chorismate mutase. The invention uses indigenous bacteria as a carrier, and overcomes the disadvantage that exogenous microorganisms are difficult to colonize in intestinal tracts. The dsRNA interference object is a conserved gene, has extremely high targeting property and universality across nematodes of different species, and is not easy to generate drug resistance. Therefore, the recombinant Serratia for producing the dsRNA is used for successfully preventing and treating plant root knot nematode disease, and has important guiding significance and application value for developing novel biopesticide.
Description
Technical Field
The invention relates to the technical field of microorganisms and genetic engineering, in particular to recombinant Serratia expressing dsRNA and application thereof.
Background
Plant root knot nematodes (Meloidogyne) cause plant nematode disease, which aggravate the hazard of agricultural production in successive years, resulting in massive plant yield loss. The traditional prevention and control of root-knot nematodes, mainly crop rotation and chemical pesticides, of plants worldwide is difficult to meet the requirements of modern agricultural production.
Conventional resistance breeding and nematode-resistant transgenic breeding mainly expressing exogenous proteins are mainly limited by the lack of resistance genes and the increasing drug resistance of diseases and insects. The realization of the resistance of transgenic plants depends on the interaction between proteins, and the foreign proteins trigger a complex disease resistance signal transduction process through the identification and interaction with nematode pathogens, and as the pathogens have frequent genetic variation under unfavorable parasitic conditions, the identification and interaction of the foreign proteins can be lost due to the tiny structural variation of pathogen target proteins, and finally the resistance is lost.
Microecological preparations represented by bacillus thuringiensis also face the problem of disease and insect resistance. Bt toxins are naturally produced by bacillus thuringiensis and are widely used to control pests. The toxins must bind to the cadherin receptor in the pest gut to be effective, and mutations in the cadherin receptor create resistance to Bt toxins. Development and breakthrough of novel nematicide are needed in the situation of crop disaster and agricultural yield reduction caused by nematode disease flooding. Recently, the RNA interference technology developed based on the microecological microbial inoculum brings new breakthrough to the nematode resistant genetic engineering.
For example, the invention of publication No. CN1 12409065A discloses a soil finishing agent for overcoming continuous cropping obstacle of potato and an application method thereof, wherein the soil finishing agent relates to a microbial agent, and the microbial agent consists of 20% of bacillus subtilis, 20% of bacillus thuringiensis, 10% of actinomycetes, 10% of bacillus licheniformis, 10% of sulfureted bacteria, 15% of nitrifying bacteria and 15% of saccharomycetes in percentage by mass.
Disclosure of Invention
The invention constructs RNA interference carrier, expresses dsRNA of important gene of root-knot nematode in microbial agent bacteria, and the bacteria are led into nematode body through oral needle feeding of the nematode, and dsRNA product induces systemic RNA interference reaction of the nematode, so that parasitic, development, metabolism, movement and other barriers and even death occur, thereby realizing the killing effect on the parasitic nematode.
A recombinant serratia obtained by exogenously transferring a coding gene sequence of a dsRNA into a serratia nematophila, wherein said dsRNA is capable of gene silencing a root knot nematode chorismate mutase.
Preferably, the Serratia nematophila used also knocks out both the RNC and alr genes.
More preferably, the RNC gene sequence is shown as SEQ ID NO. 4; the alr gene sequence is shown in SEQ ID NO. 6.
The recombinant Serratia comprises the following construction steps:
(1) Constructing an antibiotic-free screening marker Serratia expression vector, taking a pBBRmcs2 vector as a starting vector, respectively inserting a coding gene for expressing the dsRNA and fragments for expressing alanine racemase genes alr and T7RNA polymerase genes from escherichia coli atcc25922, and constructing a recombinant plasmid pBBR-alr-T7RP-CM;
(2) Knocking out two genes of RNC and alr in Serratia nematophila, and then transferring into recombinant plasmid pBBR-alr-T7RP-CM to obtain the recombinant Serratia nematophila.
Preferably, in the step (1), a fragment fused by the bidirectional T7 promoter and the coding gene of the dsRNA is connected to a pBBRmcs2 vector, and the nucleotide sequence of the fragment fused by the bidirectional T7 promoter and the coding gene of the dsRNA is shown as SEQ ID NO.2.
Preferably, in step (1), the tac promoter is fused with fragments of alanine racemase gene alr and T7RNA polymerase gene from Escherichia coli atcc25922, wherein rbs sequences are added in front of the two genes respectively, terminator sequences are added in back of the latter genes, and the sequence of the whole insert is shown as SEQ ID NO.3.
The invention also discloses application of the recombinant Serratia to preparation of a microecological microbial agent for preventing and controlling root-knot nematodes.
The invention also discloses a microecological microbial agent for preventing and controlling root-knot nematodes, which comprises the recombinant Serratia.
The invention also discloses a plant cultivation method for preventing and controlling the root-knot nematode, the microecological microbial inoculum is applied to soil planted with plants, and the soil is infected by the root-knot nematode.
The invention at least comprises the following beneficial effects:
the recombinant Serratia disclosed by the invention is obtained by connecting a target chorismate mutase dsRNA coding gene with an expression vector, constructing a recombinant expression plasmid, and then introducing the recombinant expression plasmid into a host cell of a nematophila defective strain. Serratia nematophila is a gram-negative bacterium, is widely found in the intestinal tracts of insects in nature, especially nematodes, and is considered to be an intestinal endophyte with very strong colonization ability, which is highly suitable for the intestinal environment. Serratia nematophila has been reported to have a firm symbiotic relationship with nematodes, and the presence of Serratia nematophila has a certain promotion effect on the growth of nematodes. Serratia nematophila is selected as target nematode chorismate mutase dsRNA expression host bacteria, and has the advantages of easy field planting of thalli in intestinal tracts of nematodes, and rapid and stable exertion of RNA interference function.
The RNaseIII enzyme (RNC) of the Serratia nematophila has strong activity and is very unfavorable for the stable existence of dsRNA, and the mutant Serratia strain which is constructed by the invention and knocks out RNC genes is favorable for the stable existence of product dsRNA.
The auxotroph serratia nematophila which is constructed by the invention and knocks out alanine racemase can only be grown normally by adding 100 mug/ml alanine into a culture medium or transferring into a recombinant expression plasmid pBBR-alr-T7RP-CM which simultaneously expresses alr racemase and targeted chorismate mutase dsRNA. The serratia auxotroph expression system constructed by the invention can ensure that the dsRNA plasmid in the recombinant strain is kept stable under the premise of not adding antibiotics, and is convenient for the recombinant strain to use in the environment.
The recombinant Serratia for producing the dsRNA constructed by the invention is applied as a microecological microbial inoculum, and can obviously inhibit root knot phenomenon of tomato seedlings caused by nematodes in a tomato potting experiment.
The recombinant Serratia prepared by the invention creatively utilizes the indigenous endophyte of the nematode intestinal tract of the Serratia nematophila to make the recombinant Serratia colonize the intestinal tract of the root knot nematode, stably express dsRNA, effectively interfere the growth and development of the nematode and cause death of the adult, thereby obviously reducing the formation of hardening phenomenon caused by the nematode of the tomato root system. The invention uses indigenous bacteria as a carrier, and overcomes the disadvantage that exogenous microorganisms are difficult to colonize in intestinal tracts. The dsRNA interference object is a conserved gene, has extremely high targeting property and universality across nematodes of different species, and is not easy to generate drug resistance. Therefore, the recombinant Serratia for producing the dsRNA is used for successfully preventing and treating plant root knot nematode disease, and has important guiding significance and application value for developing novel biopesticide.
Drawings
FIG. 1 is a map of the plasmid pBBR-CM of the present invention.
FIG. 2 is a map of the dsRNA expression plasmid pBBR-alr-T7RP-CM of the present invention.
FIG. 3 is a map of plasmid pK18mobSacB-RNC constructed according to the present invention.
FIG. 4 is a diagram of PCR identification results of recombinant Serratia nematophila colony construction.
FIG. 5 is an agarose gel electrophoresis of dsRNA extracted according to the present invention.
FIG. 6 is an inhibition of tomato root knot phenomenon by the addition of recombinant Serratia nematophila producing dsRNA; wherein, the A group is a control plant group; group B is a plant group of recombinant Serratia nematophila added with dsRNA.
Detailed Description
Example 1
Constructing a dsRNA recombinant expression plasmid.
The gene sequence is shown in SEQ ID NO.1 according to the synthetic coding gene (GenBank: AF 095949) of the root-knot nematode chorismate mutase (chorismate mutase, CM) published on NCBI.
According to the sequence of the chorismate mutase gene, the coding gene sequence of the dsRNA is designed through codon optimization, and T7 promoters are respectively added at the upper and lower stream of the coding gene sequence, and the coding gene sequence is oppositely started, and the specific sequence is shown as SEQ ID NO.2.
The designed sequence is synthesized into a double-chain fragment in a total gene synthesis mode, and the double-chain fragment is seamlessly cloned and connected into an expression plasmid pBBRmcs2 with KpnI and HindIII double-enzyme tangentially, so as to construct a recombinant plasmid, double-enzyme digestion verification and sequencing are carried out, and the recombinant plasmid is confirmed to be successfully constructed and named pBBR-CM (shown in figure 1).
Construction of plasmid pBBR-alr-T7 RP-CM. the tac promoter fuses the gene fragments of alanine racemase (alanine racemase gene alr from escherichia coli atcc 25922) and T7RNA polymerase, wherein rbs sequences are respectively added in front of the two genes, terminator sequences are added behind one gene, and the specific sequence is shown as SEQ ID NO.3. The seamless cloning is connected with KpnI single enzyme digestion linearization expression plasmid pBBR-CM to construct recombinant plasmid, double enzyme digestion verification and sequencing to confirm that the recombinant plasmid is constructed successfully, named pBBR-alr-T7RP-CM (shown in figure 2).
Example 2
Construction of a Serratia nematophila gene knockout mutant strain.
(1) According to NCBI database information, the sequence of the nuclease RNaseIII gene (RNC gene) of Serratia nematophila is shown as SEQ ID NO.4.
The fusion of the upstream and downstream gene sequences of RNC genes is designed into 1 knockout fragment, and the fragment is synthesized by total genes, and the specific sequence is shown as SEQ ID NO.5.
(2) The knockdown fragment was inserted into EcoRI and HindIII multiple cloning sites of the pK18mobSacB vector by double cleavage, and the recombinant plasmid was constructed successfully and named pK18mobSacB-RNC (as shown in FIG. 3).
(3) The pK18mobSacB-RNC transformed E.coli S17-1 strain (from Korean culture Collection http:// KCTC. Kribb. Re. Kr /) was co-cultured with Serratia nematophila (strain No. KCTC22310 from Korean culture collection) on LB plates at 30℃for 48 hours, combined transfer occurred during co-culture, S17-1 E.coli had pili, plasmid was transferred into Serratia by pili, and the conjugation product was then suspended and diluted to 1/10 with 1 LB liquid medium 5 Then spread on LB plate with Km, gm and Cm resistance, and cultured for 72-96h at 30 ℃ to obtain Serratia single colony.
(4) And selecting single colony culture to extract total DNA of bacteria. PCR detection was performed with P1/P2 primers to obtain a primary recombinant strain (integration of the whole plasmid into the genome of Serratia nematophila).
The sequence of the identified primer is as follows:
P1：AGCCGGGCAAACCGTTGGCGG；
P2：CGTTCATCCCTTTCTCG。
(5) Culturing the primary recombinant strain in TY liquid culture medium added with Cm at 30 ℃ for 72 hours, diluting and distributing the culture on LB solid culture medium added with Cm, transferring the single colonies grown on LB solid culture medium containing 10% of sucrose, cm, km and Gm respectively, screening the secondary recombinant colonies, picking up single colonies insensitive to sucrose and sensitive to Km and Gm, culturing and extracting total DNA, and carrying out PCR verification on the candidate strain through P1/P2 primer, thereby obtaining the Serratia nematophila mutant strain with RNC gene knocked out.
(6) Serratia nematophila alr (alanine racemase gene) with specific sequence shown in SEQ ID NO. 6.
Based on the mutant strain, the alr gene knockout fragment is synthesized through total genes, the specific sequence is shown as SEQ ID NO.7, and the steps (1) - (5) are repeated, so that the double mutant strain of the Serratia nematophila with the alr gene and the RNC gene knockout can be obtained.
The sequence of the identified primer is as follows:
P3：CCGACCGAAGTGCGCTCGCGC；
P4：TACCGACGGCAAAATTCCGCTG。
example 3
Constructing recombinant Serratia nematophila.
Transferring the constructed recombinant expression plasmid pBBR-alr-T7RP-CM into a Serratia nematophila double mutant strain, adopting Palr-F and PCM-R primers to select out transformants for colony PCR, and generating 4200bp bands (figure 4), and verifying that the recombinant Serratia nematophila is successfully constructed. The primer sequences were as follows:
Palr-F：ATGCAAGCGGCAACTGTTGTG；
PCM-R：TAGATAAGTCTGTAAATAATTTT。
example 4
Production of dsRNA recombinant Serratia nematophila.
The method comprises the following steps:
1) The recombinant Serratia nematophila successfully constructed in example 3 was inoculated into a seed medium and cultured at 37℃and 220rpm for 10 hours for use. The seed culture medium comprises the following components in mass concentration: 10g/L of tryptone, 5g/L of yeast powder and 10g/L of NaCl.
2) Inoculating the cultured seed solution of the recombinant Serratia nematophila into a liquid culture medium according to 5% of the volume, fermenting for 48 hours at 37 ℃ and 220rpm, and carrying out solid-liquid separation to obtain a fermentation liquid supernatant. The fermentation medium comprises the following components in mass concentration: sucrose 50g/L, peptone 10g/L, lactose 5g/L, ammonium sulfate 6g/L, yeast powder 20g/L, K 2 HPO 4 ·3H 2 O12.5g/L、KH 2 PO 4 2.5g/L and MgSO 4 ·7H 2 O1.5g/L。
Example 5
determination of dsRNA yield.
5ml of the bacterial fermentation broth obtained in example 4 above was centrifuged at 10000rpm at 4℃for 10min; discarding the supernatant, suspending the thalli with 1ml TE buffer solution, and crushing for 5min with 400w power of an ultrasonic cell crusher; centrifugation was performed at 10000rpm at 4℃for 10min, and the supernatant was checked for purity and yield by agarose gel electrophoresis. The dsRNA with the size of the target fragment is obviously expressed, so that the intracellular expression of the dsRNA in the recombinant Serratia nematophila is realized (figure 5).
Example 6
Use of dsRNA recombinant serratia nematophila.
1) Experiment for inhibiting root-knot nematode of potted tomato
The plant material used in this study was tomato variety. Proper amount of seeds are wrapped in gauze, and heat shock is carried out three times in 80 ℃ hot water for 30 seconds each time. The seeds were soaked in 40 ℃ warm water for 6 hours. Spreading sterilized filter paper in a sterilized culture dish with diameter of 9cm, spreading the soaked seeds on the filter paper, dripping a proper amount of sterile water to keep water, and accelerating germination in a 28-DEG C incubator. After the seeds bud, the small buds which are orderly and consistent are selected to be sown in a seedling raising tray, and a cultivation substrate (peat soil, vermiculite and perlite=2:1:1) is adopted. And normally managing, wherein 3-4 true leaves are used for a potting transplanting test.
The potted test soil is taken from tomato garden soil which is confirmed to be seriously infected by root-knot nematodes, the soil with 5cm of the epidermis is removed, the soil with 5-20cm of depth is excavated downwards, and 100kg of soil is prepared.
Recombinant expression dsRNA nematophila Serratia is fermented for 30 hours in a fermentation medium, and the thallus density reaches 10 9 CFU, collect bacterial liquid for later use. The bacterial liquid is applied to a pot plant by adopting a soil mixing method, and before the tomato seedlings are transplanted, the bacterial liquid is fully and uniformly mixed with the soil to be tested according to the dosage of 15ml/kg and then is filled into a plastic pot with the volume of 15cm multiplied by 12cm, the soil filling volume is the pot, and the final concentration of the bacterial agent viable bacteria in all the inoculation treatment soil is 3 multiplied by 10 8 CFU/g. A control plant group mixed with sterile water was also set. After 15 days, tomato plants were all removed from the soil and observed for differences in root phenotype due to nematode infection (fig. 6a, b). 6A is the control plant group and 6B is the plant group to which dsRNA Serratia nematophila was added. As can be seen from the results in the figures, dsRNA nematophilaSerratia can obviously inhibit the formation of root knots of root systems.
Sequence listing
<110> Hangzhou university of education
<120> a recombinant Serratia expressing dsRNA and use thereof
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 576
<212> DNA
<213> root-knot nematode (Meloidogyne)
<400> 1
atgtctttga attggcttta ttgcaattta tttattgtaa tactcctttt caacattgta 60
aagagtgata ccgatactaa tgctgatatt gatcgatttg ttgaaattgc agacgatcgt 120
ttaactcttt ctgattatgt tgctttatat aaaattgtta ataaccaaag tattactgat 180
ccaaaacgag aagaaaaact tttggacgat atgagaagta agggaaagaa tctctcgtta 240
tctgaggatt atgttacttt aatattccaa gaccaaataa atgctagtaa atattttcag 300
aattatttgg ttaatttatg gaatcaaaca ggcattccac ctattaaagt tcgaaattta 360
aatacagact tacgcccagc aattgatcaa ataaatacag aaatgctgca attgctagtt 420
aaaatacaaa aacttccctc caaagattgt ttaaaaaaag tagataagtc tgtaaataat 480
tttattatga gagttaatca aattgatgaa caaaatgatg ctttgaaaat ggctgtgaaa 540
ggcaaagacc tctgcccagc atgtaaacat aattaa 576
<210> 2
<211> 521
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
taatacgact cactatagga tgtctttgaa ttggctttat tgcaatttat ttattgtaat 60
actccttttc aacattgtaa agagtgatac cgatactaat gctgatattg atcgatttgt 120
tgaaattgca gacgatcgtt taactctttc tgattatgtt gctttatata aaattgttaa 180
taaccaaagt attactgatc caaaacgaga agaaaaactt ttggacgata tgagaagtaa 240
gggaaagaat ctctcgttat ctgaggatta tgttacttta atattccaag accaaataaa 300
tgctagtaaa tattttcaga attatttggt taatttatgg aatcaaacag gcattccacc 360
tattaaagtt cgaaatttaa atacagactt acgcccagca attgatcaaa taaatacaga 420
aatgctgcaa ttgctagtta aaatacaaaa acttccctcc aaagattgtt taaaaaaagt 480
agataagtct gtaaataatt ttcctatagt gagtcgtatt a 521
<210> 3
<211> 3849
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ttgacaatta atcatcggct cgtataatgc ctctagaaat aattttgttt aactttaaga 60
aggagaatgc aagcggcaac tgttgtgatt aaccgccgcg ctctgcgaca caacctgcaa 120
cgtcttcgtg aactggcccc tgccagtaaa atggttgcgg tggtgaaagc gaacgcttat 180
ggtcacggtc ttcttgagac cgcgcgaacg ctccccgatg ctgacgcctt tggcgtagcc 240
cgtctcgaag aagctctgcg actgcgtgcg gggggaatca ccaaacctgt actgttactc 300
gaaggctttt ttgatgccag agatctgccg acgatttctg cgcaacattt tcataccgcc 360
gtgcataacg aagaacagct ggctgcgctg gaagaggcta gcctggacga gccggttacc 420
gtctggatga aactcgatac cggtatgcac cgtctgggcg taaggccgga acaggctgag 480
gcgttttatc atcgcctgac ccagtgcaaa aacgttcgtc agccggtgaa tatcgtcagc 540
cattttgcgc gcgcggatga accaaaatgt ggcgcaaccg agaaacaact cgctatcttt 600
aatacctttt gcgaaggcaa acctggtcaa cgttccattg ccgcgtcggg tggcattctg 660
ctgtggccac agtcgcattt tgactgggtg cgcccgggca tcattcttta tggcgtctcg 720
ccgctggaag atcgctccac cggtgccgat tttggctgtc agccagtgat gtcactaacc 780
tccagcctga ttgccgtgcg tgagcataaa gccggagagc ctgttggtta tggtggaacc 840
tgggtaagcg aacgtgatac ccgtcttggc gtagtcgcga tgggctatgg cgatggttat 900
ccgcgcgccg cgccgtccgg tacgccagtg ctggtgaacg gtcgcgaagt accgattgtc 960
gggcgcgtgg cgatggatat gatctgcgta gacttaggtc cacaggcgca ggacaaagcc 1020
ggggatccgg tcattttatg gggcgaaggt ttgcccgtag aacgtatcgc tgaaatgacg 1080
aaagtaagcg cttacgaact tattacgcgc ctgacttcaa gggtcgcgat gaaatacgtg 1140
gattaatttg tttaacttta agaaggagaa tgaacacgat taacatcgct aagaacgact 1200
tctctgacat cgaactggct gctatcccgt tcaacactct ggctgaccat tacggtgagc 1260
gtttagctcg cgaacagttg gcccttgagc atgagtctta cgagatgggt gaagcacgct 1320
tccgcaagat gtttgagcgt caacttaaag ctggtgaggt tgcggataac gctgccgcca 1380
agcctctcat cactacccta ctccctaaga tgattgcacg catcaacgac tggtttgagg 1440
aagtgaaagc taagcgcggc aagcgcccga cagccttcca gttcctgcaa gaaatcaagc 1500
cggaagccgt agcgtacatc accattaaga ccactctggc ttgcctaacc agtgctgaca 1560
atacaaccgt tcaggctgta gcaagcgcaa tcggtcgggc cattgaggac gaggctcgct 1620
tcggtcgtat ccgtgacctt gaagctaagc acttcaagaa aaacgttgag gaacaactca 1680
acaagcgcgt agggcacgtc tacaagaaag catttatgca agttgtcgag gctgacatgc 1740
tctctaaggg tctactcggt ggcgaggcgt ggtcttcgtg gcataaggaa gactctattc 1800
atgtaggagt acgctgcatc gagatgctca ttgagtcaac cggaatggtt agcttacacc 1860
gccaaaatgc tggcgtagta ggtcaagact ctgagactat cgaactcgca cctgaatacg 1920
ctgaggctat cgcaacccgt gcaggtgcgc tggctggcat ctctccgatg ttccaacctt 1980
gcgtagttcc tcctaagccg tggactggca ttactggtgg tggctattgg gctaacggtc 2040
gtcgtcctct ggcgctggtg cgtactcaca gtaagaaagc actgatgcgc tacgaagacg 2100
tttacatgcc tgaggtgtac aaagcgatta acattgcgca aaacaccgca tggaaaatca 2160
acaagaaagt cctagcggtc gccaacgtaa tcaccaagtg gaagcattgt ccggtcgagg 2220
acatccctgc gattgagcgt gaagaactcc cgatgaaacc ggaagacatc gacatgaatc 2280
ctgaggctct caccgcgtgg aaacgtgctg ccgctgctgt gtaccgcaag gacaaggctc 2340
gcaagtctcg ccgtatcagc cttgagttca tgcttgagca agccaataag tttgctaacc 2400
ataaggccat ctggttccct tacaacatgg actggcgcgg tcgtgtttac gctgtgtcaa 2460
tgttcaaccc gcaaggtaac gatatgacca aaggactgct tacgctggcg aaaggtaaac 2520
caatcggtaa ggaaggttac tactggctga aaatccacgg tgcaaactgt gcgggtgtcg 2580
ataaggttcc gttccctgag cgcatcaagt tcattgagga aaaccacgag aacatcatgg 2640
cttgcgctaa gtctccactg gagaacactt ggtgggctga gcaagattct ccgttctgct 2700
tccttgcgtt ctgctttgag tacgctgggg tacagcacca cggcctgagc tataactgct 2760
cccttccgct ggcgtttgac gggtcttgct ctggcatcca gcacttctcc gcgatgctcc 2820
gagatgaggt aggtggtcgc gcggttaact tgcttcctag tgaaaccgtt caggacatct 2880
acgggattgt tgctaagaaa gtcaacgaga ttctacaagc agacgcaatc aatgggaccg 2940
ataacgaagt agttaccgtg accgatgaga acactggtga aatctctgag aaagtcaagc 3000
tgggcactaa ggcactggct ggtcaatggc tggcttacgg tgttactcgc agtgtgacta 3060
agcgttcagt catgacgctg gcttacgggt ccaaagagtt cggcttccgt caacaagtgc 3120
tggaagatac cattcagcca gctattgatt ccggcaaggg tctgatgttc actcagccga 3180
atcaggctgc tggatacatg gctaagctga tttgggaatc tgtgagcgtg acggtggtag 3240
ctgcggttga agcaatgaac tggcttaagt ctgctgctaa gctgctggct gctgaggtca 3300
aagataagaa gactggagag attcttcgca agcgttgcgc tgtgcattgg gtaactcctg 3360
atggtttccc tgtgtggcag gaatacaaga agcctattca gacgcgcttg aacctgatgt 3420
tcctcggtca gttccgctta cagcctacca ttaacaccaa caaagatagc gagattgatg 3480
cacacaaaca ggagtctggt atcgctccta actttgtaca cagccaagac ggtagccacc 3540
ttcgtaagac tgtagtgtgg gcacacgaga agtacggaat cgaatctttt gcactgattc 3600
acgactcctt cggtaccatt ccggctgacg ctgcgaacct gttcaaagca gtgcgcgaaa 3660
ctatggttga cacatatgag tcttgtgatg tactggctga tttctacgac cagttcgctg 3720
accagttgca cgagtctcaa ttggacaaaa tgccagcact tccggctaaa ggtaacttga 3780
acctccgtga catcttagag tcggacttcg cgttcgcgta aagaaggcca tcctgacgga 3840
tggcctttt 3849
<210> 4
<211> 681
<212> DNA
<213> Serratia nematophila (Serratia nematodiphila)
<400> 4
atgaacccca tcgtaataaa caggctgcag cggaagctgg gctacacttt tcaacagcag 60
gagcttttac tgcaggcttt gactcaccgc agcgccagca gtaaacacaa tgaacgtctt 120
gagtttctgg gtgactcgat tctgagcttt gtcatcgcca atgcgctcta tcaccgtttt 180
cctcgcgtag acgagggcga catgagccgc atgcgcgcta cgctggtgcg cggcaacacg 240
ctggcggaga tggcgcgcga gtttgacctg ggcgaatgtc tgcggcttgg gccgggcgaa 300
ttgaaaagtg gtgggttccg ccgcgaatca atcctggcgg atacggtgga ggcattgatc 360
ggcggcgtgt tcctggacag cgacatccag accgtcgagc gtctgatttt ggactggtat 420
cgcagccggt tggacgaaat cagccccggc gataagcaga aagacccgaa aacccgtttg 480
caggaatttt tgcaggggcg tcatctgccg ttgccttctt atttggtggt gcaggttcgc 540
ggtgaagcgc acgaccagga gtttaccatc cactgccagg tgagtggttt gagcgagccc 600
gtggtgggca ccggctcgag ccgccgtaaa gccgagcagg cggcagcgga acaagcgctg 660
aaaaagctgg agcttgaatg a 681
<210> 5
<211> 930
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
agccgggcaa accgttggcg gagtgggtgg tgccggccgg gcattacttc atgatgggcg 60
acaaccgtga caacagcgcg gacagccgtt actggggctt tgtgccggag aagaatctgg 120
tgggcaaagc cacggccatc tggatgagct ttgaaaaaca ggaaggcgag tggcctaccg 180
gcgtgcgttt cagccggatc ggcggcattc attaatcgct gatttattcc ctgtcaattt 240
cacgccgcag cctgctgcgg cgtgaaagat taagaggata taaacacagc attatgtttc 300
cactcgttgt agaatacctt ctcgagcgat aaaagttggc tcctgctggg agccactgca 360
aacgaaacag ctttggatcg gctttcggcg aagcaggcct gttccgtgtg ctgcaagttt 420
ttgacgcatt cttgatctat tggtaactca gcgaagtaaa acaacactgc gggtttatcg 480
ccatcgtcgg ccgcccgaat gtgggtaaat cgacgttgct gaaccaactg ctggggcaga 540
aggtttccat tacgtcgcgt aagccgcaga cgacccgtca ccgcatcatg ggcatcgaca 600
ccgatggcgc ctatcaggcg atctacgtcg ataccccagg gctgcacatc gaagaaaaac 660
gcgccatcaa ccgtttgatg aaccgcgcgg ccagcagctc gatcggcgac gttgagctgg 720
tgatcttcgt ggtcgaaggc accaactgga ccgccgacga cgaaatggtg gtcaacaagc 780
tgcgcagcct gcgctgcccg gtattgctgg cgatcaacaa ggtcgataac gttaccgaca 840
aatccaagct gttgccgcac atcgcgttcc tcagccagca gatgaacttc ctcgacgtgg 900
tgcctatttc cgccgagaaa gggatgaacg 930
<210> 6
<211> 1080
<212> DNA
<213> Serratia nematophila (Serratia nematodiphila)
<400> 6
tcagtcgcca atgtattcca tcgccacgcg ctgcgtgagc ttggtgatca gttcataagc 60
gctgataccg gtacaggcgg cgatgcgctc gaccggcaac gccggccccc acagcaccgc 120
ttcatccccc accttatcgg cggcgtccgg cccgagatcg accgaaatca tgtccatcga 180
cacccggccg acgatcggca cttcgcggcc gttgatcagg atcggcgtgc cggtcggcgc 240
gctgcgcggg tagccgtcgc cgtaccccat cgccaccacg ccaaggcgag tatcgcgcgg 300
gctgatccag gtgccgccat agcccaccgc ttcaccagcc ttgtgctcgc gcaccgcgat 360
caggctggat ttcagcgtca tcgccggctg cagaccatgc tcggcgccgc tgccgctatc 420
caacggcgac acgccgtaca gaatgatgcc gggacgcacc cactcgttgt gggcgtccgg 480
ccacagcagc gtgccgccgg aggcggcgac cgagcgctgg cccggtttgc cgcgcgcgaa 540
ctgctcaaag caggcgatct gtttcagcgt ggcgtcggag cccggctcat cggcgcggct 600
gaagtggctc atgatattga ccggctgcgc cacgttgcgg caggcgcaca ggcgctgata 660
aaacgcctcc gcctgttcgg ggcgcacccc cagccgatgc atgccggtat cgagcttcat 720
ccacaccggc accgggcgcg ccagctcggc ctgttccagc gcctcgagct gttcgatgct 780
gtgcaccgcg gtttcgatgt tgttcgccac cagcaccggc aggtcttcgg cgctgaagaa 840
gccttccagc agcaggatcg gcttgacgat gccgccggag cgcagcatca gcgcctcgcc 900
gatgcgcgct acgccgtagc agtcggcgtc ttgcagggtg tgtgctgttt ccagcaggcc 960
atgtccataa gcgtttgctt tcacaacggc aatcaggcgg ctttgcggcg cctggcggcg 1020
cacctgttgc agattatgtc gcagagcgcg gcggtcgatt acagcggttg ccgctttcat 1080
<210> 7
<211> 950
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
ccgaccgaag tgcgctcgcg cgcgcggcgc attttccgcg agcacgacgg gcttagcctg 60
atcatgatcg actacctgca gctgatgcgc gtgccggccc tgtccgacaa ccgtacgctg 120
gagatcgccg agatttcgcg ctcgctgaag gcgctggcga aagagctgca ggtgccggtg 180
gtggcgctgt cgcagctgaa ccgcagcctg gagcagcgcg ccgacaaacg cccggtcaac 240
tccgacctgc gtgaatccgg ctctatcgag caggatgccg acctgattat gttcatctat 300
cgtgatgagg tgtatcacga gaacagcgat ctgaaaggga tcgcggaaat tattatcggt 360
aagcagcgta acggcccgat cggcaccgtg cgccttacct ttaacggcca gtggtcgcgt 420
ttcgataact acgcggggcc acaatacgat gacgaataat cagctaagga actgaatacg 480
ccgcaggggc cgacgcgcgt cggccccgtt tctcagcgcg ttacttcttt accgccaacc 540
acttgtcgat aatcttctga tactcgccgg tcgccttggc caggtgcagc cactgatcca 600
catacagttt ccagctcaga tcgtcgcgcg gcagcatgta agccttctcg ccgtactgca 660
tcggtttggt cggattcacc gcgcacagct tcggatagcg cttttgttgg tacaacgcct 720
cggaggcgtc ggtgatcatc acgtccgcct tgcgatccac cagctgctgg aaaatgctca 780
tgttgtcgtg cgtcagcgtc agtttggcct tcggcaaata ggcgtgcacg aaggcttcat 840
tggtgccgcc cgccggttcc agcaggcgca ccgacggttt gttgatctgt tctatcgtgc 900
ggtatttctt cacgtcggtg cagcgcacca gcggaatttt gccgtcggta 950
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
agccgggcaa accgttggcg g 21
<210> 9
<211> 17
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
cgttcatccc tttctcg 17
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
ccgaccgaag tgcgctcgcg c 21
<210> 11
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
taccgacggc aaaattccgc tg 22
<210> 12
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
atgcaagcgg caactgttgt g 21
<210> 13
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
tagataagtc tgtaaataat ttt 23
Claims (8)
1. Recombinant Serratia expressing dsRNA obtained by exogenous transfer of a coding gene sequence of dsRNA into Serratia nematophila, wherein the dsRNA is capable of gene silencing a root knot nematode chorismate mutase CM,
the nematophila gene knocks out two genes of RNaseIII enzyme RNC and alanine racemase gene alr.
2. The recombinant serratia according to claim 1, wherein the RNC gene sequence is shown in SEQ ID No. 4; the alr gene sequence is shown in SEQ ID NO. 6.
3. The recombinant serratia according to claim 1, characterized by the construction steps of:
(1) Constructing an antibiotic-free screening marker Serratia expression vector, taking a pBBRmcs2 vector as a starting vector, respectively inserting a coding gene for expressing the dsRNA and fragments for expressing alanine racemase genes alr and T7RNA polymerase genes from escherichia coli atcc25922, and constructing a recombinant plasmid pBBR-alr-T7RP-CM;
(2) Knocking out two genes of RNC and alr in Serratia nematophila, and then transferring into recombinant plasmid pBBR-alr-T7RP-CM to obtain the recombinant Serratia nematophila.
4. The recombinant Serratia of claim 3, wherein in step (1), a fragment of the bi-directional T7 promoter fused to the gene encoding the dsRNA is ligated into a pBBRmcs2 vector, and the nucleotide sequence of the fragment of the bi-directional T7 promoter fused to the gene encoding the dsRNA is shown in SEQ ID NO.2.
5. The recombinant Serratia of claim 3, wherein in step (1), the tac promoter is fused to fragments of the alanine racemase gene alr and the T7RNA polymerase gene from E.coli atcc25922, the two genes are preceded by an rbs sequence and the latter gene is followed by a terminator sequence, the sequence of the entire insert being shown in SEQ ID NO.3.
6. The use of the recombinant Serratia bacteria according to any one of claims 1 to 5 for the preparation of a probiotic for controlling root-knot nematodes.
7. A microecological microbial agent for preventing and controlling root-knot nematodes, which is characterized by comprising the recombinant serratia according to any one of claims 1 to 5.
8. A plant cultivation method for controlling root-knot nematodes, characterized in that the microbial inoculum of claim 7 is applied to a soil in which plants are planted, said soil being infected with root-knot nematodes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111375847.4A CN114058562B (en) | 2021-11-19 | 2021-11-19 | Recombinant Serratia expressing dsRNA and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111375847.4A CN114058562B (en) | 2021-11-19 | 2021-11-19 | Recombinant Serratia expressing dsRNA and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114058562A CN114058562A (en) | 2022-02-18 |
| CN114058562B true CN114058562B (en) | 2023-08-18 |
Family
ID=80278587
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111375847.4A Active CN114058562B (en) | 2021-11-19 | 2021-11-19 | Recombinant Serratia expressing dsRNA and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114058562B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6465217B1 (en) * | 2000-07-05 | 2002-10-15 | Paradigm Genetics, Inc. | Methods and compositions for the modulation of chorismate synthase and chorismate mutase expression or activity in plants |
| KR20130016917A (en) * | 2011-08-09 | 2013-02-19 | 재단법인 전라남도생물산업진흥재단 | Serratia nematodiphila wcu338 strain, composition for control plant disease and control method of plant disease with same |
| CN105349453A (en) * | 2015-11-03 | 2016-02-24 | 湖南中烟工业有限责任公司 | Serratia nematodiphila strain and application thereof |
| CN105907769A (en) * | 2016-05-09 | 2016-08-31 | 南京农业大学 | Insecticide toxin protein HS487 and application of gene thereof in biological prevention and treatment |
| KR101886967B1 (en) * | 2017-05-22 | 2018-08-08 | 경상대학교산학협력단 | Serratia nematodiphila gnu02 strain and composition as acaricide against harmful insects containing the same |
| CN110229839A (en) * | 2019-06-04 | 2019-09-13 | 中国农业大学 | A method of significantly promoting Escherichia coli dsRNA expression productivity |
| CN110317756A (en) * | 2019-07-16 | 2019-10-11 | 东北师范大学 | A kind of thermophilic nematode Serratieae and its acquisition methods and application |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19919124A1 (en) * | 1999-04-27 | 2000-11-23 | Rhein Biotech Proz & Prod Gmbh | Nucleic acid molecule comprising a nucleic acid coding for a polypeptide with chorismate mutase activity |
| CA2836368C (en) * | 2006-02-13 | 2020-04-07 | Monsanto Technology Llc | Method for managing crop pest resistance |
| US8575427B2 (en) * | 2008-08-12 | 2013-11-05 | The United States Of America As Represented By The Secretary Of Agriculture | Chorismate mutase gene from the potato cyst nematode Globodera rostochiensis |
-
2021
- 2021-11-19 CN CN202111375847.4A patent/CN114058562B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6465217B1 (en) * | 2000-07-05 | 2002-10-15 | Paradigm Genetics, Inc. | Methods and compositions for the modulation of chorismate synthase and chorismate mutase expression or activity in plants |
| KR20130016917A (en) * | 2011-08-09 | 2013-02-19 | 재단법인 전라남도생물산업진흥재단 | Serratia nematodiphila wcu338 strain, composition for control plant disease and control method of plant disease with same |
| CN105349453A (en) * | 2015-11-03 | 2016-02-24 | 湖南中烟工业有限责任公司 | Serratia nematodiphila strain and application thereof |
| CN105907769A (en) * | 2016-05-09 | 2016-08-31 | 南京农业大学 | Insecticide toxin protein HS487 and application of gene thereof in biological prevention and treatment |
| KR101886967B1 (en) * | 2017-05-22 | 2018-08-08 | 경상대학교산학협력단 | Serratia nematodiphila gnu02 strain and composition as acaricide against harmful insects containing the same |
| CN110229839A (en) * | 2019-06-04 | 2019-09-13 | 中国农业大学 | A method of significantly promoting Escherichia coli dsRNA expression productivity |
| CN110317756A (en) * | 2019-07-16 | 2019-10-11 | 东北师范大学 | A kind of thermophilic nematode Serratieae and its acquisition methods and application |
Non-Patent Citations (1)
| Title |
|---|
| RNA 干扰在植物抗根结线虫病基因工程应用中的研究进展;牛俊海等;基因组学与应用生物学;第28卷(第1期);167-173 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114058562A (en) | 2022-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109679993B (en) | Construction method of agrobacterium rhizogenes-mediated transgenic plant | |
| Zhang et al. | Insecticidal effect of recombinant endophytic bacterium containing Pinellia ternata agglutinin against white backed planthopper, Sogatella furcifera | |
| US5686283A (en) | Genomic DNA encoding the pseudomonas fluorescens alternative sigma factor, RpoS, capable of activating gene expression | |
| CN106832001B (en) | Insecticidal fusion protein, encoding gene and application thereof | |
| CN109735562A (en) | A kind of construction method of the effective root system transgenic system of economic plants | |
| CN101205537A (en) | Method for acquiring transgenic gramineae farm crop capable of being selectively eliminated | |
| CN106834318B (en) | Insect-resistant fusion gene, encoding protein and application thereof | |
| CN113801886B (en) | Application of BZR1 gene in regulation and control of insect pest stress resistance of plants | |
| CN114058562B (en) | Recombinant Serratia expressing dsRNA and application thereof | |
| CN112501172B (en) | Root knot nematode related miRNA and regulatory gene, protein and application thereof | |
| CN103409460A (en) | Maize transformation method | |
| CN103667265B (en) | The application of tomato LoxD gene in regulating plant resistance | |
| CN103834605B (en) | A kind of Abamectin producing bacterium and its preparation method and application | |
| CN114107373B (en) | Method for preparing arabidopsis autophagy gene mutant and application thereof | |
| CN102851297A (en) | Myzuspersicae hunchback gene cDNA and application thereof | |
| CN103305541B (en) | A kind of activate label A c/Ds transposon system and plant mutant storehouse build in application | |
| WO2018177146A1 (en) | Recombinant microorganism for expressing tenvermectin b, preparation method therefor and use thereof | |
| CN113801834B (en) | Gene engineering streptomyces diastatochromogenes for high yield of toyocamycin and construction method and application thereof | |
| CN109096380A (en) | Application of the OsBICs gene in regulation plant plant height, flowering time | |
| CN110541000B (en) | Method for obtaining magnetic nanoparticle-mediated antibacterial peptide chlorella | |
| CN110396125B (en) | Application of arabidopsis transcription factor gene PIF3 in insect stress resistance of plants | |
| CN102140446A (en) | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape | |
| CN113980945B (en) | Trichoderma viride histone deacetylase and encoding gene and application thereof | |
| AU4662593A (en) | Gene activating element | |
| CN115927363B (en) | Cymbidium CgARF8 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |