CN106834318B - Insect-resistant fusion gene, encoding protein and application thereof - Google Patents

Abstract

The invention discloses an insect-resistant fusion gene, an encoding protein and application thereof, wherein the gene comprises a nucleotide sequence which sequentially contains encoding chitin binding protein and a nucleotide sequence which encodes Vip3 toxin from 5 'to 3'; and the 2 nucleotide sequences are positioned in the same open reading frame. Compared with the original chitin binding protein and Vip3 protein, the artificial protein molecule synthesized by fusing one chitin binding protein and one Vip3 toxin has the following advantages: the insecticidal spectrum is wide, multiple important pests (such as beet armyworms, armyworms and whiteflies) in lepidoptera and hemiptera can be simultaneously controlled, and the insecticidal efficiency reaches 50-100 percent; is beneficial to the combined use of the protein with different functions and other insect-resistant proteins (such as ICPs), further expands the insecticidal spectrum and delays the generation of pest resistance.

Description

Insect-resistant fusion gene, encoding protein and application thereof

(I) technical field

The invention relates to an insect-resistant fusion gene, a fusion protein coded by the insect-resistant fusion gene and application of the fusion protein.

(II) background of the invention

The pests bring huge loss to global agricultural production, the current pest control mainly depends on chemical pesticides, but the use of the pesticides aggravates the production cost, and pesticide residues bring serious harm to human health. Therefore, the method for preventing and controlling the pests by using the genetic engineering method has great economic, environmental and social values.

The key to obtaining transgenic pest-resistant crops is cloning excellent insecticidal protein. There are many insecticidal proteins, and most widely used is Bacillus thuringiensis (Bt) secreted by ICP during cell production, such as Cry1Ab, Cry1C, etc., which have strong killing effect on lepidopteran, dipteran, coleopteran, etc. (e.g., diamond back moth, corn borer) (Schnepf, e.crickmore, n., Van, r.j., Lereclus, d.baum, j., & Feitelson, j., et al 1998,62(3), 775) 806), which have been studied and widely used at present, and transgenic Bt crops such as corn, soybean, potato, cotton, etc. have been commercially grown on a large scale. Bacillus thuringiensis also secretes, during vegetative growth, a protein with no amino acid sequence homology to ICPs, a completely different insecticidal mechanism, namely Vegetative Insecticidal Proteins (VIPs), such as Vip3A, Vip3B, Vip3C, Vip3D, Vip3H, which are also insecticidally active against some ICPs-insensitive pests, and which do not cross-resistance (Estruch, J.J., Warren, G.W., Mullins, M.A., Nye, G.J., Craig, J.A. & Koziel, M.G.1996, Proceedings of the National Academy of Sciences of the United States of America,93(11), and 5394).

The Vip3 protein is a novel insecticidal protein, and is a good complement to the ICP protein which is most widely used at present from the aspects of insecticidal mechanism, insecticidal spectrum and insecticidal activity. For example, ICPs have weak killing effect on prodenia litura and armyworm, and Vip3 has good control effect on prodenia litura and armyworm. Nevertheless, in the practical operation of transgenic crop development, there are still some technical problems to be solved urgently. For example, researchers have found that plants highly expressing the Vip3 gene alone are relatively slow in growth and prone to albinism. This is probably because after the Vip3 protein is directly expressed in transgenic plants, the protein is greatly gathered and combined on plant cell membranes and forms pores due to the secretion of a signal peptide, thereby causing damage to cells and influencing the growth and development of the cells.

Sucking phloem juice by hemiptera pests (such as whiteflies and plant hoppers) causes plant withering, leaf fall, growth retardation, yield reduction and even extinction, and causes great harm to grain crops and economic crops such as rice, cotton and the like. The Bt insect-resistant gene has good killing effect on pests such as Lepidoptera, Coleoptera and the like. However, no Bt protein has been found to have a good control effect on hemipteran pests. Recently, scientists have discovered a protein Tma12 from ferns with excellent control of hemipteran pests, a chitin binding protein with chitinase activity (Shukla A K, Udahyay S K, Mishra M, et al 2016, Nature Biotechnology).

Most of the first generation transgenic crops only have the characteristic of resisting lepidoptera pests, while the second generation transgenic crops are developing to the compound characteristic of resisting various pests at the same time. There are various ways to obtain transgenic crops with complex traits, such as by crossing transgenic crops with a single trait; constructing a plurality of gene expression frames in the same expression frame; through co-transformation, a plurality of agrobacterium tumefaciens containing single genes are mixed together for mixed transformation, and a transgenic plant with a plurality of genes simultaneously integrated with two or more plasmid T-DNA is screened out. However, the above method has some problems in actual operation and application. Therefore, a method for obtaining a transgenic crop with a complex trait more simply and efficiently is a problem which needs to be actually solved.

Disclosure of the invention

The invention aims to provide a method for simultaneously killing lepidoptera and hemiptera by using the same fusion protein through gene fusion.

The technical scheme adopted by the invention is as follows:

the invention provides an insect-resistant fusion gene, which sequentially comprises a nucleotide sequence for coding chitin-binding protein and a nucleotide sequence for coding Vip3 toxin from 5 'to 3'; and the 2 nucleotide sequences are positioned in the same open reading frame.

Further, preferably, the gene is composed of a nucleotide sequence coding for chitin-binding protein and a nucleotide sequence coding for Vip3 toxin which are connected in sequence from 5 'to 3'.

Further, the chitin binding protein is Tma12, and the Vip3 toxin is Vip3A, Vip3B, Vip3C, Vip3D or Vip 3H.

Still further, the Vip3 toxin is Vip3A or Vip 3H.

Further, the nucleotide sequence of the insect-resistant fusion gene is SEQ ID NO: 1 (chitin binding protein Tma12, Vip toxin Vip3A) or SEQ ID NO: 3 (chitin binding protein is Tma12, Vip toxin is Vip 3H).

The invention also provides a fusion protein coded by the insect-resistant fusion gene, which is chitin binding protein and Vip3 toxin from the N end to the C end in sequence.

Further, the amino acid sequence of the fusion protein is SEQ ID NO: 2 (chitin binding protein Tma12, Vip3 toxin Vip3A) or SEQ ID NO: 4 (chitin binding protein is Tma12, Vip toxin is Vip 3H).

The invention also provides application of the fusion protein in preparing transgenic insect-resistant crops, transgenic insecticidal microorganisms or antibodies of the fusion protein.

Furthermore, the transgenic insect-resistant crop is prepared by converting the fusion protein and the BT crystal toxin.

Compared with the prior art, the invention has the following beneficial effects: compared with the original chitin binding protein and Vip3 protein, the artificial protein molecule synthesized by fusing one chitin binding protein and one Vip3 toxin has the following advantages: the insecticidal spectrum is wide, multiple important pests (such as beet armyworms, armyworms and whiteflies) in lepidoptera and hemiptera can be simultaneously controlled, and the insecticidal efficiency reaches 50-100 percent; is beneficial to the combined use of the protein with different functions and other insect-resistant proteins (such as ICPs), further expands the insecticidal spectrum and delays the generation of pest resistance.

(IV) description of the drawings

FIG. 1 is a structural diagram of a fusion pesticidal protein of the present invention. The N end of the fusion protein is chitin binding protein, and the C end is Vip3 toxin.

FIG. 2 is a structural diagram of a T-DNA of the present invention for introducing a pesticidal fusion protein gene into a plant. pUBI is a maize ubiquitin promoter, and the fusion protein gene is chitin binding protein-Vip 3 toxin fusion gene.

FIG. 3 is a diagram of the structure of T-DNA of the present invention for the combined introduction of insecticidal fusion proteins and ICPs into plants. pUBI is a maize ubiquitin promoter, the fusion protein gene is a chitin binding protein-Vip 3 toxin fusion gene, p35S is a cauliflower mosaic virus 35S promoter, and ICPs are parasporal crystallin coding genes.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1 construction of Tma12-Vip3A fusion protein expression vector

The Tma12 and Vip3A insecticidal protein genes are synthesized by Shanghai, and the DNA sequences are respectively SEQ ID NO: 5 and SEQ ID NO in Chinese patent 200610049611.0: 7, and cloned between the restriction enzyme BamHI and SacI sites of pET28a expression vector. The constructed vectors were named pET28a-Tma12 and pET28a-Vip3A, respectively.

The Tma12-Vip3A is synthesized by the following steps:

1. vip3A (SEQ ID NO: 7 in Chinese patent 200610049611.0) was used as a template to obtain a Vip3A gene fragment by PCR.

2. The primers are as follows:

vip 3A-F: 5' CCCGGGAAGGGTGGAGGAATGAACAAGAACAACACCAAG and Vip 3A-R: 5' CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTCACGA. These two primers contain sites for restriction endonuclease sites XmalI and ScaI, respectively.

3. The PCR product was treated with XmalI and ScaI and ligated with pET28a-Tma12 vector treated with the same enzyme.

4. The plasmid obtained by transferring the strain into Escherichia coli is pET28a-Tma12-Vip 3A. The fusion protein gene Tma12-Vip3A (SEQ ID NO: 1) was cloned into pET28a expression vector, and the fusion protein encoded by the fusion protein gene Tma12-Vip3A (SEQ ID NO: 2) has molecular weight of about 116 kD.

Example 2 construction of Tma12-Vip3H fusion protein expression vector

The Tma12 and Vip3H insecticidal protein genes are synthesized by Shanghai, and the DNA sequences are respectively SEQ ID NO: 5 and SEQ ID NO: 6, and was cloned between the restriction enzyme BamHI and SacI sites of pET28a expression vector. The constructed vectors were named pET28a-Tma12 and pET28a-Vip3H, respectively.

The Tma12-Vip3H is synthesized by the following steps:

1. a fragment of Vip3H gene was obtained by PCR using Vip3H (SEQ ID NO: 6) as a template. The primers are as follows: vip 3H-F: 5' CCCGGGAAGGGTGGAGGAATGAACAAGAACAACAGTAAG and Vip 3H-R: 5' CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGGTGATGT. These two primers contain sites for restriction endonuclease sites XmalI and ScaI, respectively.

2. The PCR product was treated with XmalI and ScaI and ligated with pET28a-Tma12 vector treated with the same enzyme.

3. The plasmid obtained by transferring the strain into Escherichia coli is pET28a-Tma12-Vip 3H. The fusion protein gene Tma12-Vip3H (SEQ ID NO: 3) was cloned into pET28a expression vector, and the fusion protein encoded by the fusion protein gene Tma12-Vip3H (SEQ ID NO: 4) has a molecular weight of about 112 kD.

Example 3 expression of insecticidal proteins

The above expression vectors containing the fusion protein gene (pET28a-Tma12-Vip3A, pET28a-Tma12-Vip3H, pET28a-Tma12, pET28a-Vip3A and pET28a-Vip3H) were transformed into E.coli BL21star, respectively, by a general standard method. Selecting monoclonal colony, inoculating into 100ml LB bacterial culture solution, shaking culturing at 37 deg.C to OD₆₀₀IPTG was added to 0.5mM and incubation continued under the same conditions for 4 hours. 5000g of culture solution is collected and centrifuged for 10 minutes to precipitate Escherichia coli cells, and then the supernatant is discarded to collect the precipitate. 30 ml of 20mM Tris-HCL buffer solution is added into the precipitate, and the mixture is subjected to ultrasonic pulverization to be used for measuring the insecticidal activity.

Example 4 Tma12-Vip3A and Tma12-Vip3H have killing effects on various lepidopteran and hemipteran pests

The insecticidal proteins obtained in example 3 (Tma12-Vip3A, Tma12-Vip3H, Tma12, Vip3A and Vip3H) were each coated on the surface of artificial insect feed and newborn first-instar larvae were used for insecticidal assay. The negative control was pET28a empty vector, prepared in the same manner as in example 3. Insecticidal activity results are shown in table 1:

TABLE 1 pesticidal efficiency of fusion proteins

	Sticky insect	Beet armyworm	Bemisia tabaci (Fr.) Kuntze
				Tma12	0％	0％	100％
Vip3A	100％	100％	0％
				Vip3H	100％	100％	0％
Tma12-Vip3A	100％	100％	100％
				Tma12-Vip3H	100％	100％	100％
Negative control	0％	0％	0％

Example 5 Tma12-Vip3A plant transformation vector construction

The Tma12-Vip3A gene fragment was obtained by PCR using Tma12-Vip3A (SEQ ID NO: 1) as a template. The primers are as follows: TVA-F: 5' AGGATCCAACAATGGGCAGGAGCTGGGGCGT and TVA-R: 5' CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTC. These two primers contain sites for restriction endonuclease sites BamH1 and ScaI, respectively. The terminator sequence ter (SEQ ID NO: 8) was artificially synthesized, and ScaI and KpnI sites were provided at the 5 'end and 3' end, respectively. The Tma12-Vip3A digested with BamH1 and ScaI and the terminator digested with ScaI and KpnI were ligated to the pCambia1300 vector digested with BamH1 and KpnI to obtain pCambia1300-Tma12-Vip 3A-ter.

pUBI is a maize ubiquitin protein promoter and is obtained by PCR. pUBI was obtained by PCR amplification using genomic DNA of Zhengdan 958, a commercial maize variety as a template. The PCR reaction conditions are as follows: 3 minutes at 95 ℃; repeating 32 cycles at 95 ℃ for 15 seconds, 68 ℃ for 15 seconds, and 72 ℃ for 2 minutes; then 10 minutes at 72 ℃. The resulting PCR product of approximately 2.0Kb was cloned into the T-vector pMD 19. Clones with correct sequence were obtained for the following experiments. PCR primers were pUBI-F (5 'GAAGCTTGCATGCCTACAGTGCAGCGTGACCC) and pUBI-R (5' GGGTGGATCCTCTAGAGTCGACCTGCAGAAGTAAC), which were provided with HindIII and BamHI restriction sites, respectively.

The pUBI was digested with HindIII and BamHI, and the digested fragments were ligated into pCambia1300-Tma12-Vip3A-ter vector digested with the same enzymes to obtain the final vector. This vector was named: pCambia1300-pUBI-Tma12-Vip 3A.

Finally, the above T-DNA plasmid was transferred into Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15. mu.g/mL tetracycline and 50. mu.g/mL kanamycin, and maintained for the subsequent plant transformation.

Example 6 Tma12-Vip3H plant transformation vector construction

The Tma12-Vip3H gene fragment was obtained by PCR using Tma12-Vip3H (SEQ ID NO: 2) as a template. The primers are as follows: TVH-F: 5' GGATCCAACAATGGGCAGGAGCTGGGGCGT and TVH-R: 5' CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGG. These two primers contain sites for restriction endonuclease sites BamH1 and ScaI, respectively. The terminator sequence ter (SEQ ID NO: 8) was artificially synthesized, and ScaI and KpnI sites were provided at the 5 'end and 3' end, respectively. The Tma12-Vip3H digested with BamH1 and ScaI and the terminator digested with ScaI and KpnI were ligated to the pCambia1300 vector digested with BamH1 and KpnI to obtain pCambia1300-Tma12-Vip 3H-ter.

The pUBI is the maize ubiquitin protein promoter obtained by the same method as example 5.

The pUBI was digested with HindIII and BamHI, and the digested fragments were ligated into pCambia1300-Tma12-Vip3H-ter vector digested with the same enzymes to obtain the final vector. This vector was named: pCambia1300-pUBI-Tma12-Vip 3H.

Finally, the above T-DNA plasmid was transferred into Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15. mu.g/mL tetracycline and 50. mu.g/mL kanamycin, and maintained for the subsequent plant transformation.

Example 7 Tma12-Vip3A and ICPs protein plant transformation vector construction

The gene of the insecticidal protein Cry1Ab (SEQ ID NO: 7) was synthesized from Shanghai, and BamH1 and ScaI sites were provided at the 5 'and 3' ends, respectively. The terminator sequence ter (SEQ ID NO: 8) was artificially synthesized, and ScaI and EcoRI sites were placed at the 5 'end and 3' end, respectively. Cry1Ab digested with BamHI and ScaI and terminator digested with ScaI and EcoRI were ligated into BamH1 and EcoRI-digested pCambia1300 vector to obtain pCambia1300-Cry1 Ab-ter.

The p35S promoter is cauliflower mosaic virus CaMV 35S promoter, is synthesized by Shanghai, and has a sequence shown in SEQ ID NO: the 9, 5 'end and the 3' end are respectively provided with KpnI and BamHI sites.

The pCambia1300-Cry1Ab-ter was digested with BamH1 and EcoRI, p35S was digested with KpnI and BamHI, and the two fragments were ligated in three pieces with the KpnI and EcoRI-digested vector pCambia1300-Tma12-Vip3A-ter to obtain the final vector. This vector was named: pCambia1300-pUBI-Tma12-Vip3A-p35S-Cry1 Ab.

Finally, the above T-DNA plasmid was transferred into Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15. mu.g/mL tetracycline and 50. mu.g/mL kanamycin, and maintained for the subsequent plant transformation.

Example 8 Tma12-Vip3H Gene and BT Crystal toxin Gene (ICPs protein) plant transformation vector construction

The gene of the insecticidal protein Cry1Ab (SEQ ID NO: 7) was synthesized from Shanghai, and BamH1 and ScaI sites were provided at the 5 'and 3' ends, respectively. The terminator sequence ter (SEQ ID NO: 8) was artificially synthesized, and ScaI and EcoRI sites were placed at the 5 'end and 3' end, respectively. Cry1Ab digested with BamHI and ScaI and terminator digested with ScaI and EcoRI were ligated into BamH1 and EcoRI-digested pCambia1300 vector to obtain pCambia1300-Cry1 Ab-ter.

The p35S promoter is cauliflower mosaic virus CaMV 35S promoter, is synthesized by Shanghai, and has a sequence shown in SEQ ID NO: the 9, 5 'end and the 3' end are respectively provided with KpnI and BamHI sites.

The pCambia1300-Cry1Ab-ter was digested with BamH1 and EcoRI, p35S was digested with KpnI and BamHI, and the two fragments were ligated in three pieces with the KpnI and EcoRI-digested vector pCambia1300-Tma12-Vip3H-ter to obtain the final vector. This vector was named: pCambia1300-pUBI-Tma12-Vip3H-p35S-Cry1 Ab.

Finally, the above T-DNA plasmid was transferred into Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15. mu.g/mL tetracycline and 50. mu.g/mL kanamycin, and maintained for the subsequent plant transformation.

Example 9 transgenic Rice

The transgenic rice is obtained by adopting the prior art (Luzhong, Gong ancestor Xun (1998) Life sciences 10: 125-. Mature and full 'Xishui-134' seeds are selected to be hulled, and callus is generated by induction and is used as a transformation material. The vectors constructed in examples 5-8 and the pCambia1300 empty vector Agrobacterium slide were taken separately. A single colony is selected and inoculated, and agrobacterium for transformation is prepared. The callus to be transformed is placed into an Agrobacterium tumefaciens liquid with an OD of about 0.6 (preparation of Agrobacterium tumefaciens liquid: Agrobacterium tumefaciens is inoculated into a culture medium to be cultured until the OD is about 0.6, the culture medium consists of 3g/L K₂HPO₄、1g/LNaH₂PO₄、1g/LNH₄Cl、0.3g/L MgSO₄·7H₂O、0.15g/L KCl、0.01g/L CaCl₂、0.0025g/L FeSO₄·7H₂O, 5g/L sucrose, 20mg/L acetosyringone, water as solvent, pH 5.8), allowing Agrobacterium to bind to the callus surface, and transferring the callus to co-culture medium (MS +2 mg/L2, 4-D +30g/L glucose +30g/L sucrose +3g/L agar (sigma 7921) +20mg/L acetosyringone) for co-culture for 2-3 days. The transformed calli were rinsed with sterile water, transferred to selection medium (MS +2 mg/L2, 4-D +30g/L sucrose +3g/L agar (Sigma 7921) +20mg/L acetosyringone +2mM glyphosate (Sigma)), and cultured for two months with selection (intermediate subculture). Transferring the callus with good growth activity after screening to a pre-differentiation culture medium (MS +0.1g/L inositol +5mg/L ABA +1mg/L NAA +5 mg/L6-BA +20g/L sorbitol +30g/L sucrose +2.5 g/Lgelrite) for culturing for about 20 days, then transferring the pre-differentiated callus to the differentiation culture medium, and irradiating for differentiation and germination for 14 hours every day. After 2-3 weeks, transferring the resistant regenerated plants to a rooting culture medium (1/2 MS +0.2 mg/L NAA +20g/L sucrose +2.5g/L gelrite), strengthening and rooting the strong seedlings, finally washing the regenerated plants and removing agar, transplanting the washed regenerated plants to a greenhouse, selecting transgenic lines with high yield, large seeds or high biomass and the like which can improve the rice yield, and culturing new varieties. Separately obtaining a vector containing the above transformation vector and a vector containing onlyTransgenic rice plants with empty vector of the selection marker gene EPSPS.

Example 10 transgenic Rice can kill pests

T0 generation plants of the transgenic rice plants prepared in example 9 were transplanted in the greenhouse, and the insecticidal properties of the transgenic rice plants and the non-transgenic recipient control plants were compared and analyzed. We performed insect resistance assays on 102 transgenic lines (designated TV3A) transformed with pCambia1300-Tma12-Vip3A-ter vector and 83 transgenic lines (designated TV3H) transformed with pCambia1300-Tma12-Vip3H-ter vector, and the insecticidal effects are shown in Table 2:

table 2: detecting the insecticidal effect of different pests on the rice leaf extract 30 days after sowing

Pest pests	Insecticidal rate
		Sticky insect	100％
Beet armyworm	100％
		Bemisia tabaci (Fr.) Kuntze	100％

Injecting: at least 3 replicates were set up for each experiment.

The insect resistance of 137 transgenic lines (named as TV3A1Ab) transformed with pCambia1300-Tma12-Vip3A-p35S-Cry1Ab vector and 142 transgenic lines (named as TV3H1Ab) transformed with pCambia1300-Tma12-Vip3H-p35S-Cry1Ab vector, which are obtained by us, was determined, and the insecticidal effect thereof was shown in Table 3:

table 3: detecting the insecticidal effect of different pests on the rice leaf extract 30 days after sowing

Pest pests	Insecticidal rate
		Corn borer	100％
Bollworm	100％
		Sticky insect	100％
Beet armyworm	100％
		Bemisia tabaci (Fr.) Kuntze	100％

Injecting: at least 3 replicates were set up for each experiment.

Example 11 transgenic Soybean

The procedure used here to obtain transgenic soybeans is known from the prior art (Deng et al, 1998, plant physiology Communications 34: 381-387; Ma et al, 2008, scientific agricultural informa 41: 661-668; Zhou et al, 2001, Journal of northern agricultural University 32: 313-319). Healthy, full and ripe soybeans were selected, sterilized with 80% ethanol for 2 minutes, washed with sterile water, and then sterilized in a desiccator filled with chlorine gas (generated by reacting 50ml of naclo with 2ml of concentrated HCl) for 4-6 hours. Sterilizing semen glycines in clean benchIs sown in B5 culture medium, and cultured at 25 deg.C for 5 days with optical density of 90-150 μmol photon/m²S level. When the cotyledon turns green and breaks the seed coat, the aseptic bean sprouts grow. The bean sprouts with the hypocotyl removed were cut into five-five pieces in length so that both explants had cotyledons and epicotyls. The explants are cut at about 7-8 of the node of the cotyledon and epicotyl and can be used as the target tissue to be infected.

Agrobacterium from the vector constructed in examples 5-8 and the pCambia1300 empty vector, respectively, were separately cultured for use. The prepared explants are immersed in the agrobacterium suspension and co-cultured for about 30 minutes. Then, the excess cell suspension on the infected tissue was absorbed up with absorbent paper, transferred to 1/10B5 co-culture medium, and cultured in the dark at 25 ℃ for 3-5 days.

The co-cultured plant tissue was washed with B5 liquid medium to remove excess Agrobacterium, and then placed in B5 solid medium for 5 days at 25 ℃ until it germinated. The induced germ tissue was transferred to B5 selection medium containing 0.1-0.5mM glyphosate and incubated at 25 ℃ with light for 4 weeks, during which the medium was changed every two weeks. Transferring the selected embryo tissue to a solid culture medium, culturing at 25 deg.C, and growing into plantlet. Subsequently, the transgenic plants were transferred to 1/2B5 medium for rooting induction. Finally, the grown plantlets are washed to remove agar and planted in a greenhouse.

Example 12 transgenic Soybean is insecticidal

T0 generation plants of the transgenic rice plants prepared in example 11 were transplanted in the greenhouse and the insecticidal properties of the transgenic rice plants and non-transgenic recipient control plants were compared and analyzed. We performed insect resistance assays on 76 transgenic lines (designated TV3A) transformed with pCambia1300-Tma12-Vip3A-ter vector and 68 transgenic lines (designated TV3H) transformed with pCambia1300-Tma12-Vip3H-ter vector, and the insecticidal effects are shown in Table 4:

table 4: detecting the insecticidal effect of different pests on soybean leaf extract 24 days after sowing

Pest pests	Insecticidal rate
		Sticky insect	100％
Beet armyworm	100％
		Bemisia tabaci (Fr.) Kuntze	100％

Injecting: at least 3 replicates were set up for each experiment.

Insect resistance assays were performed on 62 transgenic lines obtained by us transformed with pCambia1300-Tma12-Vip3A-p35S-Cry1Ab vector (designated TV3A1Ab) and 77 transgenic lines transformed with pCambia1300-Tma12-Vip3H-p35S-Cry1Ab vector (designated TV3H1Ab), and the insecticidal effects thereof were shown in Table 5:

table 5: detecting the insecticidal effect of different pests on soybean leaf extract 24 days after sowing

Pest pests	Insecticidal rate
		Corn borer	100％
Bollworm	100％
		Sticky insect	100％
Beet armyworm	100％
		Bemisia tabaci (Fr.) Kuntze	100％

Injecting: at least 3 replicates were set up for each experiment.

Finally, it should also be noted that the above-mentioned list is only a specific embodiment of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

SEQUENCE LISTING

<110> Zhejiang university

<120> insect-resistant fusion gene, encoding protein and application thereof

<130>

<160>9

<170>PatentIn version 3.5

<210>1

<211>3042

<212>DNA

<213>unknown

<220>

<223> Artificial sequence

<400>1

atgggcagga gctggggcgt ggtggccgtg atggtgctgt gcgccagcgg cctgctgggc 60

atcgtgaggg gccacggcag catggaggac ccgatcagca gggtgtacag gtgcaggctg 120

gagaacccgg agaggccgac cagcccggcc tgccaggctg ccgtggccct gagcggcacc 180

caggccttct acgactggaa cgaggtgaac atcccgaacg ctgccggcag gcacagggag 240

ctgatcccgg acggccagct gtgcagcgcc ggcaggttca agttcagggg cctggacctg 300

gccaggagcg actggatcgc caccccgctg ccgagcggag ccagcagctt cccgttcagg 360

tacatcgcca ccgccgccca cctgggcttc ttcgagttct acgtgaccag ggagggctac 420

cagccgaccg tgccgctgaa gtgggccgac ctggaggagc tgccgttcat caacgtgacc 480

aaccctccgc tggtgagcgg cagctaccag atcaccggca ccaccccgag cggcaagagc 540

ggcagccacc tgatctacgt gatctggcag aggaccgaca gcccggaggc cttctacagc 600

tgcagcgacg tgtacttcac cgacgccctg agcctgcaca gcaccacccg aggccccggg 660

aagggtggag gaatgaacaa gaacaacacc aagctgagca ccagggccct gccgagcttc 720

atcgactact tcaacggcat ctacggcttc gccaccggca tcaaggacat catgaacatg 780

atcttcaaga ccgacaccgg cggcgacctg accctggacg agatcctgaa gaaccagcag 840

ctgctgaacg acatcagcgg caagctggac ggcgtgaacg gcagcctgaa cgacctgatc 900

gcccagggca acctgaacac cgagctgagc aaggagatcc tgaagatcgc caacgagcag 960

aaccaggtgc tgaacgacgt gaacaacaag ctggacgcca tcaacaccat gctgagggtg1020

tacctgccga agatcaccag catgctgagc gacgtgatga agcagaacta cgccctgagc 1080

ctgcagatcg agtacctgag caagcagctg caggagatca gcgacaagct ggacatcatc 1140

aacgtgaacg tgctgatcaa cagcaccctg accgagatca ccccggccta ccagaggatc 1200

aagtacgtga acgagaagtt cgaggagctg accttcgcca ccgagaccag cagcaaggtg 1260

aagaaggacg gcagcccggc cgacatcctg gacgagctga ccgagctgac cggcctggcc 1320

aagagcgtgc cgaagaacga cgtggacggc ttcgagttct acctgaacac cttccacgac 1380

gtgatggtgg gcaacaacct gttcggcagg agcgccctga agaccgccag cgagctgatc 1440

accaaggaga acgtgaagac cagcggcagc gaggtgggca acgtgtacaa cagcctgatc 1500

gtgctgaccc tgctgcaggc caaggccttc ctgaccctga ccacctgcag gaagctgctg 1560

ggcctggccg acatcgacta caccagcatc atgaacgagc acctgaacaa ggagaaggag 1620

gagttcaggg tgaacatccc gccgaccctg agcaacacct tcagcaaccc gaactacgcc 1680

aaggtgaagg gcagcgacga ggacgccaag atgatcgtgg aggccaagcc gggccacgcc 1740

ctggtgggct tcgagatcag caacgacagc atcaccgtgc tgaaggtgta cgaggccaag 1800

ctgaagcaga actaccaggt ggacaaggac agcctgagcg aggtgatcta cggcgacatg 1860

gacaagctgc tgggcccgga ccagagcggc ccgatctact acccgaacaa catcgtgttc 1920

ccgaacgagt acgtgatcac caagatcgac ttcaccaaga agatgaagac cctgaggtac 1980

gaggtgaccg ccaacttcta cgacagcagc accggcgaga tcgacctgaa caagaagaag 2040

gtggagagca gcgaggccga gtacaggacc ctgagcgcca acgacgacgg cgtgtacatg 2100

ccgctgggcg tgatcagcga gaccttcctg accccgatca acggcttcgg cctgcaggcc 2160

gacgagaaca gcaggctgat caccctgacc tgcaagagct acctgaggga gctgctgctg 2220

gccaccgacc tgagcaacaa ggagaccaag ctgatcgtgc cgccgagcgg cttcatcaag 2280

aacatcgtgg agaacggcag catcgaggag gacaacctgg agccgtggaa ggccaacaac 2340

aagaacgcct acgtggacca caccggcggc gtgaacggca ccaaggccct gtacgtgcac 2400

aaggacggcg gcatcagcca gttcatcggc gacaagctga agccgaagac cgagtacgtg 2460

atccagtaca ccgtgaaggg caagccgagc atccacctga aggacgagaa caccggctac 2520

atccactacg aggacaccaa caacaacctg gaggactacc agaccatcac caagaggttc 2580

accaccggca ccgacctgaa gggcgtgtac ctgatcctga agagccagaa cggcgacgag 2640

gcctggggcg acaacttcat catcctggag atcagcccga gcgagaagct gctgagcccg 2700

gagctgatca acaccaacaa ctggaccagc accggcagca ccaacatcag cggcaacacc 2760

ctgaccctgt accagggcgg caggggcatc ctgaagcaga acctgcagct ggacagcttc 2820

agcacctaca gggtgtactt cagcgtgagc ggcgacgcca acgtgaggat caggaacagc 2880

agggaggtgc tgttcgagaa gaggtacatg agcggcgcca aggacgtgag cgagatcttc 2940

accaccaagc tgggcaagga caacttctac atcgagctga gccagggcaa caacctgaac 3000

ggcggcccga tcgtgaagtt ctacgacgtg agcatcaagt ag 3042

<210>2

<211>1013

<212>PRT

<213>unknown

<220>

<223> Artificial sequence

<400>2

Met Gly Arg Ser Trp Gly Val Val Ala Val Met Val Leu Cys Ala Ser

1 5 10 15

Gly Leu Leu Gly Ile Val Arg Gly His Gly Ser Met Glu Asp Pro Ile

20 25 30

Ser Arg Val Tyr Arg Cys Arg Leu Glu Asn Pro Glu Arg Pro Thr Ser

35 40 45

Pro Ala Cys Gln Ala Ala Val Ala Leu Ser Gly Thr Gln Ala Phe Tyr

50 55 60

Asp Trp Asn Glu Val Asn Ile Pro Asn Ala Ala Gly Arg His Arg Glu

65 70 75 80

Leu Ile Pro Asp Gly Gln Leu Cys Ser Ala Gly Arg Phe Lys Phe Arg

85 90 95

Gly Leu Asp Leu Ala Arg Ser Asp Trp Ile Ala Thr Pro Leu Pro Ser

100 105 110

Gly Ala Ser Ser Phe Pro Phe Arg Tyr Ile Ala Thr Ala Ala His Leu

115 120 125

Gly Phe Phe Glu Phe Tyr Val Thr Arg Glu Gly Tyr Gln Pro Thr Val

130 135 140

Pro Leu Lys Trp Ala Asp Leu Glu Glu Leu Pro Phe Ile Asn Val Thr

145 150 155 160

Asn Pro Pro Leu Val Ser Gly Ser Tyr Gln Ile Thr Gly Thr Thr Pro

165 170 175

Ser Gly Lys Ser Gly Ser His Leu Ile Tyr Val Ile Trp Gln Arg Thr

180 185 190

Asp Ser Pro Glu Ala Phe Tyr Ser Cys Ser Asp Val Tyr Phe Thr Asp

195 200 205

Ala Leu Ser Leu His Ser Thr Thr Arg Gly Pro Gly Lys Gly Gly Gly

210 215 220

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

225 230 235 240

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

245 250 255

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

260 265 270

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

275 280 285

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

290 295 300

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

305 310 315 320

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

325 330 335

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

340 345 350

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

355 360 365

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

370 375 380

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

385 390 395 400

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

405 410 415

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

420 425 430

Leu Thr Glu Leu Thr Gly Leu Ala Lys Ser Val Pro Lys Asn Asp Val

435 440 445

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

450 455 460

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

465 470 475 480

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

485 490 495

Asn Ser Leu Ile Val Leu Thr Leu Leu Gln Ala Lys Ala Phe Leu Thr

500 505 510

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

515 520 525

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

530 535 540

Asn Ile Pro Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

545 550 555 560

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

565 570 575

Pro Gly His Ala Leu Val Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

580 585 590

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

595 600 605

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

610 615 620

Gly Pro Asp Gln Ser Gly Pro Ile Tyr Tyr Pro Asn Asn Ile Val Phe

625 630 635 640

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

645 650 655

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

660 665 670

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

675 680 685

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

690 695 700

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

705 710 715 720

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

725 730 735

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

740 745 750

Val Pro Pro Ser Gly Phe Ile Lys Asn Ile Val Glu Asn Gly Ser Ile

755 760 765

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

770 775 780

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

785 790 795 800

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

805 810 815

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

820 825 830

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

835 840 845

Asn Leu Glu Asp Tyr Gln Thr Ile Thr Lys Arg Phe Thr Thr Gly Thr

850 855 860

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

865 870 875 880

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

885 890 895

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

900 905 910

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

915 920 925

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

930 935 940

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

945 950 955 960

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

965 970 975

Ser Glu Ile Phe Thr Thr Lys Leu Gly Lys Asp Asn Phe Tyr Ile Glu

980 985 990

Leu Ser Gln Gly Asn Asn Leu Asn Gly Gly Pro Ile Val Lys Phe Tyr

995 1000 1005

Asp Val Ser Ile Lys

1010

<210>3

<211>3036

<212>DNA

<213>unknown

<220>

<223> Artificial sequence

<400>3

atgggcagga gctggggcgt ggtggccgtg atggtgctgt gcgccagcgg cctgctgggc 60

atcgtgaggg gccacggcag catggaggac ccgatcagca gggtgtacag gtgcaggctg 120

gagaacccgg agaggccgac cagcccggcc tgccaggctg ccgtggccct gagcggcacc 180

caggccttct acgactggaa cgaggtgaac atcccgaacg ctgccggcag gcacagggag 240

ctgatcccgg acggccagct gtgcagcgcc ggcaggttca agttcagggg cctggacctg 300

gccaggagcg actggatcgc caccccgctg ccgagcggag ccagcagctt cccgttcagg 360

tacatcgcca ccgccgccca cctgggcttc ttcgagttct acgtgaccag ggagggctac 420

cagccgaccg tgccgctgaa gtgggccgac ctggaggagc tgccgttcat caacgtgacc 480

aaccctccgc tggtgagcgg cagctaccag atcaccggca ccaccccgag cggcaagagc 540

ggcagccacc tgatctacgt gatctggcag aggaccgaca gcccggaggc cttctacagc 600

tgcagcgacg tgtacttcac cgacgccctg agcctgcaca gcaccacccg aggccccggg 660

aagggtggag gaatgaacaa gaacaacagt aagctctcca cccgcgccct cccgtccttc 720

atcgactact tcaacggcat ctacggcttc gccaccggca tcaaggacat catgaacatg 780

atcttcaaga ccgacaccgg cggcaacgtc accctcgacg agatcctcaa gaaccagcag 840

ctcctcaacg agatcagcgg caagctcgac ggcgtgaacg gctccctcaa cgagctgatc 900

gcccaggtca acctcaacac cgagctgtcc aaggagatcc tcaagatctc caacgagcag 960

aaccaggtgc tcaacgacgt gaacaacaag ctggacgcca tcaacaccat gctgcacatc 1020

tacctcccga agatcacctc catgctctcc gacgtgatga agcagaacta cgccctctcc 1080

ctccagatcg agtacctctc caagcagctc caggagatca gcgacaagct cgacatcatc 1140

aacgtgaacg tgctcatcaa ctccaccctc accgagatca ccccggccta ccagcgcatc 1200

aagtacgtga acgagaagtt cgaggagctg accttcgcca ccgagaccac cctcaaggtg 1260

aagaaggact cctccccggc cgacatcctc gacgagctga ccgagctgac cgagctggcc 1320

aagtccgtga ccaagaacga cgtggacggc ttcgagttct acctcaacac cttgcacgac 1380

gtgatggtgg gcaacaacct cttcggccgc tccgccctca agaccgcctc cgagctgatc 1440

gccaaggaga acgtgaagac ctccggctcc gaggtgggca acgtgtacaa cttcctcatc 1500

gtgctcaccg ccctgcaggc caaggccttc ctcaccctca ccacctgccg caagctcctc 1560

ggcctcgccg gcatcgacta cacctccatc atgaacgagc acctcaacaa ggagaaggag 1620

gagttccgcg tgaacatcct cccgaccctc tccaacacct tctccaaccc gaactacgcc 1680

aaggtgaagg gctccgacga ggacgccaag atgatcgtgg aggccaagcc gggccacgcc 1740

ctcgtgggct tcgagatgtc caacgactcc atcaccgtgc tcaaggtgta cgaggccaag 1800

ctcaagcaga actaccaggt ggacaaggac tccctctccg aggtgatcta cggcgacacc 1860

gacaagctct tctgcccgga ccagtccgag cagatatact acaccaacaa catcgtgttc 1920

ccgaacgagt acgtgatcac caagatcgac ttcaccaaga agatgaagac cctccgctac 1980

gaggtgaccg ccaacttcta cgactcctcc accggcgaga tcgacctcaa caagaagaag 2040

gtggagtcct ccgaggccga gtaccgcacc ctctccgcca acgacgacgg cgtgtacatg 2100

ccgctcggcg tgatctccga aaccttcctc accccgatca acggcttcgg cctccaggcc 2160

gacgagaact cccgcctcat caccctcacc tgcaagtcct acctccgcga gctgctcctc 2220

gccaccgacc tctccaacaa ggagaccaag ctcatcgtgc cgccgtccgg cttcatctcc 2280

aacatcgtgg agaacggcgg catcgaggag gacaacctcg agccgtggaa ggccaacaac 2340

aagaacgcct acgtggacca caccggcggc gtgaacggca ccaaggccct ctacgtgcac 2400

aaggacggcg gcttctccca gttcatcggc gacaagctca agccgaagac cgagtacgtg 2460

atccagtaca ccgtgaaggg caaggccagc atctacctga aggacgagaa gaacaacgag 2520

ggcatctacg aggagatcaa caacgacctg gaggacttcc agaccgtgac caagaggttc 2580

atcaccggca ccgacagcag cggcgtgcac ctgatcttca ccagccagaa cggcgacgag 2640

gccttcggcg gcaacttcat catcagcgag atcaggagca gcgaggagct gctgagcccg 2700

gagctgatca agagcgacgc ctgggtgggc agccagggca cctggatcag cggcaacagc 2760

ctgaccatca acagcaacgc caacggcacc ttcaggcaga acctgccgct ggagagctac 2820

agcacctaca gcatgaactt caacgtgaac ggcttcgcca aggtgaccgt gaggaacagc 2880

agggaggtgc tgttcgagaa gaacttcagc cagctgagcc cgaaggacta cagcgagaag 2940

ttcaccaccg ccgccaacaa caccggcttc tacgtggagc tgagcagggg cacccagggc 3000

ggcaacatca ccttcaggga cttcagcatc aagtag 3036

<210>4

<211>1011

<212>PRT

<213>unknown

<220>

<223> Artificial sequence

<400>4

Met Gly Arg Ser Trp Gly Val Val Ala Val Met Val Leu Cys Ala Ser

1 5 10 15

Gly Leu Leu Gly Ile Val Arg Gly His Gly Ser Met Glu Asp Pro Ile

20 25 30

Ser Arg Val Tyr Arg Cys Arg Leu Glu Asn Pro Glu Arg Pro Thr Ser

35 40 45

Pro Ala Cys Gln Ala Ala Val Ala Leu Ser Gly Thr Gln Ala Phe Tyr

50 55 60

Asp Trp Asn Glu Val Asn Ile Pro Asn Ala Ala Gly Arg His Arg Glu

65 70 75 80

Leu Ile Pro Asp Gly Gln Leu Cys Ser Ala Gly Arg Phe Lys Phe Arg

85 90 95

Gly Leu Asp Leu Ala Arg Ser Asp Trp Ile Ala Thr Pro Leu Pro Ser

100 105 110

Gly Ala Ser Ser Phe Pro Phe Arg Tyr Ile Ala Thr Ala Ala His Leu

115 120 125

Gly Phe Phe Glu Phe Tyr Val Thr Arg Glu Gly Tyr Gln Pro Thr Val

130 135 140

Pro Leu Lys Trp Ala Asp Leu Glu Glu Leu Pro Phe Ile Asn Val Thr

145 150 155 160

Asn Pro Pro Leu Val Ser Gly Ser Tyr Gln Ile Thr Gly Thr Thr Pro

165 170 175

Ser Gly Lys Ser Gly Ser His Leu Ile Tyr Val Ile Trp Gln Arg Thr

180 185 190

Asp Ser Pro Glu Ala Phe Tyr Ser Cys Ser Asp Val Tyr Phe Thr Asp

195 200 205

Ala Leu Ser Leu His Ser Thr Thr Arg Gly Pro Gly Lys Gly Gly Gly

210 215 220

Met Asn Lys Asn Asn Ser Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

225 230 235 240

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

245 250 255

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asn Val Thr Leu

260 265 270

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Glu Ile Ser Gly Lys

275 280 285

Leu Asp Gly Val Asn Gly Ser Leu Asn Glu Leu Ile Ala Gln Val Asn

290 295 300

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ser Asn Glu Gln

305 310 315 320

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

325 330 335

Met Leu His Ile Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

340 345 350

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

355 360 365

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

370 375 380

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

385 390 395 400

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

405 410 415

Thr Leu Lys Val Lys Lys Asp Ser Ser Pro Ala Asp Ile Leu Asp Glu

420 425 430

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

435 440 445

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Leu His Asp Val Met Val Gly

450 455 460

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

465 470 475 480

Ala Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

485 490 495

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Lys Ala Phe Leu Thr

500 505 510

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Gly Ile Asp Tyr Thr

515 520 525

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

530 535 540

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

545 550 555 560

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

565 570 575

Pro Gly His Ala Leu Val Gly Phe Glu Met Ser Asn Asp Ser Ile Thr

580 585 590

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

595 600 605

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Thr Asp Lys Leu Phe

610 615 620

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

625 630 635 640

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

645 650 655

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

660 665 670

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

675 680 685

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

690 695 700

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

705 710 715 720

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

725 730 735

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

740 745 750

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Gly Ile

755 760 765

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

770 775 780

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

785 790 795 800

Lys Asp Gly Gly Phe Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

805 810 815

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Ala Ser Ile Tyr

820 825 830

Leu Lys Asp Glu Lys Asn Asn Glu Gly Ile Tyr Glu Glu Ile Asn Asn

835 840 845

Asp Leu Glu Asp Phe Gln Thr Val Thr Lys Arg Phe Ile Thr Gly Thr

850 855 860

Asp Ser Ser Gly Val His Leu Ile Phe Thr Ser Gln Asn Gly Asp Glu

865 870 875 880

Ala Phe Gly Gly Asn Phe Ile Ile Ser Glu Ile Arg Ser Ser Glu Glu

885 890 895

Leu Leu Ser Pro Glu Leu Ile Lys Ser Asp Ala Trp Val Gly Ser Gln

900 905 910

Gly Thr Trp Ile Ser Gly Asn Ser Leu Thr Ile Asn Ser Asn Ala Asn

915 920 925

Gly Thr Phe Arg Gln Asn Leu Pro Leu Glu Ser Tyr Ser Thr Tyr Ser

930 935 940

Met Asn Phe Asn Val Asn Gly Phe Ala Lys Val Thr Val Arg Asn Ser

945 950 955 960

Arg Glu Val Leu Phe Glu Lys Asn Phe Ser Gln Leu Ser Pro Lys Asp

965 970 975

Tyr Ser Glu Lys Phe Thr Thr Ala Ala Asn Asn Thr Gly Phe Tyr Val

980 985 990

Glu Leu Ser Arg Gly Thr Gln Gly Gly Asn Ile Thr Phe Arg Asp Phe

995 1000 1005

Ser Ile Lys

1010

<210>5

<211>652

<212>DNA

<213>unknown

<220>

<223> Artificial sequence

<400>5

atgggcagga gctggggcgt ggtggccgtg atggtgctgt gcgccagcgg cctgctgggc 60

atcgtgaggg gccacggcag catggaggac ccgatcagca gggtgtacag gtgcaggctg 120

gagaacccgg agaggccgac cagcccggcc tgccaggctg ccgtggccct gagcggcacc 180

caggccttct acgactggaa cgaggtgaac atcccgaacg ctgccggcag gcacagggag 240

ctgatcccgg acggccagct gtgcagcgcc ggcaggttca agttcagggg cctggacctg 300

gccaggagcg actggatcgc caccccgctg ccgagcggag ccagcagctt cccgttcagg 360

tacatcgcca ccgccgccca cctgggcttc ttcgagttct acgtgaccag ggagggctac 420

cagccgaccg tgccgctgaa gtgggccgac ctggaggagc tgccgttcat caacgtgacc 480

aaccctccgc tggtgagcgg cagctaccag atcaccggca ccaccccgag cggcaagagc 540

ggcagccacc tgatctacgt gatctggcag aggaccgaca gcccggaggc cttctacagc 600

tgcagcgacg tgtacttcac cgacgccctg agcctgcaca gcaccaccta ac 652

<210>6

<211>2364

<212>DNA

<213>unknown

<220>

<223> Artificial sequence

<400>6

atgaacaaga acaacagtaa gctctccacc cgcgccctcc cgtccttcat cgactacttc 60

aacggcatct acggcttcgc caccggcatc aaggacatca tgaacatgat cttcaagacc 120

gacaccggcg gcaacgtcac cctcgacgag atcctcaaga accagcagct cctcaacgag 180

atcagcggca agctcgacgg cgtgaacggc tccctcaacg agctgatcgc ccaggtcaac 240

ctcaacaccg agctgtccaa ggagatcctc aagatctcca acgagcagaa ccaggtgctc 300

aacgacgtga acaacaagct ggacgccatc aacaccatgc tgcacatcta cctcccgaag 360

atcacctcca tgctctccga cgtgatgaag cagaactacg ccctctccct ccagatcgag 420

tacctctcca agcagctcca ggagatcagc gacaagctcg acatcatcaa cgtgaacgtg 480

ctcatcaact ccaccctcac cgagatcacc ccggcctacc agcgcatcaa gtacgtgaac 540

gagaagttcg aggagctgac cttcgccacc gagaccaccc tcaaggtgaa gaaggactcc 600

tccccggccg acatcctcga cgagctgacc gagctgaccg agctggccaa gtccgtgacc 660

aagaacgacg tggacggctt cgagttctac ctcaacacct tgcacgacgt gatggtgggc 720

aacaacctct tcggccgctc cgccctcaag accgcctccg agctgatcgc caaggagaac 780

gtgaagacct ccggctccga ggtgggcaac gtgtacaact tcctcatcgt gctcaccgcc 840

ctgcaggcca aggccttcct caccctcacc acctgccgca agctcctcgg cctcgccggc 900

atcgactaca cctccatcat gaacgagcac ctcaacaagg agaaggagga gttccgcgtg 960

aacatcctcc cgaccctctc caacaccttc tccaacccga actacgccaa ggtgaagggc 1020

tccgacgagg acgccaagat gatcgtggag gccaagccgg gccacgccct cgtgggcttc 1080

gagatgtcca acgactccat caccgtgctc aaggtgtacg aggccaagct caagcagaac 1140

taccaggtgg acaaggactc cctctccgag gtgatctacg gcgacaccga caagctcttc 1200

tgcccggacc agtccgagca gatatactac accaacaaca tcgtgttccc gaacgagtac 1260

gtgatcacca agatcgactt caccaagaag atgaagaccc tccgctacga ggtgaccgcc 1320

aacttctacg actcctccac cggcgagatc gacctcaaca agaagaaggt ggagtcctcc 1380

gaggccgagt accgcaccct ctccgccaac gacgacggcg tgtacatgcc gctcggcgtg 1440

atctccgaaa ccttcctcac cccgatcaac ggcttcggcc tccaggccga cgagaactcc 1500

cgcctcatca ccctcacctg caagtcctac ctccgcgagc tgctcctcgc caccgacctc 1560

tccaacaagg agaccaagct catcgtgccg ccgtccggct tcatctccaa catcgtggag 1620

aacggcggca tcgaggagga caacctcgag ccgtggaagg ccaacaacaa gaacgcctac 1680

gtggaccaca ccggcggcgt gaacggcacc aaggccctct acgtgcacaa ggacggcggc 1740

ttctcccagt tcatcggcga caagctcaag ccgaagaccg agtacgtgat ccagtacacc 1800

gtgaagggca aggccagcat ctacctgaag gacgagaaga acaacgaggg catctacgag 1860

gagatcaaca acgacctgga ggacttccag accgtgacca agaggttcat caccggcacc 1920

gacagcagcg gcgtgcacct gatcttcacc agccagaacg gcgacgaggc cttcggcggc 1980

aacttcatca tcagcgagat caggagcagc gaggagctgc tgagcccgga gctgatcaag 2040

agcgacgcct gggtgggcag ccagggcacc tggatcagcg gcaacagcct gaccatcaac 2100

agcaacgcca acggcacctt caggcagaac ctgccgctgg agagctacag cacctacagc 2160

atgaacttca acgtgaacgg cttcgccaag gtgaccgtga ggaacagcag ggaggtgctg 2220

ttcgagaaga acttcagcca gctgagcccg aaggactaca gcgagaagtt caccaccgcc 2280

gccaacaaca ccggcttcta cgtggagctg agcaggggca cccagggcgg caacatcacc 2340

ttcagggact tcagcatcaa gtaa 2364

<210>7

<211>1848

<212>DNA

<213>unknown

<220>

<223> Artificial sequence

<400>7

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacaa acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactag 1848

<210>8

<211>208

<212>DNA

<213>unknown

<220>

<223> Artificial sequence

<400>8

gagctctaga tgggccctgt tctgcacaaa gtggagtagt cagtcatcga tcaggaacca 60

gacaccagac ttttattcat acagtgaagt gaagtgaagt gcagtgcagt gagttgctgg 120

tttttgtaca acttagtatg tatttgtatt tgtaaaatac ttctatcaat aaaatttcta 180

attcctaaaa ccaaaatcca ggggtacc 208

<210>9

<211>792

<212>DNA

<213>unknown

<220>

<223> Artificial sequence

<400>9

ggtacctggt ggagcacgac actctcgtct actccaagaa tatcaaagat acagtctcag 60

aagaccaaag ggctattgag acttttcaac aaagggtaat atcgggaaac ctcctcggat 120

tccattgccc agctatctgt cacttcatca aaaggacagt agaaaaggaa ggtggcacct 180

acaaatgcca tcattgcgat aaaggaaagg ctatcgttca agatgcctct gccgacagtg 240

gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 300

cgtcttcaaa gcaagtggat tgatgtgata acatggtgga gcacgacact ctcgtctact 360

ccaagaatat caaagataca gtctcagaag accaaagggc tattgagact tttcaacaaa 420

gggtaatatc gggaaacctc ctcggattcc attgcccagc tatctgtcac ttcatcaaaa 480

ggacagtaga aaaggaaggt ggcacctaca aatgccatca ttgcgataaa ggaaaggcta 540

tcgttcaaga tgcctctgcc gacagtggtc ccaaagatgg acccccaccc acgaggagca 600

tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgatatct 660

ccactgacgt aagggatgac gcacaatccc actatccttc gcaagacctt cctctatata 720

aggaagttca tttcatttgg agaggacacg ctgaaatcac cagtctctct ctacaaatct 780

atctctggat cc 792

Claims (7)

1. An insect-resistant fusion gene is characterized in that the gene is formed by connecting a nucleotide sequence coding chitin binding protein and a nucleotide sequence coding Vip3 toxin from 5 'to 3'; and the 2 nucleotide sequences are positioned in the same open reading frame; the chitin binding protein is Tma12, and the Vip3 toxin is Vip3A, Vip3B, Vip3C, Vip3D or Vip 3H.

2. The insect-resistant fusion gene according to claim 1, wherein said Vip3 toxin is Vip3A or Vip 3H.

3. The insect-resistant fusion gene of claim 1, wherein the nucleotide sequence of the insect-resistant fusion gene is SEQ ID NO: 1 or SEQ ID NO: 3, respectively.

4. A fusion protein encoded by the insect-resistant fusion gene of claim 1.

5. The fusion protein of claim 4, wherein the amino acid sequence of the fusion protein is SEQ ID NO: 2 or SEQ ID NO: 4, respectively.

6. Use of the fusion protein of claim 4 in the preparation of a transgenic insect-resistant crop, a transgenic insecticidal microorganism, or an antibody.

7. The use according to claim 6, wherein the transgenic pest-resistant crop is transformed with a fusion protein in combination with BT crystal toxin.

Images