CN106834318A

CN106834318A - A kind of insect-resistant fusion gene, encoding proteins and its application

Info

Publication number: CN106834318A
Application number: CN201611267539.9A
Authority: CN
Inventors: 张先文; 王东芳; 沈志成
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2016-12-31
Filing date: 2016-12-31
Publication date: 2017-06-13
Anticipated expiration: 2036-12-31
Also published as: CN106834318B

Abstract

The invention discloses a kind of insect-resistant fusion gene, encoding proteins and its application, described gene includes the nucleotide sequence from 5 ' 3 ' nucleotide sequences successively containing coding chitin-binding protein and coding Vip3 toxin；And above-mentioned 2 nucleotide sequences are located at same open reading inframe.One chitin-binding protein of use and a Vip3 toxin fusion designed by the present invention into artificial proteins molecule, compared with original chitin-binding protein and Vip3 albumen, have the following advantages that：Insecticidal spectrum is wide, can simultaneously prevent and treat various important pests (such as beet armyworm, mythimna separata, aleyrodid) in Lepidoptera and Semiptera, and insecticide efficiency is up to 50% 100%；Be conducive to albumen and other insect resistance proteins (such as ICPs) with above-mentioned difference in functionality to be used in combination, further expand insecticidal spectrum, delay pest resistance to produce.

Description

A kind of insect-resistant fusion gene, encoding proteins and its application

(1) technical field

The present invention relates to the fusion protein that a kind of insect-resistant fusion gene, the insect-resistant fusion gene are encoded, and above-mentioned fusion egg White application.

(2) background technology

Insect brings huge loss to Global Agriculture production, and current control of insect relies primarily on chemical pesticide, but agriculture The use of medicine has aggravated production cost, and residues of pesticides bring serious harm to health.Therefore, using genetic engineering side Method pest control has great economy, environment and social value.

The key for obtaining insect-resistant transgenic crops is clone's excellent pesticidal protein.Insect-killing protein has a lot, uses Most commonly used is bacillus thuringiensis (Bacillus thuringiensis, abbreviation Bt) secreted one kind during born of the same parents are produced Insecticidal crystal proteins (insecticidalcrystal proteins, ICP), such as Cry1Ab, Cry1C etc., these albumen are to squama The insects such as wing mesh, Diptera, coleoptera (such as diamondback moth, corn borer) have very strong lethal effect (Schnepf, E., Crickmore,N.,Van,R.J.,Lereclus,D.,Baum,J.,&Feitelson,J.,et al.1998,62(3),775- 806.), furtherd investigate and widely used at present, the trans Bt gene crops such as corn and soybean, potato, cotton are advised greatly Mould commercial growth.Thuringiensis can secrete a kind of and ICPs without amino acid sequence homologous during nutrient growth, also The entirely different albumen of property, insecticidal mechanism, i.e. Vegetative Insecticidal Proteins (vegetative insecticidal proteins, VIPs), such as Vip3A, Vip3B, Vip3C, Vip3D, Vip3H, to some, the insect insensitive to ICPs also has insecticidal activity, and And will not occur cross tolerance (Estruch, J.J., Warren, G.W., Mullins, M.A., Nye, G.J., Craig, J.A.,&Koziel,M.G.1996,Proceedings of the National Academy of Sciences of the United States of America,93(11),5389-94.)。

Vip3 albumen as a kind of new insecticidal proteins, to current the most widely used ICP albumen from insecticidal mechanism, Insecticidal spectrum is to being all a supplement well in insecticidal activity.Such as, ICPs is very weak to the lethal effect of prodenia litura and mythimna separata, Vip3 then has extraordinary prevention effect to prodenia litura and mythimna separata.Even so, in the practical operation of genetically modified crops research and development In, however it remains some are badly in need of the technical matters for solving.For example, researcher has found the plant of the single Vip3 genes of expression high Strain growth fraction is slower, albinism easily occurs.This be probably due in genetically modified plants directly expression Vip3 albumen after, should Albumen is assembled because the secretion of signal peptide is a large amount of and combines on plant cell membrane and form duct, so as to be caused to cell Damage, influence it to grow.

Hemipteran pest (such as aleyrodid, plant hopper) by suck phloem sap cause plant withered, fallen leaves, hypoevolutism, The underproduction is even had no harvest, and very big harm is caused to the grains such as paddy rice, cotton and industrial crops.Bt anti insect genes are to Lepidoptera, sheath The insects such as wing mesh have good lethal effect.But, prevent very well there is presently no finding that any Bt albumen has to Hemipteran pest Control effect.Recently, there is scientist that a kind of egg to Hemipteran pest with good preventive and therapeutic effect is found that from pteridophyte White Tma12, the albumen be it is a kind of with chitinase activity chitin-binding protein (Shukla A K, Upadhyay S K, Mishra M,et al.2016,Nature Biotechnology。

First generation genetically modified crops mostly only with anti-lepidoptera pest characteristic, and second generation genetically modified crops to The complex character development of anti-various pests simultaneously.Obtaining the genetically modified crops with complex character has various methods, such as pass through Hybridization to the genetically modified crops with single traits；By by multiple gene expression frame constructions inside same expression cassette； By cotransformation, multiple is mixed containing monogenic Agrobacterium, carry out mixing conversion, filter out multiple genes simultaneously whole The transfer-gen plant of two or more plasmid T-DNA is closed.But the above method all also has one in practical operation and application A little problems.Therefore, it is to need to cut instantly to obtain the more simple efficient method for obtaining the genetically modified crops with complex character The real problem for solving.

(3) content of the invention

Cause same fusion protein simultaneously to Lepidoptera and half wing by Gene Fusion it is an object of the present invention to provide one kind The method that mesh has fragmentation effect.

The technical solution adopted by the present invention is：

The present invention provides a kind of insect-resistant fusion gene, and described gene includes coding chitin combination egg successively from 5 ' -3 ' White nucleotide sequence and the nucleotide sequence of coding Vip3 toxin；And above-mentioned 2 nucleotide sequences are read positioned at same opening In frame.

Further, preferably described gene from 5 ' -3 ' successively by the nucleotide sequence and volume of coding chitin-binding protein The nucleotide sequence connection composition of code Vip3 toxin.

Further, the chitin-binding protein be Tma12, the Vip3 toxin be Vip3A, Vip3B, Vip3C, Vip3D or Vip3H.

Further, the Vip3 toxin is Vip3A or Vip3H.

Further, the nucleotides sequence of the insect-resistant fusion gene is classified as SEQ ID NO：1 (chitin-binding protein is Tma12, Vip toxin are Vip3A) or SEQ ID NO：(chitin-binding protein is Tma12, and Vip toxin is Vip3H) shown in 2.

The present invention also provides a kind of fusion protein of insect-resistant fusion gene coding, the fusion protein from N-terminal to C-terminal according to It is secondary for chitin-binding protein and Vip3 toxin.

Further, the amino acid sequence of the fusion protein is SEQ ID NO：3 (chitin-binding protein is Tma12, Vip3 toxin is Vip3A) or SEQ ID NO：Shown in 4 (chitin-binding protein is Tma12, and Vip toxin is Vip3H).

The present invention also provide a kind of described fusion protein prepare transgenosis anti-pest crop, transgenic insecticidal microorganism or Application in the antibody of the fusion protein.

Further, the insect-resistant transgenic crops are prepared from by fusion protein joint BT crystal toxin conversions.

Compared with prior art, beneficial effect of the present invention is mainly reflected in：One chitin knot of use designed by the present invention Hop protein and a Vip3 toxin fusion into artificial proteins molecule, with original chitin-binding protein and Vip3 albumen phases Than having the following advantages that：Insecticidal spectrum is wide, can simultaneously prevent and treat (such as beet armyworm, viscous of various important pests in Lepidoptera and Semiptera Worm, aleyrodid), insecticide efficiency is up to 50%-100%；Be conducive to albumen and other insect resistance proteins with above-mentioned difference in functionality (such as ICPs) it is used in combination, further expands insecticidal spectrum, delays pest resistance to produce.

(4) illustrate

Fig. 1 is the structure chart of fusion insecticidal proteins of the invention.N-terminal is chitin-binding protein in fusion protein, and C-terminal is Vip3 toxin.

Fig. 2 is T-DNA structure charts desinsection antigen-4 fusion protein gene imported in plant in the present invention.PUBI is maize ubiquitin Promoter, antigen-4 fusion protein gene is chitin-binding protein-Vip3 toxin fusion genes.

Fig. 3 is T-DNA structure charts desinsection fusion protein and ICPs joints imported in plant in the present invention.PUBI is jade Rice ubiquitin promoter, antigen-4 fusion protein gene is chitin-binding protein-Vip3 toxin fusion genes, and p35S is cauliflower mosaic Malicious 35S promoter, ICPs is insecticidal crystal proteins encoding gene.

(5) specific embodiment

With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in This：

The structure of embodiment 1, Tma12-Vip3A fusion protein expression vectors

The gene of Tma12 and Vip3A insecticidal proteins synthesizes by Shanghai life work, and its DNA sequence dna is respectively SEQ ID NO：5 With the SEQ ID NO in Chinese patent 200610049611.0：7, and it is cloned in the restriction enzyme of pET28a expression vectors Between BamHI and SacI sites.The carrier for building is respectively designated as pET28a-Tma12 and pET28a-Vip3A.

Tma12-Vip3A synthesis is comprised the following steps that：

1st, with Vip3A (the SEQ ID NO in Chinese patent 200610049611.0：7) obtained by PCR as template Vip3A genetic fragments.

2nd, primer is：

Vip3A-F：5 ' CCCGGGAAGGGTGGAGGAATGAACAAGAACAACACCAAG and Vip3A-R：5’ CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTCACGA.The two primers include restriction endonuclease sites respectively The site of XmalI and ScaI.

3rd, PCR primer is processed with XmalI and ScaI, and is connected with the pET28a-Tma12 carriers crossed with identical ferment treatment Connect.

4th, Escherichia coli are transferred to, acquisition plasmid is pET28a-Tma12-Vip3A.Antigen-4 fusion protein gene Tma12-Vip3A (SEQ ID NO：1) it has been cloned into pET28a expression vectors, the fusion protein Tma12-Vip3A of antigen-4 fusion protein gene coding (SEQ ID NO：2) molecular weight is about 116kD.

The structure of embodiment 2, Tma12-Vip3H fusion protein expression vectors

The gene of Tma12 and Vip3H insecticidal proteins synthesizes by Shanghai life work, and its DNA sequence dna is respectively SEQ ID NO：5 With SEQ ID NO：6, and be cloned between the restriction enzyme BamHI and SacI sites of pET28a expression vectors.Build Carrier be respectively designated as pET28a-Tma12 and pET28a-Vip3H.

Tma12-Vip3H synthesis is comprised the following steps that：

1st, with Vip3H (SEQ ID NO：6) Vip3H genetic fragments are obtained by PCR as template.Primer is：Vip3H- F：5 ' CCCGGGAAGGGTGGAGGAATGAACAAGAACAACAGTAAG and Vip3H-R：5’ CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGGTGATGT.The two primers include restriction endonuclease sites respectively The site of XmalI and ScaI.

2nd, PCR primer is processed with XmalI and ScaI, and is connected with the pET28a-Tma12 carriers crossed with identical ferment treatment Connect.

3rd, Escherichia coli are transferred to, acquisition plasmid is pET28a-Tma12-Vip3H.Antigen-4 fusion protein gene Tma12-Vip3H (SEQ ID NO：3) it has been cloned into pET28a expression vectors, the fusion protein Tma12-Vip3H of antigen-4 fusion protein gene coding (SEQ ID NO：4) molecular weight is about 112kD.

The expression of embodiment 3, insecticidal proteins

Universal standard method is by above-mentioned expression vector (pET28a-Tma12-Vip3A, pET28a- containing antigen-4 fusion protein gene Tma12-Vip3H, pET28a-Tma12, pET28a-Vip3A and pET28a-Vip3H) e. coli bl21 star is transferred to respectively. Picking monoclonal colony inoculation in 100ml LB inoculums, 37 DEG C of vibrations cultures to OD₆₀₀=0.6, add IPTG to arrive 0.5mM, continues to cultivate 4 hours under the same conditions.Collect nutrient solution 5000g and 10 minutes precipitation Bacillus coli cells are centrifuged, so After abandon supernatant collect precipitation.Add 30 milliliters of 20mMTris-HCL buffer solutions in precipitation, insecticidal activity is can be used for after Ultrasonic Pulverization Measure.

Embodiment 4, Tma12-Vip3A and Tma12-Vip3H have lethal effect to many Lepidopterous and Hemipteran pest

The insecticidal proteins (Tma12-Vip3A, Tma12-Vip3H, Tma12, Vip3A and Vip3H) that embodiment 3 is obtained point The surface of insect artificial diet is not coated in, and newborn first-instar young is used for carrying out pesticidal measure.Negative control is pET28a unloaded Body, preparation method is same as Example 3.Insecticidal activity result is as shown in table 1：

The insecticide efficiency of table 1, fusion protein

	Mythimna separata	Beet armyworm	Bemisia tabaci
				Tma12	0%	0%	100%
Vip3A	100%	100%	0%
				Vip3H	100%	100%	0%
Tma12-Vip3A	100%	100%	100%
				Tma12-Vip3H	100%	100%	100%
Negative control	0%	0%	0%

Embodiment 5, Tma12-Vip3A plant conversion carriers build

With Tma12-Vip3A (SEQ ID NO：1) Tma12-Vip3A genetic fragments are obtained by PCR as template.Primer For：TVA-F：5 ' AGGATCCAACAATGGGCAGGAGCTGGGGCGT and TVA-R：5’ CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTC.The two primers respectively comprising restriction endonuclease sites BamH1 and The site of ScaI.Artificial synthesized terminator sequence ter (SEQ ID NO：8), 5 ' ends and 3 ' ends are respectively arranged with ScaI and KpnI Site.With the Tma12-Vip3A after BamH1 and ScaI digestions and with the terminator after ScaI and KpnI digestions be connected into through In the pCambia1300 carriers of BamH1 and KpnI digestions, pCambia1300-Tma12-Vip3A-ter is obtained.

PUBI is maize ubiquitin protein promoter, is obtained by PCR.With the genomic DNA of commercial corn kind Zheng Dan 958 It is template, is expanded by PCR and obtain pUBI.PCR reaction conditions are：95 DEG C 3 minutes；95 DEG C 15 seconds, 68 DEG C 15 seconds, 72 DEG C 2 points Clock, repeats 32 circulations；Then 72 DEG C 10 minutes.The PCR primer of the about 2.0Kb for obtaining is cloned into T- carriers pMD19. Sequence is obtained correctly to clone for following experiment.PCR primer is pUBI-F (5 ' ) and pUBI-R (5 ' GAAGCTTGCATGCCTACAGTGCAGCGTGACCC GGGTGGATCCTCTAGAGTCGACCTGCAGAAGTAAC), HindIII and BamHI restriction enzymes are respectively provided with primer Enzyme restriction enzyme site.

With HindIII and BamHI digestion pUBI, the fragment after digestion is connected into the pCambia1300- with identical digestion In Tma12-Vip3A-ter carriers, whole carrier is obtained.This carrier is named as：pCambia1300-pUBI-Tma12-Vip3A.

Finally, the method for being turned by electricity is transferred to above-mentioned T-DNA plasmids in Agrobacterium LBA4404, by containing 15 μ g/ml The YEP solid mediums of the kanamycins of tetracycline and 50 μ g/mL filter out positive colony, and protect bacterium, for ensuing plant Thing is converted.

Embodiment 6, Tma12-Vip3H plant conversion carriers build

With Tma12-Vip3H (SEQ ID NO：2) enter PCR as template and obtain Tma12-Vip3H genetic fragments.Primer For：TVH-F：5 ' GGATCCAACAATGGGCAGGAGCTGGGGCGT and TVH-R：5’ CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGG.The two primers respectively comprising restriction endonuclease sites BamH1 and The site of ScaI.Artificial synthesized terminator sequence ter (SEQ ID NO：8), 5 ' ends and 3 ' ends are respectively arranged with ScaI and KpnI Site.With the Tma12-Vip3H after BamH1 and ScaI digestions and with the terminator after ScaI and KpnI digestions be connected into through In the pCambia1300 carriers of BamH1 and KpnI digestions, pCambia1300-Tma12-Vip3H-ter is obtained.

PUBI is the preparation method of maize ubiquitin protein promoter with embodiment 5.

With HindIII and BamHI digestion pUBI, the fragment after digestion is connected into the pCambia1300- with identical digestion In Tma12-Vip3H-ter carriers, whole carrier is obtained.This carrier is named as：pCambia1300-pUBI-Tma12-Vip3H.

Embodiment 7, Tma12-Vip3A and ICPs protein plants conversion carrier build

With Cry1Ab (SEQ ID NO：7) gene of insecticidal proteins is synthesized by Shanghai life work, and 5 ' ends and 3 ' ends are respectively provided with There are BamH1 and ScaI sites.Artificial synthesized terminator sequence ter (SEQ ID NO：8), 5 ' end and 3 ' end be respectively provided with ScaI and EcoRI sites.With the Cry1Ab after BamHI and ScaI digestions and with the terminator after ScaI and EcoRI digestions be connected into through In the pCambia1300 carriers of BamH1 and EcoRI digestions, pCambia1300-Cry1Ab-ter is obtained.

P35S promoters are cauliflower mosaic virus CaMV 35S promoters, are synthesized by Shanghai life work, sequence such as SEQ ID NO：9,5 ' ends and 3 ' ends are respectively arranged with KpnI and BamHI sites.

With BamH1 and EcoRI digestion pCambia1300-Cry1Ab-ter, with KpnI and BamHI digestion p35S, above-mentioned Two fragments and through KpnI and EcoRI digestions carrier pCambia1300-Tma12-Vip3A-ter carry out three sections connection, obtain Whole carrier.This carrier is named as：pCambia1300-pUBI-Tma12-Vip3A-p35S-Cry1Ab.

Embodiment 8, Tma12-Vip3H genes and BT crystal toxins gene (ICPs albumen) plant conversion carrier build

With BamH1 and EcoRI digestion pCambia1300-Cry1Ab-ter, with KpnI and BamHI digestion p35S, above-mentioned Two fragments and through KpnI and EcoRI digestions carrier pCambia1300-Tma12-Vip3H-ter carry out three sections connection, obtain Whole carrier.This carrier is named as：pCambia1300-pUBI-Tma12-Vip3H-p35S-Cry1Ab.

Embodiment 9, transgenic paddy rice

The preparation method of transgenic paddy rice is using prior art (Lu Xiongbin, Gong ancestral an ancient egg-shaped, holed wind instrument (1998) life science 10：125- 131；Liu Fan etc. (2003) Molecular Plant Breeding 1：108-115)." elegant water -134 " seed for choosing mature and plump shells, and induces Callus is produced as converting material.The carrier for being built in Example 5-8 respectively and pCambia1300 empty carrier Agrobacteriums Draw plate.Single bacterium colony inoculation is chosen, is prepared conversion and is used Agrobacterium.Callus to be transformed is put into the Agrobacterium that OD is 0.6 or so (the preparation of Agrobacterium bacterium solution in bacterium solution：By Agrobacterium inoculation to culture medium, culture to OD is 0.6 or so；Culture medium is constituted：3g/ L K₂HPO₄、1g/LNaH₂PO₄、1g/LNH₄Cl、0.3g/L MgSO₄·7H₂O、0.15g/L KCl、0.01g/L CaCl₂、 0.0025g/L FeSO₄·7H₂O, 5g/L sucrose, 20mg/L acetosyringones, solvent are water, pH=5.8), allow Agrobacterium to combine To callus surface, callus is then transferred to co-cultivation base (MS+2mg/L 2,4-D+30g/L glucose+30g/L Sucrose+3g/L agar (sigma 7921)+20mg/L acetosyringones) in, co-culture 2-3 days.After being converted with aseptic water washing Callus, be transferred to screening and culturing medium (MS+2mg/L 2,4-D+30g/L sucrose+3g/L agar (sigma 7921)+20mg/L Acetosyringone+2mM glyphosates (Sigma)) on, screening and culturing two months (middle subculture is once).After screening, growth vigor Good callus is transferred to pre- differential medium (MS+0.1g/L inositol+5mg/L ABA+1mg/L NAA+5mg/L 6-BA+ 20g/L sorbierite+30g/L sucrose+2.5g/L gelrite) on cultivate 20 days or so, the callus that then pre- will have broken up Move on on differential medium, the daily differentiation of illumination in 14 hours germination.After 2-3 weeks, resistance regeneration plant is transferred to culture of rootage Strengthening seedling and rooting on base (the g/L gelrite of 1/2MS+0.2mg/L NAA+20g/L sucrose+2.5), finally washes away regeneration plant Agar is transplanted in greenhouse, and selection yield is high, seed is big or biomass is high etc. can improve the transgenic line of rice yield, training Educate new varieties.The transgenic paddy rice containing above-mentioned conversion carrier and the empty carrier for comprising only riddled basins EPSPS is obtained respectively Plant.

Embodiment 10, transgenic paddy rice can be with desinsection

During the T0 of transgenic rice plant prepared by the method for embodiment 9 is for plantlet of transplant to greenhouse, to transgenic paddy rice The insecticidal properties of plant and non-transgenic acceptor adjoining tree are compared analysis.We turn to 102 obtained The transgenic line (being named as TV3A) of pCambia1300-Tma12-Vip3A-ter carriers and 83 turn pCambia1300- The transgenic line (being named as TV3H) of Tma12-Vip3H-ter carriers carries out insect resistace measure, its insecticidal effect such as institute of table 2 Show：

Table 2：The rice leaf extracts of after planting 30 days are carried out with the insecticidal effect detection of different insects

Insect	Killing rate
		Mythimna separata	100%
Beet armyworm	100%
		Bemisia tabaci	100%

* note：Each experiment is at least provided with 3 repetitions.

137 transgenic lines for turning pCambia1300-Tma12-Vip3A-p35S-Cry1Ab carriers that we are obtained System (being named as TV3A1Ab) and 142 transgenic lines for turning pCambia1300-Tma12-Vip3H-p35S-Cry1Ab carriers (being named as TV3H1Ab) carries out insect resistace measure, and its insecticidal effect is as shown in table 3：

Table 3：The rice leaf extracts of after planting 30 days are carried out with the insecticidal effect detection of different insects

Insect	Killing rate
		Corn borer	100%
Bollworm	100%
		Mythimna separata	100%
Beet armyworm	100%
		Bemisia tabaci	100%

* note：Each experiment is at least provided with 3 repetitions.

Embodiment 11, genetically engineered soybean

The step of acquisition genetically engineered soybean used herein, comes from existing technology (Deng et al., 1998, Plant Physiology Communications 34:381-387；Ma et al.,2008,Scientia AgriculturaSinica 41:661-668；Zhou et al.,2001,Journal of Northeast Agricultural University 32:313-319).Healthy, full, ripe soybean is chosen, with 80% ethanol disinfection 2 Minute, then with sterile water wash, it is then placed within the drier full of chlorine (by the dense HCl reactions generations of 50mlNaClO and 2ml) 4-6 hour of middle sterilizing.Soybean after sterilizing is sowed in B5 medium in superclean bench, and 5 are cultivated under the conditions of 25 DEG C My god, with optical densities in 90-150 μm of ol photons/m²S levels.When cotyledon greening and top break in the seed coat, aseptic bean sprouts is with regard to president Go out.The bean sprouts for eliminating hypocotyl is cut into fifty and fifty percent in length so that two panels explant all has cotyledon and epicotyl. Cut at the node of cotyledon and epicotyl at explant about 7-8, you can as the destination organization for being infected.

The carrier for being built in Example 5-8 respectively and the Agrobacterium of pCambia1300 empty carriers are separately cultivated stand-by. Ready explant is co-cultured 30 minutes or so in being immersed in agrobacterium suspension.Then, the tissue that will be infected is unnecessary Cell suspending liquid is absorbed cleanly with blotting paper, is then transferred to 1/10B5 and is co-cultured in base, 25 DEG C of light cultures 3-5 days.

The plant tissue of co-cultivation is cleaned with B5 fluid nutrient mediums, to remove unnecessary Agrobacterium, is then placed into B5 and is consolidated Cultivated 5 days at 25 DEG C in body culture medium, treat that it germinates.Induce the embryonic tissue for occurring to be transferred to and contain 0.1-0.5mM glyphosates B5 screening and culturing mediums in, 25 DEG C of illumination cultivations 4 weeks, period changes a subculture every two weeks.The embryonic tissue for screening It is then transferred in solid medium, 25 DEG C of cultures treat that it grows up to seedling.Then, transfer-gen plant seedling is transferred to 1/2B5 cultures Rooting induction is carried out in base.Finally, planted in greenhouse after the cleaned removal agar of plantlet for growing up to.

Embodiment 12, genetically engineered soybean can be with desinsection

During the T0 of transgenic rice plant prepared by the method for embodiment 11 is for plantlet of transplant to greenhouse, to transgenic paddy rice The insecticidal properties of plant and non-transgenic acceptor adjoining tree are compared analysis.We turn to 76 obtained The transgenic line (being named as TV3A) of pCambia1300-Tma12-Vip3A-ter carriers and 68 turn pCambia1300- The transgenic line (being named as TV3H) of Tma12-Vip3H-ter carriers carries out insect resistace measure, its insecticidal effect effect such as table 4 It is shown：

Table 4：The soybean leaves extracts of after planting 24 days are carried out with the insecticidal effect detection of different insects

* note：Each experiment is at least provided with 3 repetitions.

62 transgenic lines for turning pCambia1300-Tma12-Vip3A-p35S-Cry1Ab carriers that we are obtained (being named as TV3A1Ab) and 77 transgenic line for turning pCambia1300-Tma12-Vip3H-p35S-Cry1Ab carriers (lives Entitled TV3H1Ab) insect resistace measure is carried out, its insecticidal effect is as shown in table 5：

Table 5：The soybean leaves extracts of after planting 24 days are carried out with the insecticidal effect detection of different insects

* note：Each experiment is at least provided with 3 repetitions.

Finally, in addition it is also necessary to it is noted that listed above is only specific embodiment of the invention.Obviously, the present invention is not limited In above example, there can also be many deformations.One of ordinary skill in the art can directly lead from present disclosure The all deformations for going out or associating, are considered as protection scope of the present invention.

SEQUENCE LISTING

<110>Zhejiang University

<120>A kind of insect-resistant fusion gene, encoding proteins and its application

<130>

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 3042

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 1

atgggcagga gctggggcgt ggtggccgtg atggtgctgt gcgccagcgg cctgctgggc 60

atcgtgaggg gccacggcag catggaggac ccgatcagca gggtgtacag gtgcaggctg 120

gagaacccgg agaggccgac cagcccggcc tgccaggctg ccgtggccct gagcggcacc 180

caggccttct acgactggaa cgaggtgaac atcccgaacg ctgccggcag gcacagggag 240

ctgatcccgg acggccagct gtgcagcgcc ggcaggttca agttcagggg cctggacctg 300

gccaggagcg actggatcgc caccccgctg ccgagcggag ccagcagctt cccgttcagg 360

tacatcgcca ccgccgccca cctgggcttc ttcgagttct acgtgaccag ggagggctac 420

cagccgaccg tgccgctgaa gtgggccgac ctggaggagc tgccgttcat caacgtgacc 480

aaccctccgc tggtgagcgg cagctaccag atcaccggca ccaccccgag cggcaagagc 540

ggcagccacc tgatctacgt gatctggcag aggaccgaca gcccggaggc cttctacagc 600

tgcagcgacg tgtacttcac cgacgccctg agcctgcaca gcaccacccg aggccccggg 660

aagggtggag gaatgaacaa gaacaacacc aagctgagca ccagggccct gccgagcttc 720

atcgactact tcaacggcat ctacggcttc gccaccggca tcaaggacat catgaacatg 780

atcttcaaga ccgacaccgg cggcgacctg accctggacg agatcctgaa gaaccagcag 840

ctgctgaacg acatcagcgg caagctggac ggcgtgaacg gcagcctgaa cgacctgatc 900

gcccagggca acctgaacac cgagctgagc aaggagatcc tgaagatcgc caacgagcag 960

aaccaggtgc tgaacgacgt gaacaacaag ctggacgcca tcaacaccat gctgagggtg 1020

tacctgccga agatcaccag catgctgagc gacgtgatga agcagaacta cgccctgagc 1080

ctgcagatcg agtacctgag caagcagctg caggagatca gcgacaagct ggacatcatc 1140

aacgtgaacg tgctgatcaa cagcaccctg accgagatca ccccggccta ccagaggatc 1200

aagtacgtga acgagaagtt cgaggagctg accttcgcca ccgagaccag cagcaaggtg 1260

aagaaggacg gcagcccggc cgacatcctg gacgagctga ccgagctgac cggcctggcc 1320

aagagcgtgc cgaagaacga cgtggacggc ttcgagttct acctgaacac cttccacgac 1380

gtgatggtgg gcaacaacct gttcggcagg agcgccctga agaccgccag cgagctgatc 1440

accaaggaga acgtgaagac cagcggcagc gaggtgggca acgtgtacaa cagcctgatc 1500

gtgctgaccc tgctgcaggc caaggccttc ctgaccctga ccacctgcag gaagctgctg 1560

ggcctggccg acatcgacta caccagcatc atgaacgagc acctgaacaa ggagaaggag 1620

gagttcaggg tgaacatccc gccgaccctg agcaacacct tcagcaaccc gaactacgcc 1680

aaggtgaagg gcagcgacga ggacgccaag atgatcgtgg aggccaagcc gggccacgcc 1740

ctggtgggct tcgagatcag caacgacagc atcaccgtgc tgaaggtgta cgaggccaag 1800

ctgaagcaga actaccaggt ggacaaggac agcctgagcg aggtgatcta cggcgacatg 1860

gacaagctgc tgggcccgga ccagagcggc ccgatctact acccgaacaa catcgtgttc 1920

ccgaacgagt acgtgatcac caagatcgac ttcaccaaga agatgaagac cctgaggtac 1980

gaggtgaccg ccaacttcta cgacagcagc accggcgaga tcgacctgaa caagaagaag 2040

gtggagagca gcgaggccga gtacaggacc ctgagcgcca acgacgacgg cgtgtacatg 2100

ccgctgggcg tgatcagcga gaccttcctg accccgatca acggcttcgg cctgcaggcc 2160

gacgagaaca gcaggctgat caccctgacc tgcaagagct acctgaggga gctgctgctg 2220

gccaccgacc tgagcaacaa ggagaccaag ctgatcgtgc cgccgagcgg cttcatcaag 2280

aacatcgtgg agaacggcag catcgaggag gacaacctgg agccgtggaa ggccaacaac 2340

aagaacgcct acgtggacca caccggcggc gtgaacggca ccaaggccct gtacgtgcac 2400

aaggacggcg gcatcagcca gttcatcggc gacaagctga agccgaagac cgagtacgtg 2460

atccagtaca ccgtgaaggg caagccgagc atccacctga aggacgagaa caccggctac 2520

atccactacg aggacaccaa caacaacctg gaggactacc agaccatcac caagaggttc 2580

accaccggca ccgacctgaa gggcgtgtac ctgatcctga agagccagaa cggcgacgag 2640

gcctggggcg acaacttcat catcctggag atcagcccga gcgagaagct gctgagcccg 2700

gagctgatca acaccaacaa ctggaccagc accggcagca ccaacatcag cggcaacacc 2760

ctgaccctgt accagggcgg caggggcatc ctgaagcaga acctgcagct ggacagcttc 2820

agcacctaca gggtgtactt cagcgtgagc ggcgacgcca acgtgaggat caggaacagc 2880

agggaggtgc tgttcgagaa gaggtacatg agcggcgcca aggacgtgag cgagatcttc 2940

accaccaagc tgggcaagga caacttctac atcgagctga gccagggcaa caacctgaac 3000

ggcggcccga tcgtgaagtt ctacgacgtg agcatcaagt ag 3042

<210> 2

<211> 1013

<212> PRT

<213> unknown

<220>

<223>Artificial sequence

<400> 2

Met Gly Arg Ser Trp Gly Val Val Ala Val Met Val Leu Cys Ala Ser

1 5 10 15

Gly Leu Leu Gly Ile Val Arg Gly His Gly Ser Met Glu Asp Pro Ile

20 25 30

Ser Arg Val Tyr Arg Cys Arg Leu Glu Asn Pro Glu Arg Pro Thr Ser

35 40 45

Pro Ala Cys Gln Ala Ala Val Ala Leu Ser Gly Thr Gln Ala Phe Tyr

50 55 60

Asp Trp Asn Glu Val Asn Ile Pro Asn Ala Ala Gly Arg His Arg Glu

65 70 75 80

Leu Ile Pro Asp Gly Gln Leu Cys Ser Ala Gly Arg Phe Lys Phe Arg

85 90 95

Gly Leu Asp Leu Ala Arg Ser Asp Trp Ile Ala Thr Pro Leu Pro Ser

100 105 110

Gly Ala Ser Ser Phe Pro Phe Arg Tyr Ile Ala Thr Ala Ala His Leu

115 120 125

Gly Phe Phe Glu Phe Tyr Val Thr Arg Glu Gly Tyr Gln Pro Thr Val

130 135 140

Pro Leu Lys Trp Ala Asp Leu Glu Glu Leu Pro Phe Ile Asn Val Thr

145 150 155 160

Asn Pro Pro Leu Val Ser Gly Ser Tyr Gln Ile Thr Gly Thr Thr Pro

165 170 175

Ser Gly Lys Ser Gly Ser His Leu Ile Tyr Val Ile Trp Gln Arg Thr

180 185 190

Asp Ser Pro Glu Ala Phe Tyr Ser Cys Ser Asp Val Tyr Phe Thr Asp

195 200 205

Ala Leu Ser Leu His Ser Thr Thr Arg Gly Pro Gly Lys Gly Gly Gly

210 215 220

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

225 230 235 240

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

245 250 255

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

260 265 270

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

275 280 285

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

290 295 300

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

305 310 315 320

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

325 330 335

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

340 345 350

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

355 360 365

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

370 375 380

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

385 390 395 400

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

405 410 415

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

420 425 430

Leu Thr Glu Leu Thr Gly Leu Ala Lys Ser Val Pro Lys Asn Asp Val

435 440 445

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

450 455 460

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

465 470 475 480

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

485 490 495

Asn Ser Leu Ile Val Leu Thr Leu Leu Gln Ala Lys Ala Phe Leu Thr

500 505 510

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

515 520 525

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

530 535 540

Asn Ile Pro Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

545 550 555 560

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

565 570 575

Pro Gly His Ala Leu Val Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

580 585 590

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

595 600 605

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

610 615 620

Gly Pro Asp Gln Ser Gly Pro Ile Tyr Tyr Pro Asn Asn Ile Val Phe

625 630 635 640

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

645 650 655

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

660 665 670

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

675 680 685

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

690 695 700

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

705 710 715 720

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

725 730 735

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

740 745 750

Val Pro Pro Ser Gly Phe Ile Lys Asn Ile Val Glu Asn Gly Ser Ile

755 760 765

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

770 775 780

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

785 790 795 800

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

805 810 815

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

820 825 830

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

835 840 845

Asn Leu Glu Asp Tyr Gln Thr Ile Thr Lys Arg Phe Thr Thr Gly Thr

850 855 860

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

865 870 875 880

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

885 890 895

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

900 905 910

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

915 920 925

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

930 935 940

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

945 950 955 960

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

965 970 975

Ser Glu Ile Phe Thr Thr Lys Leu Gly Lys Asp Asn Phe Tyr Ile Glu

980 985 990

Leu Ser Gln Gly Asn Asn Leu Asn Gly Gly Pro Ile Val Lys Phe Tyr

995 1000 1005

Asp Val Ser Ile Lys

1010

<210> 3

<211> 3036

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 3

atgggcagga gctggggcgt ggtggccgtg atggtgctgt gcgccagcgg cctgctgggc 60

atcgtgaggg gccacggcag catggaggac ccgatcagca gggtgtacag gtgcaggctg 120

gagaacccgg agaggccgac cagcccggcc tgccaggctg ccgtggccct gagcggcacc 180

caggccttct acgactggaa cgaggtgaac atcccgaacg ctgccggcag gcacagggag 240

ctgatcccgg acggccagct gtgcagcgcc ggcaggttca agttcagggg cctggacctg 300

gccaggagcg actggatcgc caccccgctg ccgagcggag ccagcagctt cccgttcagg 360

tacatcgcca ccgccgccca cctgggcttc ttcgagttct acgtgaccag ggagggctac 420

cagccgaccg tgccgctgaa gtgggccgac ctggaggagc tgccgttcat caacgtgacc 480

aaccctccgc tggtgagcgg cagctaccag atcaccggca ccaccccgag cggcaagagc 540

ggcagccacc tgatctacgt gatctggcag aggaccgaca gcccggaggc cttctacagc 600

tgcagcgacg tgtacttcac cgacgccctg agcctgcaca gcaccacccg aggccccggg 660

aagggtggag gaatgaacaa gaacaacagt aagctctcca cccgcgccct cccgtccttc 720

atcgactact tcaacggcat ctacggcttc gccaccggca tcaaggacat catgaacatg 780

atcttcaaga ccgacaccgg cggcaacgtc accctcgacg agatcctcaa gaaccagcag 840

ctcctcaacg agatcagcgg caagctcgac ggcgtgaacg gctccctcaa cgagctgatc 900

gcccaggtca acctcaacac cgagctgtcc aaggagatcc tcaagatctc caacgagcag 960

aaccaggtgc tcaacgacgt gaacaacaag ctggacgcca tcaacaccat gctgcacatc 1020

tacctcccga agatcacctc catgctctcc gacgtgatga agcagaacta cgccctctcc 1080

ctccagatcg agtacctctc caagcagctc caggagatca gcgacaagct cgacatcatc 1140

aacgtgaacg tgctcatcaa ctccaccctc accgagatca ccccggccta ccagcgcatc 1200

aagtacgtga acgagaagtt cgaggagctg accttcgcca ccgagaccac cctcaaggtg 1260

aagaaggact cctccccggc cgacatcctc gacgagctga ccgagctgac cgagctggcc 1320

aagtccgtga ccaagaacga cgtggacggc ttcgagttct acctcaacac cttgcacgac 1380

gtgatggtgg gcaacaacct cttcggccgc tccgccctca agaccgcctc cgagctgatc 1440

gccaaggaga acgtgaagac ctccggctcc gaggtgggca acgtgtacaa cttcctcatc 1500

gtgctcaccg ccctgcaggc caaggccttc ctcaccctca ccacctgccg caagctcctc 1560

ggcctcgccg gcatcgacta cacctccatc atgaacgagc acctcaacaa ggagaaggag 1620

gagttccgcg tgaacatcct cccgaccctc tccaacacct tctccaaccc gaactacgcc 1680

aaggtgaagg gctccgacga ggacgccaag atgatcgtgg aggccaagcc gggccacgcc 1740

ctcgtgggct tcgagatgtc caacgactcc atcaccgtgc tcaaggtgta cgaggccaag 1800

ctcaagcaga actaccaggt ggacaaggac tccctctccg aggtgatcta cggcgacacc 1860

gacaagctct tctgcccgga ccagtccgag cagatatact acaccaacaa catcgtgttc 1920

ccgaacgagt acgtgatcac caagatcgac ttcaccaaga agatgaagac cctccgctac 1980

gaggtgaccg ccaacttcta cgactcctcc accggcgaga tcgacctcaa caagaagaag 2040

gtggagtcct ccgaggccga gtaccgcacc ctctccgcca acgacgacgg cgtgtacatg 2100

ccgctcggcg tgatctccga aaccttcctc accccgatca acggcttcgg cctccaggcc 2160

gacgagaact cccgcctcat caccctcacc tgcaagtcct acctccgcga gctgctcctc 2220

gccaccgacc tctccaacaa ggagaccaag ctcatcgtgc cgccgtccgg cttcatctcc 2280

aacatcgtgg agaacggcgg catcgaggag gacaacctcg agccgtggaa ggccaacaac 2340

aagaacgcct acgtggacca caccggcggc gtgaacggca ccaaggccct ctacgtgcac 2400

aaggacggcg gcttctccca gttcatcggc gacaagctca agccgaagac cgagtacgtg 2460

atccagtaca ccgtgaaggg caaggccagc atctacctga aggacgagaa gaacaacgag 2520

ggcatctacg aggagatcaa caacgacctg gaggacttcc agaccgtgac caagaggttc 2580

atcaccggca ccgacagcag cggcgtgcac ctgatcttca ccagccagaa cggcgacgag 2640

gccttcggcg gcaacttcat catcagcgag atcaggagca gcgaggagct gctgagcccg 2700

gagctgatca agagcgacgc ctgggtgggc agccagggca cctggatcag cggcaacagc 2760

ctgaccatca acagcaacgc caacggcacc ttcaggcaga acctgccgct ggagagctac 2820

agcacctaca gcatgaactt caacgtgaac ggcttcgcca aggtgaccgt gaggaacagc 2880

agggaggtgc tgttcgagaa gaacttcagc cagctgagcc cgaaggacta cagcgagaag 2940

ttcaccaccg ccgccaacaa caccggcttc tacgtggagc tgagcagggg cacccagggc 3000

ggcaacatca ccttcaggga cttcagcatc aagtag 3036

<210> 4

<211> 1011

<212> PRT

<213> unknown

<220>

<223>Artificial sequence

<400> 4

Met Gly Arg Ser Trp Gly Val Val Ala Val Met Val Leu Cys Ala Ser

1 5 10 15

Gly Leu Leu Gly Ile Val Arg Gly His Gly Ser Met Glu Asp Pro Ile

20 25 30

Ser Arg Val Tyr Arg Cys Arg Leu Glu Asn Pro Glu Arg Pro Thr Ser

35 40 45

Pro Ala Cys Gln Ala Ala Val Ala Leu Ser Gly Thr Gln Ala Phe Tyr

50 55 60

Asp Trp Asn Glu Val Asn Ile Pro Asn Ala Ala Gly Arg His Arg Glu

65 70 75 80

Leu Ile Pro Asp Gly Gln Leu Cys Ser Ala Gly Arg Phe Lys Phe Arg

85 90 95

Gly Leu Asp Leu Ala Arg Ser Asp Trp Ile Ala Thr Pro Leu Pro Ser

100 105 110

Gly Ala Ser Ser Phe Pro Phe Arg Tyr Ile Ala Thr Ala Ala His Leu

115 120 125

Gly Phe Phe Glu Phe Tyr Val Thr Arg Glu Gly Tyr Gln Pro Thr Val

130 135 140

Pro Leu Lys Trp Ala Asp Leu Glu Glu Leu Pro Phe Ile Asn Val Thr

145 150 155 160

Asn Pro Pro Leu Val Ser Gly Ser Tyr Gln Ile Thr Gly Thr Thr Pro

165 170 175

Ser Gly Lys Ser Gly Ser His Leu Ile Tyr Val Ile Trp Gln Arg Thr

180 185 190

Asp Ser Pro Glu Ala Phe Tyr Ser Cys Ser Asp Val Tyr Phe Thr Asp

195 200 205

Ala Leu Ser Leu His Ser Thr Thr Arg Gly Pro Gly Lys Gly Gly Gly

210 215 220

Met Asn Lys Asn Asn Ser Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

225 230 235 240

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

245 250 255

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asn Val Thr Leu

260 265 270

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Glu Ile Ser Gly Lys

275 280 285

Leu Asp Gly Val Asn Gly Ser Leu Asn Glu Leu Ile Ala Gln Val Asn

290 295 300

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ser Asn Glu Gln

305 310 315 320

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

325 330 335

Met Leu His Ile Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

340 345 350

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

355 360 365

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

370 375 380

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

385 390 395 400

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

405 410 415

Thr Leu Lys Val Lys Lys Asp Ser Ser Pro Ala Asp Ile Leu Asp Glu

420 425 430

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

435 440 445

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Leu His Asp Val Met Val Gly

450 455 460

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

465 470 475 480

Ala Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

485 490 495

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Lys Ala Phe Leu Thr

500 505 510

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Gly Ile Asp Tyr Thr

515 520 525

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

530 535 540

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

545 550 555 560

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

565 570 575

Pro Gly His Ala Leu Val Gly Phe Glu Met Ser Asn Asp Ser Ile Thr

580 585 590

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

595 600 605

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Thr Asp Lys Leu Phe

610 615 620

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

625 630 635 640

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

645 650 655

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

660 665 670

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

675 680 685

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

690 695 700

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

705 710 715 720

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

725 730 735

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

740 745 750

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Gly Ile

755 760 765

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

770 775 780

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

785 790 795 800

Lys Asp Gly Gly Phe Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

805 810 815

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Ala Ser Ile Tyr

820 825 830

Leu Lys Asp Glu Lys Asn Asn Glu Gly Ile Tyr Glu Glu Ile Asn Asn

835 840 845

Asp Leu Glu Asp Phe Gln Thr Val Thr Lys Arg Phe Ile Thr Gly Thr

850 855 860

Asp Ser Ser Gly Val His Leu Ile Phe Thr Ser Gln Asn Gly Asp Glu

865 870 875 880

Ala Phe Gly Gly Asn Phe Ile Ile Ser Glu Ile Arg Ser Ser Glu Glu

885 890 895

Leu Leu Ser Pro Glu Leu Ile Lys Ser Asp Ala Trp Val Gly Ser Gln

900 905 910

Gly Thr Trp Ile Ser Gly Asn Ser Leu Thr Ile Asn Ser Asn Ala Asn

915 920 925

Gly Thr Phe Arg Gln Asn Leu Pro Leu Glu Ser Tyr Ser Thr Tyr Ser

930 935 940

Met Asn Phe Asn Val Asn Gly Phe Ala Lys Val Thr Val Arg Asn Ser

945 950 955 960

Arg Glu Val Leu Phe Glu Lys Asn Phe Ser Gln Leu Ser Pro Lys Asp

965 970 975

Tyr Ser Glu Lys Phe Thr Thr Ala Ala Asn Asn Thr Gly Phe Tyr Val

980 985 990

Glu Leu Ser Arg Gly Thr Gln Gly Gly Asn Ile Thr Phe Arg Asp Phe

995 1000 1005

Ser Ile Lys

1010

<210> 5

<211> 652

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 5

atgggcagga gctggggcgt ggtggccgtg atggtgctgt gcgccagcgg cctgctgggc 60

atcgtgaggg gccacggcag catggaggac ccgatcagca gggtgtacag gtgcaggctg 120

gagaacccgg agaggccgac cagcccggcc tgccaggctg ccgtggccct gagcggcacc 180

caggccttct acgactggaa cgaggtgaac atcccgaacg ctgccggcag gcacagggag 240

ctgatcccgg acggccagct gtgcagcgcc ggcaggttca agttcagggg cctggacctg 300

gccaggagcg actggatcgc caccccgctg ccgagcggag ccagcagctt cccgttcagg 360

tacatcgcca ccgccgccca cctgggcttc ttcgagttct acgtgaccag ggagggctac 420

cagccgaccg tgccgctgaa gtgggccgac ctggaggagc tgccgttcat caacgtgacc 480

aaccctccgc tggtgagcgg cagctaccag atcaccggca ccaccccgag cggcaagagc 540

ggcagccacc tgatctacgt gatctggcag aggaccgaca gcccggaggc cttctacagc 600

tgcagcgacg tgtacttcac cgacgccctg agcctgcaca gcaccaccta ac 652

<210> 6

<211> 2364

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 6

atgaacaaga acaacagtaa gctctccacc cgcgccctcc cgtccttcat cgactacttc 60

aacggcatct acggcttcgc caccggcatc aaggacatca tgaacatgat cttcaagacc 120

gacaccggcg gcaacgtcac cctcgacgag atcctcaaga accagcagct cctcaacgag 180

atcagcggca agctcgacgg cgtgaacggc tccctcaacg agctgatcgc ccaggtcaac 240

ctcaacaccg agctgtccaa ggagatcctc aagatctcca acgagcagaa ccaggtgctc 300

aacgacgtga acaacaagct ggacgccatc aacaccatgc tgcacatcta cctcccgaag 360

atcacctcca tgctctccga cgtgatgaag cagaactacg ccctctccct ccagatcgag 420

tacctctcca agcagctcca ggagatcagc gacaagctcg acatcatcaa cgtgaacgtg 480

ctcatcaact ccaccctcac cgagatcacc ccggcctacc agcgcatcaa gtacgtgaac 540

gagaagttcg aggagctgac cttcgccacc gagaccaccc tcaaggtgaa gaaggactcc 600

tccccggccg acatcctcga cgagctgacc gagctgaccg agctggccaa gtccgtgacc 660

aagaacgacg tggacggctt cgagttctac ctcaacacct tgcacgacgt gatggtgggc 720

aacaacctct tcggccgctc cgccctcaag accgcctccg agctgatcgc caaggagaac 780

gtgaagacct ccggctccga ggtgggcaac gtgtacaact tcctcatcgt gctcaccgcc 840

ctgcaggcca aggccttcct caccctcacc acctgccgca agctcctcgg cctcgccggc 900

atcgactaca cctccatcat gaacgagcac ctcaacaagg agaaggagga gttccgcgtg 960

aacatcctcc cgaccctctc caacaccttc tccaacccga actacgccaa ggtgaagggc 1020

tccgacgagg acgccaagat gatcgtggag gccaagccgg gccacgccct cgtgggcttc 1080

gagatgtcca acgactccat caccgtgctc aaggtgtacg aggccaagct caagcagaac 1140

taccaggtgg acaaggactc cctctccgag gtgatctacg gcgacaccga caagctcttc 1200

tgcccggacc agtccgagca gatatactac accaacaaca tcgtgttccc gaacgagtac 1260

gtgatcacca agatcgactt caccaagaag atgaagaccc tccgctacga ggtgaccgcc 1320

aacttctacg actcctccac cggcgagatc gacctcaaca agaagaaggt ggagtcctcc 1380

gaggccgagt accgcaccct ctccgccaac gacgacggcg tgtacatgcc gctcggcgtg 1440

atctccgaaa ccttcctcac cccgatcaac ggcttcggcc tccaggccga cgagaactcc 1500

cgcctcatca ccctcacctg caagtcctac ctccgcgagc tgctcctcgc caccgacctc 1560

tccaacaagg agaccaagct catcgtgccg ccgtccggct tcatctccaa catcgtggag 1620

aacggcggca tcgaggagga caacctcgag ccgtggaagg ccaacaacaa gaacgcctac 1680

gtggaccaca ccggcggcgt gaacggcacc aaggccctct acgtgcacaa ggacggcggc 1740

ttctcccagt tcatcggcga caagctcaag ccgaagaccg agtacgtgat ccagtacacc 1800

gtgaagggca aggccagcat ctacctgaag gacgagaaga acaacgaggg catctacgag 1860

gagatcaaca acgacctgga ggacttccag accgtgacca agaggttcat caccggcacc 1920

gacagcagcg gcgtgcacct gatcttcacc agccagaacg gcgacgaggc cttcggcggc 1980

aacttcatca tcagcgagat caggagcagc gaggagctgc tgagcccgga gctgatcaag 2040

agcgacgcct gggtgggcag ccagggcacc tggatcagcg gcaacagcct gaccatcaac 2100

agcaacgcca acggcacctt caggcagaac ctgccgctgg agagctacag cacctacagc 2160

atgaacttca acgtgaacgg cttcgccaag gtgaccgtga ggaacagcag ggaggtgctg 2220

ttcgagaaga acttcagcca gctgagcccg aaggactaca gcgagaagtt caccaccgcc 2280

gccaacaaca ccggcttcta cgtggagctg agcaggggca cccagggcgg caacatcacc 2340

ttcagggact tcagcatcaa gtaa 2364

<210> 7

<211> 1848

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 7

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacaa acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactag 1848

<210> 8

<211> 208

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 8

gagctctaga tgggccctgt tctgcacaaa gtggagtagt cagtcatcga tcaggaacca 60

gacaccagac ttttattcat acagtgaagt gaagtgaagt gcagtgcagt gagttgctgg 120

tttttgtaca acttagtatg tatttgtatt tgtaaaatac ttctatcaat aaaatttcta 180

attcctaaaa ccaaaatcca ggggtacc 208

<210> 9

<211> 792

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 9

ggtacctggt ggagcacgac actctcgtct actccaagaa tatcaaagat acagtctcag 60

aagaccaaag ggctattgag acttttcaac aaagggtaat atcgggaaac ctcctcggat 120

tccattgccc agctatctgt cacttcatca aaaggacagt agaaaaggaa ggtggcacct 180

acaaatgcca tcattgcgat aaaggaaagg ctatcgttca agatgcctct gccgacagtg 240

gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 300

cgtcttcaaa gcaagtggat tgatgtgata acatggtgga gcacgacact ctcgtctact 360

ccaagaatat caaagataca gtctcagaag accaaagggc tattgagact tttcaacaaa 420

gggtaatatc gggaaacctc ctcggattcc attgcccagc tatctgtcac ttcatcaaaa 480

ggacagtaga aaaggaaggt ggcacctaca aatgccatca ttgcgataaa ggaaaggcta 540

tcgttcaaga tgcctctgcc gacagtggtc ccaaagatgg acccccaccc acgaggagca 600

tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgatatct 660

ccactgacgt aagggatgac gcacaatccc actatccttc gcaagacctt cctctatata 720

aggaagttca tttcatttgg agaggacacg ctgaaatcac cagtctctct ctacaaatct 780

atctctggat cc 792

Claims

1. a kind of insect-resistant fusion gene, it is characterised in that described gene includes coding chitin-binding protein successively from 5 ' -3 ' Nucleotide sequence and coding Vip3 toxin nucleotide sequence；And above-mentioned 2 nucleotide sequences are located at same open reading Inframe.

2. insect-resistant fusion gene as claimed in claim 1, it is characterised in that described gene is from 5 ' -3 ' successively by coding chitin The nucleotide sequence connection composition of the protein-bonded nucleotide sequence of matter and coding Vip3 toxin.

3. insect-resistant fusion gene as claimed in claim 1 or 2, it is characterised in that the chitin-binding protein is Tma12, institute Vip3 toxin is stated for Vip3A, Vip3B, Vip3C, Vip3D or Vip3H.

4. insect-resistant fusion gene as claimed in claim 1, it is characterised in that the Vip3 toxin is Vip3A or Vip3H.

5. insect-resistant fusion gene as claimed in claim 1, it is characterised in that the nucleotides sequence of the insect-resistant fusion gene is classified as SEQ ID NO：1 or SEQ ID NO：Shown in 2.

6. the fusion protein that insect-resistant fusion gene described in a kind of claim 1 is encoded.

7. fusion protein as claimed in claim 6, it is characterised in that the amino acid sequence of the fusion protein is SEQ ID NO：3 or SEQ ID NO：Shown in 4.

8. the fusion protein described in a kind of claim 6 is in prepare transgenosis anti-pest crop, transgenic insecticidal microorganism or antibody In application.

9. application as claimed in claim 8, it is characterised in that the insect-resistant transgenic crops are brilliant by fusion protein joint BT The conversion of body toxin is prepared from.