CN108588120A - The preparation method and agriculture bacillus mediated corn transformation method of a kind of corn Agrobacterium-mediated Transformation receptor - Google Patents
The preparation method and agriculture bacillus mediated corn transformation method of a kind of corn Agrobacterium-mediated Transformation receptor Download PDFInfo
- Publication number
- CN108588120A CN108588120A CN201810374834.7A CN201810374834A CN108588120A CN 108588120 A CN108588120 A CN 108588120A CN 201810374834 A CN201810374834 A CN 201810374834A CN 108588120 A CN108588120 A CN 108588120A
- Authority
- CN
- China
- Prior art keywords
- corn
- transformation
- callus
- agrobacterium
- mediated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
Abstract
The present invention relates to a kind of preparation method of corn Agrobacterium-mediated Transformation receptor and agriculture bacillus mediated corn transformation methods, belong to Breeding of Biotechnology of Maize technical field.The preparation method of corn Agrobacterium-mediated Transformation receptor provided by the invention, includes the following steps：1) maize immature embryos are subjected to Fiber differentiation, obtain loose II type callus；2) the loose II type callus that step 1) obtains is digested, obtains competence II type callus cells, i.e. corn Agrobacterium-mediated Transformation receptor；The enzymolysis enzyme includes cellulase and pectase.Transformation receptor provided by the invention selects competence corn II type callus, overcomes the season limit in maize immature embryos source, and the corn Agrobacterium transformation system to establish stable is laid a good foundation.
Description
Technical field
The present invention relates to Breeding of Biotechnology of Maize technical fields, and in particular to a kind of system of corn Agrobacterium-mediated Transformation receptor
Preparation Method and agriculture bacillus mediated corn transformation method.
Background technology
Corn (Zea mays L.) is one of most important crops in the world, the grain as numerous areas in the world
The main forage crop of crop and most area is planted extensively in the whole world.Corn is also important the raw material of industry, quilt simultaneously
It is widely used in fermentation industry, alcohol manufacture and bioenergy is provided.Crop breeding is substantially to the excellent variation of biocenose
The process of artificial selection and enrichment application.The initiative of high-quality germ plasm resource and the selection and breeding of Inbred Lines are to realize that corn breeding is prominent
Broken basis.Between nearly 100 years, corn breeding works based on natural kind of selection cross, although obtaining some good jade
Rice kind, but its breeding work amount is big, the period is long, breeding efficiency is low.Germ plasm resource is deficient, some materials intermolecular hybrid is not close
With the presence of the factors such as interbiotic reproduction isolation, causes the homogeneity of current corn kind serious, affect contemporary corn breeding
The development of work.The development and application of modern biotechnology based on molecular genetics, especially transgenic technology are answered
With successfully overcoming the incompatible difficulty of distant hybridization, by excellent channel genes to receptor species, realize breeding character
Directed change, effectively broken the obstacle that reproduction is isolated between species, enriched the diversity of material.
Since the first genetically modified plants (tobacco) come out in the world, using transgenic technology cultivate New Crop Varieties at
For important breeding technique.Theoretically, transgenic technology is realized by the exchange of target gene, with traditional breeding technology
There is no essential distinction, and technically, the hereditary information of transgenic breeding technique improvement becomes apparent from, is more clear, is more specific, choosing
It selects efficient.Extension and development of the transgenic technology as traditional breeding technology, and traditional breeding technology combination, improve kind
While improveing efficiency, can also integrated cultural go out more anti-, high-quality, highly efficient and productive new varieties.By 2015, the whole world turned base
Because maize sown area reaches 55,200,000 hectares, become the maximum genetically modified crops of grown worldwide area.In actual production, real
Show the target for reducing corn yield loss and agriculture chemical usage amount, brings huge society, economy and ecological benefits.
Good receptor system is the key component for determining corn gene operation success or failure, and perfect body cell is bred in vitro
It is the one of the prerequisite for realizing genetic transformation with regenerative system.So the corn gene research of early stage is concentrated mainly on receptor
In terms of the screening and identification of material.The maize genetic transformation receptor material reported includes suspension cell line and its isolates primary
Plastid, rataria and its embryo callus of induction, the culture of maize bud point and Mature embryo culture etc., corn transformation receptor culture skill
The continuous development of art is perfect, and effective material foundation is provided to the development of corn gene work.
Rataria (Immature embryos, IEs) is carried out earliest, using most successful explant in corn tissue's culture
Body.In Green and Phillips in 1975 with regard to carrying out tissue cultures using maize immature embryos, and regeneration plant has successfully been obtained, opens
The epoch of Immature Embryo Culture of Maize are opened.Later Lu etc., Vasil etc., Armstrong etc., Duncan etc., Li Shirun etc., Chen Ying etc.,
Report successful application rataria induces to obtain callus and and breaks up obtained regeneration plant Yuan Ying etc. in succession.Rataria is as receptor
Material, which carries out genetic transformation, has the breeding of preferable body cell and regeneration effect, Suitable genes rifle or agriculture bacillus mediated heredity
Conversion.The biolistic bombardment maize immature embryos such as Klein and the gus gene transient expression for successfully observing scultellum edge, take the lead in reality
The genetic transformation of maize immature embryos is showed.Demonstrate the possibility that maize immature embryos carry out transgeneic procedure as acceptor material.Then
Agriculture bacillus mediated maize immature embryos are also successfully established as the transformation system of transformation receptor and extensive use.Relative to plasm
Body and cell morphology and ultrastructure, rataria source and conversion operation are simpler, but due to the state of rataria material, the serious shadow of vigor difference
The efficiency of regenerating system after ringing transformation efficiency and converting.And it carries out genetic transformation using rataria material as receptor and is limited by season
System, is unfavorable for the foundation of the transformation system of a systematization, scale.
Invention content
The purpose of the present invention is to provide a kind of preparation method of corn Agrobacterium-mediated Transformation receptor and corn Agrobacterium-mediated Transformations
And breeding method.The present invention replaces rataria as acceptor material using corn II type callus, overcomes maize immature embryos source
Season limit, establish stable corn Agrobacterium transformation system.
The present invention provides a kind of preparation methods of corn Agrobacterium-mediated Transformation receptor, include the following steps：
1) maize immature embryos are subjected to Fiber differentiation, obtain loose II type callus；
2) the II type callus that step 1) obtains is digested, it is thin obtains the loose II type callus of competence
Born of the same parents, i.e. corn Agrobacterium-mediated Transformation receptor；The enzymolysis enzyme includes cellulase and pectase.
Preferably, the kind of the corn includes Hi-II, A188, C01,18-599R, neat 319 or H99.
Preferably, the mass ratio of the step 1) cellulase and pectase is 1:1.
Preferably, the step 1) enzymolysis is：It is 0.010~0.040g/mL items in the total concentration of the enzymolysis enzyme
Under part, 6~12min is digested.
The corn Agrobacterium-mediated Transformation receptor obtained the present invention also provides the preparation method based on the above-mentioned technical proposal
Agriculture bacillus mediated corn transformation method, includes the following steps：
Target gene is transferred to by the corn that preparation method described in above-mentioned technical proposal obtains using agriculture bacillus mediated method
In Agrobacterium-mediated Transformation receptor；
The corresponding transgenosis empty carrier of the target gene is pHZM3 plasmids.
The present invention also provides the T of the method for transformation based on the above-mentioned technical proposal0For the cultivation side of maize transformation plant
Method includes the following steps：
A) using nucleotide sequence, the Bt insecticidal protein genes cry1C* as shown in SEQ ID NO.1 is purpose gene, by institute
It states target gene and is connected to target genetic region on plasmid pHZM3, obtain transgene carrier pHZM3-cry1C*；
B) according to method for transformation described in above-mentioned technical proposal, the transgene carrier is transferred to the corn Agrobacterium-mediated Transformation
In receptor, 3~5d is co-cultured, the callus of foreign gene transient expression is obtained；
C) callus of the obtained foreign gene transient expressions of step b) is subjected to 7~10d of renewal cultivation, is converted
Callus；
D) by the obtained transformed callis of step c) be placed in the screening and culturing medium containing 2~3mg/L bialaphos into
The wheel screening of row 2~3, obtains the callus with Herbicid resistant；
E) the obtained callus with Herbicid resistant of the step d) is placed in differential medium and is broken up
Culture, obtains T0For maize transformation plant.
The present invention also provides the T that the breeding method obtains based on the above-mentioned technical proposal0For the anti-of maize transformation plant
Worm corn breeding method, includes the following steps：
By the T0Selfing or back pollinating are carried out for maize transformation plant, obtains the pest-resistant corn variety of character stabilization.
The present invention provides a kind of preparation methods of corn Agrobacterium-mediated Transformation receptor.The present invention utilizes the loose II types of corn
Callus replaces rataria as acceptor material, overcomes the season limit in maize immature embryos source, establishes stable corn agriculture
Bacillus transformation system.The experimental results showed that the transformation receptor that preparation method of the present invention obtains have passed through enzymolysis processing, for jade
Rice Agrobacterium-mediated Transformation can obtain 38.33% transformation efficiency, and will shorten to the transformation period 3~4 months, transformation efficiency height,
Transformation period is short, obtains efficient transformation system.
The present invention is based on the transformation receptors that above-mentioned preparation method obtains, and are finally also successfully transferred to carrier pHZM3-cry1C*
Transformation receptor obtains insect-resistant transgenic corn material, and has carried out Molecular Detection and expression verification to target gene, obtains height
The superior corn germplasm materials of anti-corn borer.
Description of the drawings
Fig. 1 is the conversion plasmid construct schematic diagram that the embodiment of the present invention 3 provides；
Fig. 2 is the T that the embodiment of the present invention 3 provides0In generation, turns cry1C* gene corn PCR testing result figures；
Fig. 3 is the transfer-gen plant expression and phenotypic analysis result figure that the embodiment of the present invention 3 provides.
Specific implementation mode
The present invention provides a kind of preparation methods of corn Agrobacterium-mediated Transformation receptor, include the following steps：
1) maize immature embryos are subjected to Fiber differentiation, obtain loose II type callus；
2) the loose II type callus that step 1) obtains is digested, it is thin obtains competence II type callus
Born of the same parents, i.e. corn Agrobacterium-mediated Transformation receptor；The enzymolysis enzyme includes cellulase and pectase.
In the present invention, the kind of the corn includes Hi-II, A188, C01,18-599R, neat 319 or H99.In this hair
In bright, the corn preferably uses Hi-II corn varieties.
In the present invention, the loose II type callus of the corn is obtained by Immature Embryo Culture of Maize.The present invention is described
Preferably further include Subculture after Fiber differentiation, and specifically, it is preferable to include the following steps：Maize immature embryos are placed in induction training
It supports in base and carries out Fiber differentiation, obtain I type callus；The I types callus is placed on subculture medium and carries out subculture
Culture, obtains loose II type callus.
In the present invention, the diameter of the rataria is preferably 1.2~1.8mm, more preferably 1.5mm.The present invention is to described
The preparation method of rataria does not have special restriction, and the cultural method using maize immature embryos well known to those skilled in the art is
It can.In the present invention, the inducing culture further includes the 2,4-D of 2mg/L preferably on the basis of N6 culture mediums；The induction
Culture is preferably light culture, and the incubation time of the Fiber differentiation is preferably 28 DEG C.
After obtaining I type callus, I type callus is placed on subculture medium and carries out squamous subculture by the present invention,
In the present invention, preferably every 20 days subcultures are primary, choose loose II type callus as transformation receptor.In the present invention, institute
It is preferably that loose drying, color be vivid, the rapid somatic embryo of growth to state loose II type callus.In the present invention, institute
Subculture medium is stated preferably on the basis of N6 culture mediums, further includes the MES of 2, the 4-D and 0.5g/L of 2mg/L.
After obtaining loose II type callus, the present invention carries out cell wall enzymolysis to the loose II type callus
Processing.In the present invention, the enzymolysis enzyme includes cellulase and pectase.In the present invention, the cellulase and fruit
The mass ratio of glue enzyme is preferably 1:1.In the present invention, the enzymolysis is preferably：It is 0.010 in the total concentration of the enzymolysis enzyme
Under the conditions of~0.040g/mL, 6~12min is digested.In the present invention, the total concentration of enzymolysis enzyme is more preferably 0.020g/
ML, the preferred 9min of enzymolysis time.In the present invention, the enzymolysis act as destroy callus cell cell wall structure, carry
Its high permeability to large biological molecule improves the frequency that agrobacterium dna enters cell.
The present invention also provides a kind of corn Agrobacterium-mediated Transformation that the preparation method described based on the above-mentioned technical proposal obtains by
The agriculture bacillus mediated corn transformation method of body, includes the following steps：Target gene is transferred to using agriculture bacillus mediated method
In the corn Agrobacterium-mediated Transformation receptor that preparation method described in above-mentioned technical proposal obtains；The corresponding transgenosis of the target gene is empty
Carrier is pHZM3 plasmids.In the present invention, the target gene is preferably Bt insecticidal protein crystal genes.
The present invention does not have special restriction, use well-known to those skilled in the art the agriculture bacillus mediated method
Agriculture bacillus mediated method.Specifically, target gene is first building up on transgenosis empty carrier by the present invention, then by transgenosis
Empty carrier is transferred to Agrobacterium, finally carries out the Agrobacterium containing target gene transgene carrier to corn Agrobacterium-mediated Transformation receptor
Conversion.The present invention does not have special restriction to the specific conversion condition, is turned using Agrobacterium well known to those skilled in the art
Change conventional method.
The present invention also provides the T of the method for transformation based on the above-mentioned technical proposal0For the cultivation side of maize transformation plant
Method includes the following steps：
A) using nucleotide sequence, the Bt insecticidal protein genes cry1C* as shown in SEQ ID NO.1 is purpose gene, by institute
It states target gene and is connected to target genetic region on plasmid pHZM3, obtain transgene carrier pHZM3-cry1C*；
B) according to method for transformation described in above-mentioned technical proposal, the transgene carrier is transferred to the corn Agrobacterium-mediated Transformation
In receptor, 3~5d is co-cultured, the callus of foreign gene transient expression is obtained；
C) callus of the obtained foreign gene transient expressions of step b) is subjected to 7~10d of renewal cultivation, is converted
Callus；
D) the obtained transformed callis of step c) are placed in the screening and culturing medium containing 2.5mg/L bialaphos and are carried out
2~3 wheel screenings, obtain the callus with Herbicid resistant；
E) the obtained callus with Herbicid resistant of the step d) is placed in differential medium and is broken up
Culture, obtains T0For maize transformation plant.
The present invention using nucleotide sequence Bt insecticidal protein genes cry1C* as shown in SEQ ID NO.1 as purpose gene,
The target gene is connected to target genetic region on plasmid pHZM3, obtains transgene carrier pHZM3-cry1C*.In the present invention
In, the plasmid pHZM3 is preferably also connected with constitutive promoter Ubi.In the present invention, the Bt insecticidal protein genes cry1C*
For wild type genotype.The present invention does not have special restriction to the source of the Bt insecticidal protein genes cry1C*, using ability
Biotech firm known to field technique personnel synthesizes or expands from plasmid or gene containing Bt insecticidal protein genes cry1C*
Increase.Specifically, the present invention is preferably expanded from the pUC57 plasmids containing Bt insecticidal protein genes cry1C*.At this
In invention, the nucleotides sequence of the Bt insecticidal protein genes cry1C* is classified as：
CACAGGTGCGGTCTGCGTCGAGAGTTGGTCCACTGGCAGGCCGGAATGAAGAAGTGCGCGTCGGAGCTGGAGCTGGA
GGCGTTCATCCGGGAGAGCGGCGAGGACGCCCGCGCCGCCGCCGGAGGTAGCAGTCCGGGGTGCGGTGGATCAAGCG
ATCCCGGAGGGAGTGGCGTCTTCTCACCCGGCTTCGGTTTCGCCGACTCGGACACCATGGATGGAGGCAGTTGGTGG
TACGGGAACGTCCGCACGCCGAACCCAGTCATGTCGCAGGCGGCGTCCATATCCGCTAGCCCCGGGCTAACCACCTC
AGCCAATCATGCTCTTGAAAGCGAGTCAGACTCCGACAGCGAATCACTGTATGAGGTAGAGGGAGTTCCATACGAGC
GAGGTAACAGATCCATTGAGACGAAGCGAATAAGAAGGATGGTGTCCAATAGGGAGTCTGCGCGGCGGTCTAGGAGG
AAGAAACAGGCACAGTTGTCTGACCTGGAGTCACAGGTTGAACGACTCAAAGGTGAAAACGCAACACTGTTCCAGCA
ACTTTCAGATGCCAACCAACAGTTCAGTACTGCAGTCACAGACAACAGAATCCTCAAATCCGATGTAGAAGCGTTAA
GAATTAAGGTAAAGATGGCAGAGGATATGGTAGCGAGAAGTGCTGTATCGTGTGGCCTAGGCGACCTTGGCCTGGCA
CCATACGTGAACTCAAGGAAGATGTGCCAAGCTTTGAATGTGCTCACAGGGTTGGATTTACTAGGGAGTGATGCGTT
CAGGGGTCCAACCGCGGTACACGAGTACAGAACTCACCAGKACAGAGCACTGCAAGCCTAGAGAGTCTGGATAACCG
AAAGTCCAACGAGGTGACCAGKTTGCGCGGCGGACATTTGGCCTTGAGCTTCAAGCCRTTGATCTGATTCAAGCTTG
CTCCRCCCTCAAAAAAAGGACCAGAGTTTGTCACTCAAATAGCTGGTGGCTTGAGCRGGCTTCTGGCACGAGTTCTC
TTGAACATATTTCCACA。
In the present invention, the Bt insecticidal protein genes cry1C* preferably uses restriction enzyme BamHI and HindIII
It carries out digestion and connection is reacted, be connected in the multiple cloning sites of plasmid pHZM3.In the present invention, Bt insecticidal proteins bases are obtained
After cry1C*, the Bt insecticidal protein genes cry1C* is preferably building up on pHZM3 carriers by the present invention.In the present invention,
The structure preferably also uses restriction enzyme BamHI and HindIII to carry out.
The present invention obtains corn Agrobacterium-mediated Transformation receptor according to preparation method described in above-mentioned technical proposal.
After obtaining transgene carrier and corn Agrobacterium-mediated Transformation receptor, the transgene carrier is transferred to corn agriculture by the present invention
In Agrobacterium-transformation receptor, 3~5d is co-cultured, the callus of foreign gene transient expression is obtained.In the present invention, the total training
The foster promotion Agrobacterium that act as is infected into receptor callus cell.In the present invention, the co-cultivation culture medium is excellent
It is selected as MS culture mediums.In the present invention, the condition of the co-cultivation is preferably 19 DEG C of light cultures.
After obtaining the callus of foreign gene transient expression, the present invention by the callus of foreign gene transient expression into
Row 7~10d of renewal cultivation, obtains transformed calli.In the present invention, the temperature of the renewal cultivation is preferably 28 DEG C, institute
It is preferably light culture to state renewal cultivation, and the time of the light culture is 7~10d, more preferably 8d.In the present invention, described extensive
Culture used medium is preferably the N6 culture mediums for carrying 0.2g/L carbenicillins again.
After obtaining transformed calli, transformed calli is placed in the screening containing 2~3mg/L bialaphos by the present invention
2~3 wheel screenings are carried out in culture medium, obtain the callus with Herbicid resistant.In the present invention, the screening and culturing medium
Further include the carbenicillin of 2, the 4-D and 0.2g/L of 2mg/L it is preferred that on the basis of N6 culture mediums.In the present invention, described double
A concentration of 2~3mg/L of third ammonia phosphine, more preferably 2.5mg/L.In the present invention, the condition of culture of the screening is preferably 28
DEG C light culture.In the present invention, the time for often taking turns screening is preferably 20~30d, more preferably 25d.In the present invention, the sieve
Choosing preferably further includes green fluorescent protein phenotype confirmation method：Callus is placed on progress green fluorescence confirmation on blue-ray light, is chosen
Selecting has the callus of green fluorescence expression；2~3 wheel screenings are carried out according to the method described above, remove the callus group of browning death
It knits, obtains vivid color, short texture, the growth rapidly callus with Herbicid resistant.
It obtains after there is the callus of Herbicid resistant, the callus with Herbicid resistant is placed in point by the present invention
Change in culture medium and carry out differentiation culture, obtains T0For maize transformation plant.In the present invention, the differential medium is cultivated with N6
Further include the 6-BA of 2mg/L on the basis of base；PH value is 5.8.In the present invention, the condition of the differentiation culture is preferably 28 DEG C,
16/8 hour photoperiod.
After differentiation culture of the present invention, hardening and transplanting are preferably carried out, T is obtained0For maize transformation plant.The present invention couple
The hardening and the method for transplanting do not have special restriction, are carried out using hardening well known to those skilled in the art, method for transplanting
.
The present invention also provides the T that the breeding method obtains based on the above-mentioned technical proposal0For the anti-of maize transformation plant
Worm corn breeding method, includes the following steps：
By the T0Selfing or back pollinating are carried out for maize transformation plant, obtains the pest-resistant corn variety of character stabilization.
The present invention is by T0Selfing or back pollinating are carried out for maize transformation plant, obtains the pest-resistant corn product of character stabilization
Kind.The present invention does not have special restriction to the method for the selfing, backcrossing, using selfing well known to those skilled in the art, returns
Friendship method.Specifically, in embodiments of the present invention, obtaining T0After maize transformation plant, the present invention is preferably to transgenosis
The molecule of material, phenotype are verified and (carry out PCR detections, protein content detection and the detection of field insect resistace)：The present invention will
Obtained pest-resistant corn variety carries out field planting, and the protein of different tissues is taken to carry out the expression verification of target gene；The present invention
Obtained pest-resistant corn variety is subjected to field planting, the time of infertility does not spray insecticide and carries out insect resistace verification, specifically, this
Invent T0For maize transformation plant more solito cultivating method of crop field isolation implant, the time of infertility does not apply pest-resistant pesticide, no
Field pest control is especially carried out, insect pest degree of impairment and Agronomic characteristic investigation require to carry out according to relevant operation, field
Between material pass through stringent artificialpollination, carry out strictly selfing or back pollinating；Swatch is fastened after pollination, is write pollination and is planted
Strain strain number, combination and date.Carry out rogueing in conjunction with Plant agronomic traits and panicled characters, obtain target gene stablize expression and
Transgenic corns material with good com-borer resistant singly receives single storage after seed maturity.It is sampled in molecular biology experiment, is real
Test with interpretation of result more according to《Molecular cloning》Techniqueflow carries out in (third edition), and experiment reagent in book according to instructing
It prepares or is ordered in associated companies.
The preparation method to a kind of corn Agrobacterium-mediated Transformation receptor of the present invention and agriculture with reference to specific embodiment
The corn transformation method that bacillus mediates is further described in detail, and technical scheme of the present invention includes but not limited to following implements
Example.
Embodiment 1
(1) preparation of corn Agrobacterium-mediated Transformation receptor：
By artificialpollination, callus induction material Hi-II (A188*B73) material seed is prepared, by F1
For seed field planting, stringent pollination self is carried out, is listed record pollination material and date.Pollination fetches children after 10~14 days
Fringe is placed in N6 inducing cultures, 28 DEG C of light culture inductions with picking rataria (diameter 1.2-1.8mm) after 75% alcohol surface sterilization
Callus is transferred to after I type callus is formed on subculture medium, 28 DEG C of light cultures, and every 20 days subcultures are primary, dredged
The II types callus (embryo callus, i.e. loose drying, color is vivid, grows rapid somatic embryo) of pine is as conversion
Receptor.
It is as follows：
1) controlled pollination of corn
A) after corn takes out hero, tassel is entangled with big pocket, is pinned below with safety pin, collect pollen.
B) it before female fringe filigree is not extracted out, is entangled with tiny pocket, is used in combination safety pin not good.
C) it pollinates the previous day, when filigree extends about 2cm, is cut off at the top of filigree with scissors, promote its elongation.
D) it second day, after filigree extends, pollinates, and listed record.
E) it harvests within 10~14 days, 4 DEG C of storages.
2) stripping and culture of rataria
A) it is stored 1~2 day in 4 DEG C after harvesting fresh fringe (embryo about 1mm).
B) bract of maize ear and filigree are removed, 75% alcohol impregnates 3~5min, and fruit ear head-tail is cut with knife
Point.
C) grain endosperm top half (cutting 1/2~2/3 according to rataria size) is cut with scalpel.
D) choose rataria with pincet.
E) rataria is put into sterile water and is cleaned.
3) IMMATURE EMBRYOS CULTURE
A) rataria is transferred on inducing culture, downwards, scultellum is upward for plumular axis (more flat one side).
B) 27~28 DEG C of light cultures 3~4 weeks, are allowed to start dedifferentiation to form I type callus.
C) every 2~3 weeks subcultures are primary, and by 2~3 subcultures, growth selection is rapid, and quality is crisp, color is vivid dredges
The II type callus of pine is as transformation receptor.
The culture medium is as follows：
MS culture mediums (1 liter)：MS a great number of elements, trace element, organic matter, molysite, 30g sucrose, 8g agar, pH5.8；
N6 culture mediums (1 liter)：N6 a great number of elements, trace element, organic matter, molysite, 20g sucrose, 0.69g proline,
0.2g caseinhydrolysates, 7g agar, pH5.8；
Rataria inducing culture：N6 culture mediums+2mg/L2,4-D；
Callus subculture medium：N6 culture mediums+2mg/L2,4-D+0.5gMES；
Screening and culturing medium：N6 culture medium+2mg/L2,4-D+2mg/L glufosinates；
Differential medium：N6 culture medium+2mg/L 6-BA, pH5.8；
Root media：1/2MS culture medium+0.4mg/L NAA, pH5.8；
Remarks：A great number of elements, trace element, molysite, organic matter formula by N6, MS basic recipe prepare (Zhu Zhiqing,
1975), above-mentioned culture medium is both needed to high pressure sterilization.
(2) Agrobacterium-mediated Transformation acceptor material screens：
It is conversion carrier to select plasmid pHZM3-cry1C*, according to Agrobacterium-mediated Transformation flow (Plant
Transformation Facility), rataria, I types callus, densification II types callus and loose II are selected respectively
Type callus is acceptor material, carries out Agrobacterium-mediated genetic transformation.Experimental setup repeats three times, each to repeat 30
Ware, per 30 ratarias of ware or 3 grams of callus.After conversion 10 days, (the clarechemical.com on blue-ray light
Transilluminator DR-46B) or the observation green under inverted fluorescence microscope (Nikon) 460~495nm exciting lights
Fluorescence counts instantaneous conversion efficiency.Inventive result shows that the instantaneous conversion efficiency of the different Induction periods of Hi-II (A188*B73) does not have
There is significant difference, the instantaneous conversion efficiency for showing as rataria, which is the instantaneous conversion efficiency of 0.053%, I type callus, is
0.047%, the instantaneous conversion efficiency of fine and close II types callus is the instantaneous conversion of 0.059%, loose II type callus
Efficiency is 0.055%.Find that the cell of Agrobacterium-mediated Transformation is located at acceptor material surface, internal cell by the observation of fluorescence sites
Structure almost without the green fluorescence positive cell.
Using the bialaphos concentration gradient of 1.5mg/L, 2mg/L and 2.5mg/L, conversion rataria or callus are carried out
5~6 wheel tissue cultures screenings, obtain the callus of Herbicid resistant.After rataria material is infected by Agrobacterium, due to can not
Antibacterial final death, can not obtain transformed calli, therefore when carrying out transgeneic procedure as acceptor material using rataria not
Consider the influence of Agrobacterium infection.On the other hand, because only that the callus that 17.36% conversion rataria can be converted
For differentiation and regeneration plant, therefore 0.99% actual conversion has been had in the induction passed through 10 months later.It is cured using I types
Injured tissue is converted as receptor, other than it not can induce II type callus and reduce conversion callus yield, also as
73.79% Agrobacterium infection rate reduces the resistant calli yield that conversion callus yield finally obtains 1.72%.Relatively
It is also shortened to 6 months in the time of rataria, I type callus induction embryo callus.For structure relatively closely densification II
Type callus just has influence similar with I type callus, in 85.31% Agrobacterium infection rate and 81.27% embryo
Callus induction rate has obtained final 0.69% conversion ratio, although can not ensure that all transformed cells can obtain
Transformed calli, but the conversion callus group that obtained transformed cells only need 3~4 months to can be obtained by a large amount of embryos
It knits.Select loose II types callus as receptor carry out it is agriculture bacillus mediated infect conversion, since loose structure is clear
It can fully scatter when washing, and then cleaning is more abundant, Agrobacterium infection rate is only 11%, and can almost be owned
Transformed cells can obtain embryo callus, 4.72% final conversion ratio is obtained, relative to other several receptor materials
Material, the subculture screening that loose II types callus only needs 3~4 months.
The II types callus of final choice short texture is as transformation receptor material.Relative to existing transformation receptor material
Expect that rataria, loosely organized II types callus are preserved by laboratory tissue culture, the offer that can largely stablize rapidly be provided,
Solves the seasonal limiting factor of rataria.As acceptor material, the II type callus of short texture has for 0.055% wink
When transformation efficiency and 4.72% transformation efficiency, be significantly higher than 0.99% transformation frequency of the rataria as acceptor material.Third
A aspect is carried out Agrobacterium-medialed transformation using loosely organized II types callus as acceptor material and only needs 3~4
The moon can screen positive callus, can will shorten to the transformation period 6 months, and highly shortened the transformation period (10
~12 months).
Embodiment 2
The foundation of transformation receptor optimization of material method, its step are as follows：
Agrobacterium-mediated genetic transformation is affected by various factors, and the research of forefathers is concentrated mainly on conversion condition
Optimization, under the premise of not increasing conversion operation difficulty, it is to improve Agrobacterium to turn to carry out preculture processing to receptor callus
Change the effective ways of efficiency.It is conversion carrier that the present invention, which selects plasmid pHZM3-cry1C*, and it is good loose to choose growth conditions
II types callus infect conversion as transgenic acceptor Agrobacterium.Loose II type callus is carried out before conversion
Cell wall enzymolysis processing improves transformation efficiency.
Lysed cells wall：Prepare the cellulase and pectinase enzymatic hydrolysis of 1g/mL, presses 1 respectively:1 ratio mixed enzymolysis,
4 DEG C are stored in before use.By the loose II types callus of preculture be transferred to respectively concentration (0.000,0.010,0.020,
0.030,0.040 and 0.050g/mL) enzymolysis liquid in, design (0,3,6,9,12 and 15 minute) time gradient.Enzymolysis processing
Afterwards, using culture medium cleaning 3~5 times is infected, clean enzymolysis liquid is removed, corn Agrobacterium-mediated Transformation receptor is obtained.Each processing is set
3 repetitions are set, it is each to repeat 20 ware callus.
Prepare OD660=1.0 infect liquid, infect corn Agrobacterium-mediated Transformation acceptor 10 min and are converted.Dry up surface bacterium
Liquid, the corn Agrobacterium-mediated Transformation receptor after infecting are transferred to co-cultivation culture medium, are transferred to renewal cultivation after 19 DEG C of light culture 3d, invade
Dye is (clarechemical.com transilluminator DR-46B) or glimmering being inverted on blue-ray light after converting 10 days
Green fluorescence is observed under light microscope (Nikon) 460~495nm exciting lights counts instantaneous conversion efficiency.1.5mg/ is used later
L, the bialaphos concentration gradient of 2mg/L and 2.5mg/L carries out 5~6 wheel tissue cultures sieves to corn Agrobacterium-mediated Transformation receptor
Choosing, obtains the callus of Herbicid resistant.The kanamycin-resistant callus tissue group number of statistics conversion generation, Agrobacterium infection are lost respectively
The number of callus number and callus induction loss, calculates final conversion ratio, as a result as follows：
Green fluorescent protein screening effect under the conditions of 1 different disposal of table,
AFCR indicates instantaneous conversion efficiency；FST indicates stable conversion rate；The statistics each handled is according to average ± standard
Difference, unit %.
From table 1 it follows that with the increase of hydrolyzate content, instantaneous conversion rate and stable conversion rate all show by
It is cumulative to add, reach peak value downward trend again.The peak value of instantaneous conversion efficiency (FCR) is 53.56%, is selecting 0.020mg/mL
Enzymolysis liquid treatment conditions under obtain, stable transformation efficiency (FST) be then 0.030mg/mL enzymolysis liquids processing after obtain
(37.48%).It is that processing 3min turns respectively to select the enzymolysis liquid of same concentrations to carry out the processing instantaneous conversion efficiency of different time
Change efficiency 71.00%, treated within 53.75%, 12 and 15 minute when the transformation efficiency of 6min is 63.03%, 9min instantaneously turns
Rate is 42.89% and 43.56% respectively, and with the extension of processing time, transformation efficiency is gradually reduced, and below
The transformation efficiency of 76.46% control treatment.And the transformation efficiency stablized then shows as first rising, the peak Distribution declined afterwards,
Highest 38.33% is obtained when handling 9min.
The present invention selects corn Agrobacterium-mediated Transformation receptor as acceptor material, in the premise for not increasing conversion operation difficulty
Under, enzymolysis processing is carried out to improve Agrobacterium-mediated Transformation efficiency.This research carries out corn Agrobacterium-mediated Transformation receptor in various degree
Enzymolysis processing screens the enzymolysis processing of 0.020g/mL processing 9min and obtains 38.33% transformation efficiency, it is established that is beautiful
Rice Agrobacterium-mediated Transformation receptor is the high-efficiency agrobacterium transformation system of acceptor material.
Embodiment 3
A kind of construction method of insect-resistant transgenic corn that stablizing heredity, its step are as follows：
Plant Transformation overexpression vector is built：
The present invention using nucleotide sequence Bt insecticidal protein genes cry1C* as shown in SEQ ID NO.1 as purpose gene,
The target gene and constitutive promoter Ubi are connected in the multiple cloning sites of plasmid pHZM3 and obtain transgene carrier (figure
1).The Bt insecticidal protein genes cry1C* preferably uses restriction enzyme BamHI and HindIII to carry out digestion and connection instead
It answers, is connected in the multiple cloning sites of plasmid pHZM3.
PHZM3 carrier double digestion system total volumes are 40 μ L, wherein (being purchased from containing 8 μ L of pHZM3 plasmids, 10 × K buffer solutions
Takara) 4 μ L, BamH I and each 1 μ L of Hind III, 24 μ L of distilled water.Purifying recycling respectively after 37 DEG C of digestions overnight.Connection is anti-
It includes 10 × T4 connections buffer solution, 1 μ L, T4DNA ligase, 1 μ L, cry1C* genes to answer in system and carrier pHZM3 is respectively 4 μ L
With 1 μ L, it is used in combination distilled water polishing to 10 μ L, 16 DEG C of connections are overnight.Bacillus coli DH 5 alpha is converted with whole connection products later
Competent cell, and screened in the LB solid plates containing 100mg/L kanamycins, the positive monoclonal detected through PCR is sent
Sequencing, the errorless monoclonal of sequence extract recombinant plasmid.Using freeze-thaw method (with reference to Pehanorm Brooker, Huang Peitang is translated,《Molecule gram
Grand experiment guide》The third edition, Science Press, 2002) recombinant plasmid is transferred in Agrobacterium tumefaciems EHA105 and is preserved.
The acquisition of transfer-gen plant：
Using the method for transformation described in Example 1 and Example 2 of the present invention, using based on corn Agrobacterium-mediated Transformation receptor
Agriculture bacillus mediated corn transformation method infects conversion HiII corn Agrobacterium-mediated Transformation receptors.Infect rear 19 DEG C of light cultures 3 days,
Screening and culturing medium screening and culturing 2~3 containing 2mg/L bialaphos is transferred to after being transferred to renewal cultivation 7~10 days to take turns, often take turns 20~
30 days.The callus with Herbicid resistant is gone into differential medium seedling differentiation after screening, obtains T0 generation conversion single plants.
By 3 wheel bialaphos screenings, 28 resistant callis are obtained, differentiation has obtained 87 plants of transgenosis T0 for plant, each
Resistant calli breaks up to obtain 2~4 plants of transfer-gen plants, is named as ZmKc.
The detection of transfer-gen plant：
T0 is extracted for the leaf DNA of transfer-gen plant using CTAB methods, uses target gene detection primer btR/btF and screening
Marker gene primer barR/barF carries out transfer-gen plant PCR detections.Obtain the transfer-gen plant of 62 plants of PCR positives.
The extraction of genomic DNA --- CTAB methods (Soyle et al.)：
1) 5g blades, liquid nitrogen grinding is taken to be added in 50mL centrifuge tubes at powder (not making material melts)；
2) 15mL1.67XCTAB Buffer are added to mix well, 65 DEG C of water-baths 1 hour；
3) it is cooled to room temperature, 15mL chloroforms/isoamyl alcohol (24 is added:1) it, jiggles and is mixed into emulsion, later
10000rpm is centrifuged 15 minutes；
4) supernatant is transferred to clean centrifuge tube, the absolute ethyl alcohol for adding 2 times of volumes to be pre-chilled gently is overturned for several times, ticked
DNA is put into the 10mL centrifuge tubes of another cleaning；
5) twice of 75% ethyl alcohol cleaning DNA, drying at room temperature 2~3 hours；
6) 1.5mL centrifuge tubes are transferred to after 500 μ L deionized water dissolvings DNA, add 5 μ L RNase (10mg/mL), 37 DEG C
Processing 1 hour；
7) 500 μ L phenol are added, mix well, centrifuge 5 minutes, supernatant is transferred to another new centrifuge tube；
8) it is separately added into 250 μ L phenol and chloroform, is mixed well, is centrifuged 5 minutes, supernatant is transferred to another new centrifuge tube；
9) 500 μ L chloroforms are added, mix well, centrifuge 5 minutes, supernatant is transferred to clean 10mL centrifuge tubes；
10) plus deionized water is to 3mL, and the precooling absolute ethyl alcohol of 2 times of volumes of 3MNaAche of 1/10 volume is then added,
It turns upside down for several times；
11) DNA that the cleaning of 75% ethyl alcohol is settled out twice, is transferred in 1.5mL centrifuge tubes, drying at room temperature and 500 μ of redundancy
L deionized waters；
12) spectrophotometric determination DNA concentration.
The PCR of transfer-gen plant is detected：
1) PCR reacts primer：Use target gene sequence design PCR primer Cry1C*-F：
Gtccgttgaaagtgaatgat-3 and Cry1C*-R：Acacttacaagtggactc, target fragment 540bp；
2) PCR reaction systems：20 μ LPCR systems are prepared, including 30ng template DNAs, 2.0 μ L 10 × buffer, 1.0 μ
L2mMdNTPs, 1.5 μ L25mM MgCl2,0.4 10 μM of μ L primers and 1.5U Taq enzymes；
3) PCR response procedures：Amplification-uses 94 DEG C of denaturation 5min of program in PCR instrument；94 DEG C of denaturation 40s；55 DEG C of annealing
45s；72 DEG C of extension 50s；Totally 35 cycles；72 DEG C of extension 5min；
4) PCR product detects (Fig. 2) using 0.8% agarose gel electrophoresis.3-8 swimming lanes are respectively independent transformation single plant
DNA is the band that template carries out PCR amplification, obtains the specific band with the 540bp of positive control same size.In Fig. 2,
Swimming lane 1：DNA molecular amount marks BM2000；Swimming lane 2：Plasmid template positive control；Swimming lane 3-8：Independent transformation single plant DNA is mould
Plate PCR detections.
Cry1C* protein content ELISA methods measure：
It chooses the positive single plant of PCR detections and carries out ELISA reaction detection Cry1C* albumen concentration.In dough stage, carry respectively
Take the different tissues of transgenosis single plant：Blade, bract, tassel, stem, female fringe, cob, pollen and seed.Each sample takes 20mg
Fresh blade, it is uniform in the grinding of 500 μ L Extraction buffers, it stands 30 minutes 20 μ L of Aspirate supernatant and 480 μ L extraction bufferings is added
Liquid.After ELISA reactions, using being detected under microplate reader (Multiskan MK3, Labsystem, P.R.China) 450nm wavelength,
Result according to detection can calculate Cry1C* protein contents.Testing result is shown in converting material ZmKc-2-3
3.43 μ g/g in fresh leaf, 3.36 μ g/g in bract, 2.71 μ g/g in tassel, 0.99 μ g/g in stem, 0.79 μ g/g in female fringe, cob
In 2.71 μ g/g, 0.19 μ g/g in pollen, 0.09 μ g/g (Fig. 3 a) in seed.Variation tendency is cry1C* albumen in nutrition organs
Content is higher than reproductive organs, and the protein content is minimum in seed.
Field resistance detects
Field planting T3 in 2011 is for transgenic line ZmKc-2-3, ZmKc-3-2,58 background of ZmKc-3-5 strains and Zheng
ZmKc-2-3 Backcross introgression materials, with inbred Zheng 58 be control, the time of infertility not applying pesticides carry out field resistance identification,
Ostrinia furnacalis under natural conditions is assessed to injure.The ratio that the 15th day statistics blade is injured after insect pest occurs, compares 58 leaf of Zheng
Piece has 43.71% by major injury, averagely has 5.75 blades to be compromised, and the damage of transgenosis single-strain blade is no more than 0.02
It is a.To be generated to grow to milk stage, it is 39.36% by insect pest ratio that statistics stalk, which is caused the ratio of tassel death, control by brill moth, and
Transfer-gen plant damages (Fig. 3 b) almost without by insect pest.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Hua Zhong Agriculture University
<120>The preparation method and agriculture bacillus mediated corn transformation method of a kind of corn Agrobacterium-mediated Transformation receptor
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1018
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
cacaggtgcg gtctgcgtcg agagttggtc cactggcagg ccggaatgaa gaagtgcgcg 60
tcggagctgg agctggaggc gttcatccgg gagagcggcg aggacgcccg cgccgccgcc 120
ggaggtagca gtccggggtg cggtggatca agcgatcccg gagggagtgg cgtcttctca 180
cccggcttcg gtttcgccga ctcggacacc atggatggag gcagttggtg gtacgggaac 240
gtccgcacgc cgaacccagt catgtcgcag gcggcgtcca tatccgctag ccccgggcta 300
accacctcag ccaatcatgc tcttgaaagc gagtcagact ccgacagcga atcactgtat 360
gaggtagagg gagttccata cgagcgaggt aacagatcca ttgagacgaa gcgaataaga 420
aggatggtgt ccaataggga gtctgcgcgg cggtctagga ggaagaaaca ggcacagttg 480
tctgacctgg agtcacaggt tgaacgactc aaaggtgaaa acgcaacact gttccagcaa 540
ctttcagatg ccaaccaaca gttcagtact gcagtcacag acaacagaat cctcaaatcc 600
gatgtagaag cgttaagaat taaggtaaag atggcagagg atatggtagc gagaagtgct 660
gtatcgtgtg gcctaggcga ccttggcctg gcaccatacg tgaactcaag gaagatgtgc 720
caagctttga atgtgctcac agggttggat ttactaggga gtgatgcgtt caggggtcca 780
accgcggtac acgagtacag aactcaccag kacagagcac tgcaagccta gagagtctgg 840
ataaccgaaa gtccaacgag gtgaccagkt tgcgcggcgg acatttggcc ttgagcttca 900
agccrttgat ctgattcaag cttgctccrc cctcaaaaaa aggaccagag tttgtcactc 960
aaatagctgg tggcttgagc rggcttctgg cacgagttct cttgaacata tttccaca 1018
Claims (7)
1. a kind of preparation method of corn Agrobacterium-mediated Transformation receptor, includes the following steps：
1) maize immature embryos are subjected to Fiber differentiation, obtain loose II type callus；
2) the loose II type callus that step 1) obtains is digested, obtains competence II type callus cells, i.e.,
Corn Agrobacterium-mediated Transformation receptor；The enzymolysis enzyme includes cellulase and pectase.
2. preparation method according to claim 1, which is characterized in that the kind of the corn include Hi-II, A188,
C01,18-599R, neat 319 or H99.
3. preparation method according to claim 1, which is characterized in that the quality of step 1) cellulase and pectase
Than being 1:1.
4. preparation method according to claim 1, which is characterized in that step 1) it is described enzymolysis be：In the enzymolysis enzyme
Total concentration be 0.010~0.040g/mL under the conditions of, digest 6~12min.
5. Agrobacterium Jie based on the corn Agrobacterium-mediated Transformation receptor that preparation method described in Claims 1 to 4 any one obtains
The corn transformation method led, includes the following steps：
Target gene is transferred to what preparation method described in Claims 1 to 4 any one obtained using agriculture bacillus mediated method
In corn Agrobacterium-mediated Transformation receptor；
The corresponding transgenosis empty carrier of the target gene is pHZM3 plasmids.
6. the T based on method for transformation described in claim 50For the breeding method of maize transformation plant, include the following steps：
A) using nucleotide sequence, the Bt insecticidal protein genes cry1C* as shown in SEQ ID NO.1 is purpose gene, by the mesh
Gene be connected to target genetic region on plasmid pHZM3, obtain transgene carrier pHZM3-cry1C*；
B) according to method for transformation described in claim 5, the transgene carrier is transferred in the corn Agrobacterium-mediated Transformation receptor,
3~5d is co-cultured, the callus of foreign gene transient expression is obtained；
C) callus of the obtained foreign gene transient expressions of step b) is subjected to 7~10d of renewal cultivation, obtains conversion callus
Tissue；
D) by the obtained transformed callis of step c) be placed in the screening and culturing medium containing 2~3mg/L bialaphos carry out 2~
3 wheel screenings, obtain the callus with Herbicid resistant；
E) the obtained callus with Herbicid resistant of the step d) is placed in differential medium and carries out differentiation culture,
Obtain T0For maize transformation plant.
7. the T obtained based on breeding method described in claim 60For the pest-resistant corn breeding method of maize transformation plant, including with
Lower step：
By the T0Selfing or back pollinating are carried out for maize transformation plant, obtains the pest-resistant corn variety of character stabilization.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810374834.7A CN108588120A (en) | 2018-04-24 | 2018-04-24 | The preparation method and agriculture bacillus mediated corn transformation method of a kind of corn Agrobacterium-mediated Transformation receptor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810374834.7A CN108588120A (en) | 2018-04-24 | 2018-04-24 | The preparation method and agriculture bacillus mediated corn transformation method of a kind of corn Agrobacterium-mediated Transformation receptor |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108588120A true CN108588120A (en) | 2018-09-28 |
Family
ID=63614576
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810374834.7A Pending CN108588120A (en) | 2018-04-24 | 2018-04-24 | The preparation method and agriculture bacillus mediated corn transformation method of a kind of corn Agrobacterium-mediated Transformation receptor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108588120A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371061A (en) * | 2018-12-17 | 2019-02-22 | 靖西市秀美边城农业科技有限公司 | A method of improving the maize genetic transformation efficiency of mediated by agriculture bacillus |
| CN109402167A (en) * | 2018-12-07 | 2019-03-01 | 北京林业大学 | A method of carrying out gene transient expression in Chinese pine hypocotyl |
| CN110699376A (en) * | 2019-11-19 | 2020-01-17 | 大连工业大学 | Agrobacterium-mediated transient transformation method for catharanthus roseus |
| CN113430210A (en) * | 2021-06-09 | 2021-09-24 | 吉林大学 | Corn side organ boundary protein gene ZmLBD24 and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101121942A (en) * | 2007-03-26 | 2008-02-13 | 吉林师范大学 | Corn genetic transferring method conducted by agrobacterium rhizogenes |
| CN102433356A (en) * | 2012-01-05 | 2012-05-02 | 广西大学 | Agrobacterium-mediated transgenic method for mature seed embryos of corn |
| CN104745625A (en) * | 2015-03-27 | 2015-07-01 | 四川农业大学 | Method for transforming and cultivating cold-resistant corns by utilizing anti-freezing protein gene |
| CN106520666A (en) * | 2016-12-05 | 2017-03-22 | 天津吉诺沃生物科技有限公司 | Method and special culture medium for efficiently separating, converting and regenerating potato protoplast |
-
2018
- 2018-04-24 CN CN201810374834.7A patent/CN108588120A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101121942A (en) * | 2007-03-26 | 2008-02-13 | 吉林师范大学 | Corn genetic transferring method conducted by agrobacterium rhizogenes |
| CN102433356A (en) * | 2012-01-05 | 2012-05-02 | 广西大学 | Agrobacterium-mediated transgenic method for mature seed embryos of corn |
| CN104745625A (en) * | 2015-03-27 | 2015-07-01 | 四川农业大学 | Method for transforming and cultivating cold-resistant corns by utilizing anti-freezing protein gene |
| CN106520666A (en) * | 2016-12-05 | 2017-03-22 | 天津吉诺沃生物科技有限公司 | Method and special culture medium for efficiently separating, converting and regenerating potato protoplast |
Non-Patent Citations (4)
| Title |
|---|
| CUTLER,S.R. ET AL: "ACCESSION NO. AF218816，Cloning vector pEGAD，complete sequence", 《GENBANK》 * |
| 杜邓襄: "玉米高效转基因体系建立与基于人工Ac/Ds转座子的激活标签突变体生成系的创建", 《中国博士学位论文全文数据库 农业科技辑》 * |
| 王娜 等: "IPP异构酶基因遗传转化对雨生红球藻（Haematococcus pluvialis）虾青素含量的影响", 《海洋与湖沼》 * |
| 高婧: "含抗除草剂标记的水稻叶绿体转化载体的构建及分子鉴定", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402167A (en) * | 2018-12-07 | 2019-03-01 | 北京林业大学 | A method of carrying out gene transient expression in Chinese pine hypocotyl |
| CN109371061A (en) * | 2018-12-17 | 2019-02-22 | 靖西市秀美边城农业科技有限公司 | A method of improving the maize genetic transformation efficiency of mediated by agriculture bacillus |
| CN110699376A (en) * | 2019-11-19 | 2020-01-17 | 大连工业大学 | Agrobacterium-mediated transient transformation method for catharanthus roseus |
| CN113430210A (en) * | 2021-06-09 | 2021-09-24 | 吉林大学 | Corn side organ boundary protein gene ZmLBD24 and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101528934B (en) | Methods for producing transgenic plants | |
| US11479790B2 (en) | Insect-resistant herbicide-tolerant corn transformation event | |
| CN108588120A (en) | The preparation method and agriculture bacillus mediated corn transformation method of a kind of corn Agrobacterium-mediated Transformation receptor | |
| RU2397250C2 (en) | Traceability of transgenic plant seeds during pre- and post-treatment | |
| CN107090464B (en) | Insect-resistant herbicide-resistant corn transformation event and creation method and detection method thereof | |
| CN101358190A (en) | Artificial synthetic high gene order expression high virulence protein for lepidoptera pest and use thereof | |
| CN104770294B (en) | A kind of protocorm based on the sprouting of iris seed is the breeding method of acceptor | |
| CN115449521A (en) | Binary vector for simultaneously expressing insect-resistant gene and herbicide-resistant gene and application thereof | |
| CN116410977A (en) | Insect-resistant glyphosate-resistant transgenic corn event KJ1172 and detection method thereof | |
| CN102725414A (en) | Method for providing mature transgenic recalcitrant plants via induction of bbm during regeneration | |
| CN106544344A (en) | A kind of application of tissue-specific promoter in regulation and control crop yield | |
| CN106834318A (en) | A kind of insect-resistant fusion gene, encoding proteins and its application | |
| CN103409445A (en) | Glyphosate-resistance gene MTP-SMG2-EPSPS and application thereof in cultivation of glyphosate-resistance corn | |
| JP2001515702A (en) | Large-scale mutagenesis of crop plants | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| JP3755876B2 (en) | Method for producing recombinant plant not containing selectable marker, and recombinant plant produced by the method | |
| CN110484545A (en) | A kind of mosaic disease resisting poison GsCAD1 gene separated from wild soybean, coding albumen and its application | |
| CN104830878B (en) | LRK2 genes or its application of coding albumen in promoting rice tillering | |
| CN108070612A (en) | The breeding method of Siraitia grosvenorii parthenocarpy female plant | |
| Gea et al. | Introduction of Hd3a gene in IPB CP1 potato cultivar through Agrobacterium tumefaciens-mediated transformation under the control of use 35S CaMV promoter | |
| CN116574724B (en) | Insect-resistant glyphosate-resistant transgenic corn event KJ1003 and detection method thereof | |
| CN101817875B (en) | Rice adventitious root protruding control gene OsDARE1 and application thereof | |
| US11932862B1 (en) | Genetic regulatory elements | |
| CN101822156B (en) | Method for quickly culturing homozygous transgenic ornamental collard with insect resistance and herbicide resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180928 |
|
| RJ01 | Rejection of invention patent application after publication |