CN108070612A - The breeding method of Siraitia grosvenorii parthenocarpy female plant - Google Patents
The breeding method of Siraitia grosvenorii parthenocarpy female plant Download PDFInfo
- Publication number
- CN108070612A CN108070612A CN201810141772.5A CN201810141772A CN108070612A CN 108070612 A CN108070612 A CN 108070612A CN 201810141772 A CN201810141772 A CN 201810141772A CN 108070612 A CN108070612 A CN 108070612A
- Authority
- CN
- China
- Prior art keywords
- siraitia grosvenorii
- iaam
- female plant
- parthenocarpy
- pbi121
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/823—Reproductive tissue-specific promoters
- C12N15/8235—Fruit-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/829—Female sterility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Pregnancy & Childbirth (AREA)
- Reproductive Health (AREA)
- Botany (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses the breeding methods of Siraitia grosvenorii parthenocarpy female plant, and mosaic gene 2A11 iaaM are integrated into the genome of Siraitia grosvenorii female plant, gene iaaM is made to be expressed in Siraitia grosvenorii female plant, so as to obtain Siraitia grosvenorii parthenocarpy female plant.The present invention is on the basis of plant binary expression vector pBI121 Gus, the Overexpression vector pBI121 2A11 iaaM of chimeric genetic construct 2A11 iaaM, and pass through agriculture bacillus mediated be integrated into the genome of Siraitia grosvenorii female plant, gene iaaM is promoted to be expressed in Siraitia grosvenorii female plant, so as to obtain the parthenocarpy female plant of Siraitia grosvenorii, to formulate transgenosis parthenocarpy Siraitia grosvenorii female germplasm, go deep into its genetics and physiology research, breed of variety etc. and basis is provided.
Description
Technical field
The present invention relates to Siraitia grosvenorii parthenocarpy technical fields.It is more particularly related to a kind of Siraitia grosvenorii unisexuality
The breeding method of solid female plant.
Background technology
Chinese medicine Siraitia grosvenorii (SIRAITIAE FRUCTUS) is Curcurbitaceae perennial root liana Siraitia grosvenorii
The dry fruit of (Siraitia grosvenorii), have refresh oneself promote the production of body fluid, clearing heat and moistening lung, relieving cough and relieving asthma, laxation defaecation it is equivalent
With being the distinctive medicinal and sweetener industrial crops in China, first and second batch is classified as medicine by health ministry, the State Administration of Traditional Chinese Medicines
Eat homologous kind.Modern pharmacology, toxicological study show Siraitia grosvenorii have anti-inflammatory, antiviral, anticancer, anti-oxidant, immunological regulation,
It protects liver, reduce a variety of effects such as blood fat, but have no toxic side effect.The main effective ingredient of Lo Han Guo fruit is cucurbitane Fourth Ring three
Terpene saponin(e with V content highest of sweet tea glycosides, accounts for the 20% of total saponin content, is one of non-saccharide sweet substance most strong in the world,
It is mogroside, is 425 times of 5% sweetness of cane sugar during a ten thousandth concentration, Gao Tian, low-heat, natural, health care have wide
Development prospect and the market space.
But Siraitia grosvenorii has the characteristics that dioecious Developmental Biology, and pollen glues weight and is unfavorable for wind pollination, it is wild
Raw big black bee reduces and influences the insect pollination of cultivar, so, it is necessary to which a large amount of artificial pollinations, can just obtain in cultivation production
Economic benefit, and Siraitia grosvenorii pollen short life under natural conditions, it usually needs that morning completes pollination blooming, and works into
This height, therefore, the problem of " how exempting artificial pollination " in the urgent need to address in Siraitia grosvenorii cultivation production.In addition, Siraitia grosvenorii
Without sweet tea glycosides and containing substantial amounts of grease in seed, mouthfeel is not only influenced, and adds the difficulty of extraction purification and is processed into
This.Although having the report of triploid seedless monordica grosvenori research, because of the reasons such as fruit is small, growth period is short, there is no can answer so far
For the triploid improved seeds of production.Therefore, how to exempt artificial pollination and realize that fruit is Siraitia grosvenorii industrialization without seed
Technical barrier urgently to be resolved hurrily in development.
Parthenocarpy refers to the phenomenon that ovary forms stenospermocarpy without fertilization, believes with auxin signal or gibberellin
Number approach etc. is related.Parthenocarpy plant body have setting percentage is high, best in quality, fruit without seed, without malformed fruit, heredity can be stablized
Etc. advantages, be the important goal pursued in eating, process and producing.In addition to heritable parthenocarpy of naturally occurring,
Can also parthenocarpy be obtained by hormone induction, transgenic technology etc..The patent of invention of Application No. 201410244509.0
It discloses and the ovary wall of Siraitia grosvenorii is handled on the day of Siraitia grosvenorii is bloomed using hormone CPPU or 2,4-D, so as to induce sieve
The method of Chinese fruit parthenocarpy, but HORMONE TREATMENT technology is more demanding, concentration is difficult to control, easily generate malformed fruit, it is necessary to compared with
More labourer's power, it is unhealthful also there are hormone residues, therefore should not promote use on producing.It is new to cultivate parthenocarpy Siraitia grosvenorii
The main bugbear for the artificial pollination that germplasm can not only overcome it in the urgent need to address in producing, can also solve pollination can bring fruit
There is the problem of seed, be the optimal selection of Siraitia grosvenorii industrialized development and breeding and hot spot forward position.
At present, with the method for genetic engineering, it is transferred to endogenous hormones metabolism or the relevant gene of signal transduction to induce
Parthenocarpy so as to obtain stenospermocarpy, has become the main means of genetically engineered plant, in tomato, eggplant, strawberry, tree
Transgenosis parthenocarpy plant is obtained in the species such as the certain kind of berries and muskmelon, such as：IaaM genes are mainly derived from Agrobacterium tumefaciems and vacation
Sporangium, codes for amino acid tryptophan monooxygenase, using tryptophan synthesis of indole acetic acid, so as to improve growth cellulose content, by iaaM
The mosaic gene formed with ovary or young fruit specific promoter is imported in plant, using it in florescence and fruit development early stage
Expression can induce the parthenocarpy using fruit as the plant of main harvest object such as eggplant, tomato.But there is presently no on sieve
The report of Chinese fruit transgenosis parthenocarpy.
The content of the invention
The present invention is to provide a kind of breeding method of Siraitia grosvenorii parthenocarpy female plant there are one purpose, is expressed in plant binary
On the basis of carrier pBI121-Gus, the Overexpression vector pBI121-2A11-iaaM of 2A11-iaaM is built, and passes through crown gall agriculture
Bacillus EHA105 is mediated, and is integrated into the genome of Siraitia grosvenorii female plant, and gene iaam is promoted to be obtained in Siraitia grosvenorii female plant
Expression so as to obtain the parthenocarpy female plant of Siraitia grosvenorii, to formulate transgenosis parthenocarpy Siraitia grosvenorii female germplasm, gos deep into its something lost
It passes physiological Study, breed of variety etc. and basis is provided.
In order to realize these purposes and further advantage according to the present invention, a kind of Siraitia grosvenorii parthenocarpy female plant is provided
Mosaic gene 2A11-iaaM is integrated into the genome of Siraitia grosvenorii female plant by breeding method, makes gene iaaM in Siraitia grosvenorii female plant
It is expressed, so as to obtain Siraitia grosvenorii parthenocarpy female plant.
Preferably, the breeding method of the Siraitia grosvenorii parthenocarpy female plant, will be chimeric with Agrobacterium_mediated method
Gene 2A11-iaaM is integrated into the genome of Siraitia grosvenorii female plant.
Preferably, the breeding method of the Siraitia grosvenorii parthenocarpy female plant, the mistake of the Agrobacterium_mediated method
Cheng Wei：Using being transferred to plant expression vector pBI121-2A11-iaaM's in the During Callus Induction of female plant Siraitia grosvenorii
Agrobacterium is infected, and successively by squamous subculture, Multiplying culture, culture of rootage obtain Siraitia grosvenorii female plant seedling, using point
Son detection screening obtains the Siraitia grosvenorii female plant seedling of gene iaaM expression, Siraitia grosvenorii list will be obtained after its hardening, transplanting and identification
The solid female plant of property.
Preferably, the breeding method of the Siraitia grosvenorii parthenocarpy female plant, the tool of the Agrobacterium_mediated method
Body step includes：
A, the specific steps of female plant Siraitia grosvenorii During Callus Induction include：
A1, the disk that Siraitia grosvenorii female plant aseptic blade is got to multiple a diameter of 0.5cm with sterilized card punch, by circle
The back side of piece and vein scratch, and are seeded on the first inducing culture, and preculture obtains to infect for 4 days under dark condition uses arhat
Fruit leaf dish, the formula of first inducing culture are：MS+TDZ0.7mg/L+IBA0.5mg/L；
A2, infecting after step A1 inductions is dipped to the agriculture for being transferred to pBI121-2A11-iaaM with Siraitia grosvenorii leaf dish
In bacillus bacterium solution, 150rpm vibrates 10min, the OD of the Agrobacterium bacterium solution at 28 DEG C600For 0.3-0.5；
A3, the Siraitia grosvenorii leaf dish that step A2 is obtained is seeded on the second inducing culture, 3 is co-cultured under dark condition
My god, the formula of second inducing culture is：MS+TDZ0.7mg/L+IBA0.5mg/L+AS100μM；
A4, the 3rd induction is seeded to after the Siraitia grosvenorii leaf dish that step A3 is obtained is blotted with sterile water wash, aseptic filter paper
On culture medium, under illumination condition culture is selected to obtain callus in two weeks, the formula of the 3rd inducing culture is：MS+
TDZ0.7mg/L+IBA0.5mg/L+Kan5mg/L+Cef300mg/L；
B, the process of squamous subculture be by callus in step A4 with being seeded to after sterile water wash on differential medium,
Squamous subculture is to generation adventitious bud, the formula of the differential medium is broken up under illumination condition：MS+TDZ0.7mg/L+
IBA0.5mg/L+GA30.5mg/L+ brassin lactones 0.5mg/L+Kan5mg/L+Cef100mg/L；
C, the callus of differentiated generation adventitious bud is forwarded to proliferated culture medium, multiplication training is carried out under illumination condition
It supports, the formula of the proliferated culture medium is：MS+6-BA0.5mg/L+IBA0.2mg/L+Kan5mg/L+Cef100mg/L；
D, when adventitious bud length is to more than 2cm during Multiplying culture, adventitious bud is cut, and is inserted into root media, is closed
Culture of rootage is carried out according under the conditions of is to adventitious root, the formula of the root media is grown：MS+NAA0.5mg/L+
IBA0.2mg/L+Kan5mg/L+Cef100mg/L。
Preferably, the breeding method of the Siraitia grosvenorii parthenocarpy female plant, illumination condition are：Illumination temperature 25 ± 1
DEG C, intensity of illumination 2000lx, light application time 12h/d.
Preferably, the breeding method of the Siraitia grosvenorii parthenocarpy female plant, the preparation method of the Agrobacterium bacterium solution
It is as follows：The Agrobacterium bacterium solution of plant expression vector pBI121-2A11-iaaM is transferred to from 80 DEG C of refrigerator taking-ups of ﹣, additional
Kan50 μ g/mL, rif 20 μ g/mL YEB solid plates on rule, 28 DEG C of culture 48h, then picking single bacterium colony, inoculation
It is added to 10mL in the YEB fluid nutrient mediums of 50 μ g/mL of Kan, rif 20 μ g/mL, in 28 DEG C, 200rpm shaken cultivation 48h,
Purpose bacterium bacterium solution is obtained, purpose bacterium bacterium solution 1mL is taken to add in the YEB fluid nutrient mediums for the antibiotic-free that 50mL is newly prepared, is added simultaneously
Enter 100 μM of AS, in 28 DEG C, 200rpm shaken cultivations 6h so that bacterium solution OD600For 0.3-0.5.
Preferably, the breeding method of the Siraitia grosvenorii parthenocarpy female plant, includes the plant of mosaic gene 2A11-iaaM
The construction method of object expression vector pBI121-2A11-iaaM is：
1) intermediate carrier pBI121-2A11 is built：PMD-2A11 plasmids and pBI121-Gus plasmids are used into HindIII respectively
With XbaI double digestions and be separately recovered to obtain linear pBI121 genetic fragments and 2A11 genetic fragments, by above-mentioned two gene piece
Section connection obtains intermediate carrier pBI121-2A11；
2) pBI121-2A11-iaaM carriers are built：PMD-iaaM plasmids and intermediate carrier pBI121-2A11 are used respectively
XbaI and XmaI double digestions simultaneously are separately recovered to obtain linear pBI121-2A11 genetic fragments and iaaM genetic fragments, will be above-mentioned
Two genetic fragments connect to obtain pBI121-2A11-iaaM carriers.
Preferably, the breeding method of the Siraitia grosvenorii parthenocarpy female plant, the specific method of the Molecular Detection are：
The cauline leaf of the Siraitia grosvenorii female plant seedling of adventitious root has been born using CTAB method Trace bio-elements, has utilized the three sets of special primers designed
PCR amplification detection is carried out, wherein three sets of special primers are respectively：For the spy of fruit differential promoter 2A11 sequence designs
Different primer pair 2A11F/R, sequence are followed successively by shown in SEQ ID NO.1 and SEQ ID NO.2；For iaaM gene sequence
The special primer of design is arranged to iaaM F/R, sequence is followed successively by shown in SEQ ID NO.3 and SEQ ID NO.4；Simultaneously across part
The special primer of target gene iaaM sequences and partial promoter 2A11 sequence designs is followed successively by SEQ ID to AI C F/R, sequence
Shown in NO.5 and SEQ ID NO.6.
The present invention includes at least following advantageous effect：
1) method that the present invention uses genetic engineering, makes target gene iaam be expressed in Siraitia grosvenorii female plant, obtains
The Siraitia grosvenorii female plant of stenospermocarpy can not be generated by artificial pollination, this method not only overcomes people in Siraitia grosvenorii actual production
Work pollination is difficult to and pollinates and can lead to the problem of fruit and have seed, also avoids easily producing using hormone induction Siraitia grosvenorii parthenocarpy
, there are hormone residues in raw malformed fruit, and the Siraitia grosvenorii parthenocarpy female plant that obtains of this method have it is higher solid
Rate, and fruit quality is excellent, parthenocarpy shape-stable heredity；
2) 2A11 promoters are derived from the fruit specific expression promoter of tomato, have good driving foreign gene
The promoter activity of tissue specific expression, the present invention promote iaaM genes to exist by the way that 2A11 is connected with target gene iaaM
Preferably expression is obtained in Siraitia grosvenorii, so as to cultivate Siraitia grosvenorii parthenocarpy female plant；
3) mosaic gene 2A11-iaaM, using Agrobacterium as mediation, is integrated into Siraitia grosvenorii by the present invention using leaf disc transformation method
In female plant, gene iaaM is made to be expressed in Siraitia grosvenorii female plant, this method is classical, transformation efficiency is high, with respect to other methods,
Such as, it is simpler to equipment requirement, cheap, beneficial to operation compared to Gene Knock-out Mice.
Part is illustrated to embody by further advantage, target and the feature of the present invention by following, and part will also be by this
The research and practice of invention and be understood by the person skilled in the art.
Description of the drawings
Fig. 1 is the intermediate carrier pBI121-2A11 collection of illustrative plates of vector construction in the embodiment of the present invention 2；
Fig. 2 is the electrophoretogram after pBI121-Gus and 2A11 plasmid double digestions in the embodiment of the present invention 2；
The PCR that Fig. 3 is pBI121-Gus and 2A11 recombinant plasmids in the embodiment of the present invention 2 detects product electrophoretogram；
Fig. 4 is pBI121-2A11-iaaM collection of illustrative plates in the embodiment of the present invention 2；
Fig. 5 turns 2A11-iaaM gene resistant buds DNA for 15 and extracts result figure；
Fig. 6 is for special primer to 2A11F/R to the testing result figure of 15 pBI121-2A11-iaaM resistant plants；
Fig. 7 is for special primer to iaaM F/R to the testing result figure of 15 pBI121-2A11-iaaM resistant plants；
Fig. 8 is for special primer to AI CF/R to the testing result figure of 15 pBI121-2A11-iaaM resistant plants.
Specific embodiment
The present invention is described in further detail below in conjunction with the accompanying drawings, to make those skilled in the art with reference to specification text
Word can be implemented according to this.
It should be noted that experimental method described in following embodiments, is conventional method unless otherwise specified, institute
Reagent and material are stated, unless otherwise specified, is commercially obtained.
In reagent and material of the present invention, TDZ Thidiazurons, IBA indolebutyric acids, AS acetosyringones, GA3 are red mould
Element, NAA methyl α-naphthyl acetates, 6-BA6- benzyls aminoadenine, Kan cards receive mycin, rif rifampins, cef cephalosporins.
Embodiment 1：A kind of breeding method of Siraitia grosvenorii parthenocarpy female plant, sieve is integrated by mosaic gene 2A11-iaaM
The genome of Chinese fruit female plant, makes gene iaam be expressed in Siraitia grosvenorii female plant, so as to obtain Siraitia grosvenorii parthenocarpy female plant.
In the present embodiment, mosaic gene 2A11-iaaM in plant Overexpression vector pBI121-2A11-iaaM is integrated into arhat
The genome of fruit female plant can be realized by particle gun.
Embodiment 2：A kind of breeding method of Siraitia grosvenorii parthenocarpy female plant, sieve is integrated by mosaic gene 2A11-iaaM
The genome of Chinese fruit female plant, makes gene iaam be expressed in Siraitia grosvenorii female plant, so as to obtain Siraitia grosvenorii parthenocarpy female plant.
In the present embodiment, mosaic gene 2A11-iaaM is integrated into the genome of Siraitia grosvenorii female plant, is with Agrobacterium_mediated method
The genome that plant expression vector pBI121-2A11-iaaM is integrated into Siraitia grosvenorii female plant is realized.
The process of the Agrobacterium_mediated method is：It utilizes and has turned in the During Callus Induction of female plant Siraitia grosvenorii
The Agrobacterium for entering plant expression vector pBI121-2A11-iaaM is infected, and successively by squamous subculture, Multiplying culture, life
Root culture obtains Siraitia grosvenorii female plant seedling, and the Siraitia grosvenorii female plant seedling for obtaining gene iaaM expression is screened using Molecular Detection, will
Siraitia grosvenorii parthenocarpy female plant is obtained after its hardening, transplanting and identification.
Wherein, the specific steps of the Agrobacterium_mediated method include：
A, the specific steps of female plant Siraitia grosvenorii During Callus Induction include：
A1, the disk that Siraitia grosvenorii female plant aseptic blade is got to multiple a diameter of 0.5cm with sterilized card punch, by circle
The back side of piece and vein scratch, and are seeded on the first inducing culture, and preculture obtains to infect for 4 days under dark condition uses arhat
Fruit leaf dish, the formula of first inducing culture are：MS+TDZ0.7mg/L+IBA0.5mg/L；
It should be noted that the preparation method for the Siraitia grosvenorii female plant that step A1 is used is as follows：Plantation is taken in the medicinal plant in Guangxi
The Siraitia grosvenorii female plant bloomed of object garden Experimental Base chooses the tender Siraitia grosvenorii stem section with axillary bud of children, with 75% alcohol disinfecting
30s, 0.1%HgCl210min is sterilized, sterile distilled water rinses 5 times, blots stem section surface moisture with aseptic filter paper afterwards, and will
Stem section is inoculated in MS culture mediums, is placed in constant temperature illumination box and is carried out tissue cultures, set temperature is 25 ± 1 DEG C, and illumination is strong
It spends and is derived from for 2000lx, light application time 12h/d.
A2, by infecting to be dipped to Siraitia grosvenorii leaf dish and be transferred to plant expression vector pBI121- after step A1 inductions
In the Agrobacterium bacterium solution of 2A11-iaaM, 150rpm vibrates 10min, the OD of the Agrobacterium bacterium solution at 28 DEG C600For 0.3-
0.5；
A3, the Siraitia grosvenorii leaf dish that step A2 is obtained is seeded on the second inducing culture, 3 is co-cultured under dark condition
My god, the formula of second inducing culture is：MS+TDZ0.7mg/L+IBA0.5mg/L+AS100μM；
A4, the 3rd induction is seeded to after the Siraitia grosvenorii leaf dish that step A3 is obtained is blotted with sterile water wash, aseptic filter paper
On culture medium, under illumination condition culture is selected to obtain callus in two weeks, the formula of the 3rd inducing culture is：MS+
TDZ0.7mg/L+IBA0.5mg/L+Kan5mg/L+Cef300mg/L；
B, the process of squamous subculture be by callus in step A4 with being seeded to after sterile water wash on differential medium,
Squamous subculture is to generation adventitious bud, the formula of the differential medium is broken up under illumination condition：MS+TDZ0.7mg/L+
IBA0.5mg/L+GA30.5mg/L+ brassin lactones 0.5mg/L+Kan5mg/L+Cef100mg/L；
C, the callus of differentiated generation adventitious bud is forwarded to proliferated culture medium, multiplication training is carried out under illumination condition
It supports, the formula of the proliferated culture medium is：MS+6-BA0.5mg/L+IBA0.2mg/L+Kan5mg/L+Cef100mg/L；
D, when adventitious bud length is to more than 2cm during Multiplying culture, adventitious bud is cut, and is inserted into root media, is closed
Culture of rootage is carried out according under the conditions of is to adventitious root, the formula of the root media is grown：MS+NAA0.5mg/L+
IBA0.2mg/L+Kan5mg/L+Cef100mg/L。
Wherein, induction of callus process, Subculture, Multiplying culture process and process of rooting culture
In, illumination condition is：25 ± 1 DEG C of illumination temperature, intensity of illumination 2000lx, light application time 12h/d.
Wherein, the preparation method of the Agrobacterium bacterium solution is as follows：PBI121-2A11- has been transferred to from 80 DEG C of refrigerator taking-ups of ﹣
The Agrobacterium bacterium solution of iaaM is rule on the YEB solid plates for adding 50 μ g/mL of Kan, rif 20 μ g/mL, 28 DEG C of trainings
48h is supported, then picking single bacterium colony, is inoculated into 10mL and adds in the YEB fluid nutrient mediums of 50 μ g/mL of Kan, rif 20 μ g/mL,
In 28 DEG C, 200rpm shaken cultivation 48h, obtain purpose bacterium bacterium solution, take purpose bacterium bacterium solution 1mL add in 50mL newly prepare without antibiosis
The YEB fluid nutrient mediums of element, while 100 μM of AS is added in, in 28 DEG C, 200rpm shaken cultivations 6h so that bacterium solution OD600For
0.3-0.5。
Wherein, the construction method of pBI121-2A11-iaaM is：1) intermediate carrier pBI121-2A11 is built：By pMD-
2A11 plasmids and pBI121-Gus plasmids through HindIII and XbaI double digestions and are separately recovered to obtain linear pBI121 bases respectively
Because of segment and 2A11 genetic fragments, above-mentioned two genetic fragment is connected to obtain intermediate carrier pBI121-2A11；
2) pBI121-2A11-iaaM carriers are built：PMD-iaaM plasmids and intermediate carrier pBI121-2A11 are passed through respectively
Xba and XmaI double digestions simultaneously are separately recovered to obtain linear pBI121-2A11 genetic fragments and iaaM genetic fragments, by above-mentioned two
A genetic fragment connects to obtain pBI121-2A11-iaaM carriers.
The building process specific method of plant expression vector pBI121-2A11-iaaM is as follows：
1) carrier and target fragment plasmid extraction
The pBI121-Gus bacterium solutions for being stored in -80 DEG C of refrigerators are inoculated into the LB fluid nutrient mediums of the 50 μ g/mL containing Kan,
37 DEG C of constant temperature, 200rpm overnight shaking cultures.With aseptic inoculation ring in the above-mentioned bacterium solution of superclean bench picking, and in μ containing Kan50
Line culture draws single bacterium colony on the LB solid mediums of g/mL.Culture is enlarged with sterile pipette tips picking single bacterium colony.pMD-
The expansion cultural method of 2A11 and pMD-iaaM bacterium solutions is same as above, and the antibiotic and antibiotic concentration wherein added in LB culture mediums is
Amp 50μg/mL.According to a small amount of extraction agent box (Sangon) specifications of SanPrep pillar Plasmid DNA to above-mentioned expansion culture
Bacterium solution afterwards carries out plasmid extraction, and 3 μ L plasmid DNA samples is taken to carry out electrophoresis detection with 1% Ago-Gel, observes plasmid
The quality and integrality of DNA extractions measure the concentration and purity of DNA with ultramicron ultraviolet specrophotometer.
2) connection of pBI121-Gus and 2A11
Since iaaM gene orders include III restriction enzyme sites of Hind, so in vector construction, promoter is first connected
2A11 reconnects target gene iaaM.
PMD-2A11 plasmids and the reaction of pBI121-Gus plasmids double digestion use III restriction enzyme of XbaI and Hind, instead
Answering condition, endonuclease reaction system is shown in Table 1 for 37 DEG C of 2h.By above-mentioned endonuclease reaction product carry out respectively gel extraction target fragment and
Carrier segments, and detect the quality and concentration of recycling segment.Prepare coupled reaction system：10×T4DNA Ligase Buffer
2.5 μ L, 4.5 μ L of target gene, carrier 1.5 μ L, T4DNA Ligase (350U/ μ L) 1.5 μ L add water to total volume 20 μ L, and 16
DEG C water-bath connection is overnight.
Connection product is converted into DH5 α competent cells, conventional coated plate is in the Kan (50 μ g/mL) containing IPTG, X-gal sum
LB solid plate culture mediums on (press《Molecular cloning》Middle respective description operation), overnight incubation, random picking conversion tablet
During white single bacterium is fallen on LB fluid nutrient mediums added with 50 μ g/mL of Kan, 37 DEG C of constant temperature, 200r/min shaking table cultures are stayed overnight；
Positive colony is identified by bacterium solution PCR, the bacterial plaque of positive colony is extracted into plasmid, digestion detection determines positive colony bacterium again
Spot obtains the medial expression vector pBI121-2A11 with target gene.
Table 1pMD-2A11 and pBI121-Gus plasmid double digestion reaction system
HindIII and XbaI is selected to carry out digestion to pBI121-Gus and pMD-2A11 respectively, cuts pBI121- respectively
The CaMV35S promoters recycling large fragment linearisation plant binary expression vector of Gus, cuts pMD carrier Ts recycling small fragment
2A11 is connected into the collection of illustrative plates after pBI121-Gus carriers and is seen Fig. 1 by 2A11.Wherein, the double digestion result of 2A11 plasmids is drawn
The target fragment of 1300bp or so and the pMD 19T simple vector segments of 2700bp or so are shown in Fig. 2, M tables in wherein Fig. 2
Show DL 15000DNA Marker；1-6 is the double digestion of pBI121-Gus；7 be 2A11 plasmid controls；8-9 is 2A11 double digestions.
After 2A11 is connected with linearisation pBI121-Gus, transformed competence colibacillus bacillus coli DH 5 alpha, coated plate is chosen on blue and white screening tablet
8 bacterial plaques are taken, the electrophoresis by PCR detection products is shown in Fig. 3, and M represents DL 2000DNA Marker in wherein Fig. 3；1-8 is represented
Recombinant plasmid bacterial plaque, this 8 bacterial plaques are all positive, 1,2, No. 3 bacterial plaques are selected to do double digestion verification, result is the positive.
3) connection of iaaM and intermediate carrier pBI121-2A11
PMD-iaaM plasmids and the reaction of pBI121-2A11 plasmids double digestion use XbaI and XmaI restriction enzymes, instead
Answering temperature conditionss, reaction system is shown in Table 2, the same step 2 of connection method for 37 DEG C.Obtain chimeric viral vectors pBI121-2A11-
iaaM.Primer pair (across promoter and target gene overall length) AI1F and AI1R is designed, is detected for follow-up PCR.Using AI1F (see
3 sequence number SEQ ID NO.7 of table) and AI1R (being shown in Table 3 sequence number SEQ ID NO.8) primer pair disposably amplify and include
The sequence of 2A11 and iaaM genes is T clones, sends to the sequencing of Hua Da gene sequencing company, sequencing gained sequence is in GenBank numbers
Blast comparisons, analysis are carried out according to storehouse, it was demonstrated that subsequent experimental is used for after errorless.
Table 2pMD-iaaM and pBI-2A11 plasmid double digestion reaction system
IaaM genes are connected 8 bacterial plaques of picking after conversion with intermediate carrier pBI121-2A11, by PCR detections and double enzymes
It cuts verification and draws 2 positive bacterial plaques.Sequencing gained sequence carries out Blast comparisons, the results show promoter in GenBank databases
Segment 2A11 gene orders and target gene segment iaaM gene orders and 2A11 the and iaaM gene orders reported, homology
All it is 99%, the corresponding protein sequence of codified.The plant expression vector pBI121-2A11-iaaM collection of illustrative plates finally built is shown in figure
4。
During Agrobacterium-mediated transformation in order to illustrate the present invention, the sensibility of the raw element Kan of Siraitia grosvenorii leaf dish confrontation,
Biocidal property and Agrobacterium to antibiotic Cef infect the concentration and time effects of bacterium solution, and inventor has done following experiments with this
Establish in embodiment 2 with Agrobacterium_mediated method the phase for carrying out tissue cultures target gene being transferred in Siraitia grosvenorii female plant
Related parameter.
Specific experiment method is as follows：
First, antibiotic Kan sensitivity tests
Respectively prepare containing various concentration Kan (0,2,4,6,8,10,13,16,20,30mg/L) callus induction training
Base is supported, the Siraitia grosvenorii leaf dish of preculture 4d is inoculated with, each 8 bottles of experiment inoculation, 10 leaf dishes of every bottle of inoculation.It is placed in constant temperature
Illumination box, setting condition of culture are：25 ± 1 DEG C, intensity of illumination 2000lx, light application time 12h/d of temperature, after cultivating 25d
Record leaf dish growing state.
The sensitivity tests result such as table 4 of the raw element Kan of Siraitia grosvenorii leaf dish confrontation, it is seen then that Siraitia grosvenorii leaf dish hold green rate with
Bud ratio is reduced with the increase of Kan concentration, while the differentiation and growth of bud are also therewith slowly until stop wilting.Siraitia grosvenorii
The green rate of holding of leaf dish is begun to decline from Kan concentration is higher than 4mg/L, and bud ratio is kept at when Kan concentration is less than 6mg/L
Higher level, excessively high Kan concentration can influence the normal growth differentiation of transformed cells, and concentration is too low and is difficult to play screening work
With thus can determine whether, Siraitia grosvenorii leaf dish differentiates selected as 5mg/L of the bud process to antibiotic Kan.
The sensitivity tests of the raw element Kan of 4 Siraitia grosvenorii leaf dish of table confrontation
2nd, antibiotic Cef bacteriostatic tests
Respectively prepare containing different concentration of Ce f (0,50,100,200,300,400,500mg/L) callus induction training
Base is supported, will be inoculated with by the Siraitia grosvenorii leaf dish of identical preculture and co-cultivation operation after sterile water wash, Mei Geshi
Test 8 bottles of inoculation, 10 leaf dishes of every bottle of inoculation.Constant temperature illumination box is placed in, setting condition of culture is：25 ± 1 DEG C of temperature, illumination
Intensity 2000lx, light application time 12h/d, culture record leaf dish growing state after two weeks.
As shown in Table 5, the pollution rate of Siraitia grosvenorii leaf dish and bud ratio are reduced with the increase of cef concentration, and Cef's is dense
Spend for 300~500mg/L when, pollution rate 0, fungistatic effect is optimal, while in this concentration range, and Cef concentration is 300mg/L
When, the bud ratio of Siraitia grosvenorii leaf dish is relatively high.Too low Cef concentration is difficult to antibacterial, excessively high Cef concentration can inhibit again
Thus bud can determine whether that the optium concentration that antibiotic Cef inhibits Siraitia grosvenorii leaf disk infection Agrobacterium is 300mg/L.
5 antibiotic Cef of table tests the inhibition of Agrobacterium
3rd, Agrobacterium infects the establishment of bacterial concentration
The Agrobacterium bacterium solution after 3mL shaken cultivations is taken, OD is measured under ultraviolet specrophotometer600Value, and it is diluted to difference
OD600The bacterium solution of (0.1,0.3,0.5,0.7) carries out infecting for same time to the Siraitia grosvenorii leaf dish of preculture 4d respectively, will invade
Leaf dish after dye is seeded to callus inducing medium (containing 100 μM of As), each 3 bottles of experiment inoculation, 20 leaves of every bottle of inoculation
Disk.It is placed under dark condition after co-culturing 3d, makes choice culture, setting condition of culture is：25 ± 1 DEG C of temperature, intensity of illumination
2000lx, light application time 12h/d, culture record leaf dish growing state after two weeks.
As shown in Table 6, the pollution rate of Siraitia grosvenorii leaf dish is raised with the increase of Agrobacterium bacterial concentration, while Siraitia grosvenorii
The bud ratio of leaf dish is reduced with the increase of Agrobacterium bacterial concentration.Excessively high Agrobacterium bacterial concentration (OD600=0.7), meeting
Cause Siraitia grosvenorii leaf dish seriously polluted, it is impossible to differentiation budding；Too low Agrobacterium bacterial concentration (OD600=0.1), then can influence
The efficiency of conversion.Thus can determine whether, bacterium solution OD when Agrobacterium is used to infect600Value preferably 0.3~0.5.
Influence of the 6 Agrobacterium bacterial concentration of table to bud ratio
4th, the establishment of Agrobacterium time of infection
The Siraitia grosvenorii leaf dish of preculture 4d is infected with the Agrobacterium bacterium solution of same concentrations, time of infection is respectively
Leaf dish after infecting is seeded to callus inducing medium (containing 100 μM by 5min, 10min, 15min, 20min, 25min
AS), each 3 bottles of experiment inoculation, 20 leaf dishes of every bottle of inoculation.It is placed under dark condition after co-culturing 3d, makes choice culture, if
Putting condition of culture is：25 ± 1 DEG C, intensity of illumination 2000lx, light application time 12h/d of temperature, culture record leaf dish growth after two weeks
Situation.
As shown in Table 7, the pollution rate of Siraitia grosvenorii leaf dish is raised with the increase of Agrobacterium time of infection, while grosvenor momordica leaf
The bud ratio of disk is reduced with the increase of Agrobacterium time of infection.When Agrobacterium time of infection be more than 15min, Siraitia grosvenorii can be caused
Leaf dish is seriously polluted, it is impossible to differentiation budding；And Agrobacterium time of infection is too short, and the efficiency of genetic transformation can be influenced.Thus may be used
Judge, Best Times when Agrobacterium is used to infect are 10min.
Influence of the 7 Agrobacterium time of infection of table to Siraitia grosvenorii leaf dish
Inventor obtains 15 resistant buds by the method for embodiment 2, and inventor is obtained by tests below identification
Resistant buds have been transferred to plant expression vector pBI121-2A11-iaaM, and specific experiment step is as follows：
After 15 resistant buds obtained by embodiment 2 are forwarded to root media culture 30d, carried using CTAB methods are micro
The cauline leaf for the Siraitia grosvenorii female plant seedling for having born adventitious root is taken, after the detection of 1% agarose gel electrophoresis, the results are shown in Figure 5,
Wherein M represents that DL 5000Marker, 1-15 are expressed as plant number.PCR amplification is carried out using the three sets of special primers designed
Detection, pcr amplification reaction system are：0.5 μ L DNA, 5 μ L 2 × Es Taq MasterMix, 0.4 μ L primers Fs/R add water to
10 μ L of total system.Pcr amplification reaction condition is：94℃4min；94 DEG C of 30s, 55~60 DEG C of 30s, 72 DEG C of 1min carry out 30 and follow
Ring；72 DEG C of 8~10min；4 DEG C of preservations.PCR product carries out electrophoresis detection on 1% Ago-Gel, and in gel imaging system
It is imaged in system.
Wherein described three sets of special primers are shown in Table 3, are respectively：For the special of fruit differential promoter 2A11 sequence designs
Primer pair 2A11F/R, sequence number are followed successively by shown in SEQ ID NO.1 and SEQ ID NO.2；For iaaM gene
To iaaM F/R, sequence number is followed successively by shown in SEQ ID NO.3 and SEQ ID NO.4 the special primer of sequence design；Simultaneously
The special primer of across part target gene iaaM sequences and partial promoter sequence 2A11 sequence designs compiles AI CF/R, sequence
It number is followed successively by shown in SEQ ID NO.5 and SEQ ID NO.6.
All primers used in 3 the present embodiment of table
| Primer | Sequence (5'-3') | Sequence number |
| 2A11F | GAAAGAGATTATGAAGGCG | SEQ ID NO.1 |
| 2A11R | TAGATGTAAGCGGAGAGGG | SEQ ID NO.2 |
| iaaM F | CTTACGAGAAAGGCACGAC | SEQ ID NO.3 |
| iaaM R | TAGATGCTGGGCAAACG | SEQ ID NO.4 |
| AI CF | AACACTTTCCCTTAAACATC | SEQ ID NO.5 |
| AI CR | ATTTCCTTGCCAACATAG | SEQ ID NO.6 |
| AI1F | GGCTTTACACTTTATGCTTCCG | SEQ ID NO.7 |
| AI1R | CACTTCCTGATTATTGACCCACA | SEQ ID NO.8 |
PCR detection amplification target fragments are carried out according to special primer in table 3, after the detection of 1% agarose gel electrophoresis, from
The testing result of comprehensive three sets of special primers, the results show share 4 plants of transformed plants and amplify purpose band in Fig. 6-8.Wherein,
Fig. 6 is special primer to 2A11F/R testing result figures, and Fig. 7 is special primer to iaaM F/R testing result figures, and Fig. 8 is special
Primer pair AI CF/R testing result figures.In Fig. 6-8, M represents that DL 2000Marker, 1-15 represent plant number.
Intend transfer-gen plants by 4 plants Jing Guo PCR tests positives and carry out batch expanding numerous, crop field refining is transferred to after taking root
Seedling 5~7 days is transferred in nutritive cube and grown 20 days or so so that tissue-cultured seedling fully adapts to external environmental condition, transplants afterwards
Crop field, later observation are drawn, are intended transfer-gen plant and are grown fine in vegetative growth stage, leaf color is bud green, and blade profile is normal.Florescence
Plant can normally bloom, plant ovary increasing of blooming, and period plant ovary develops into fruitlet without pollination, show unisexuality knot
Real character.
In order to fully support to illustrate the source of the mosaic gene 2A11-iaaM of the present invention, inventor obtains promoter 2A11
It is as follows with the cloning process of target gene iaaM；
1. fruit differential promoter 2A11 is the tomato 2A11 promoter sequences GenBank disclosed in reference to NCBI
On the basis of accession no.M87659 information, design such as 8 primer pair HXrA1F/HXrA1R of table, from cherry and tomato total DNA
It is middle to clone what is obtained.The sequence of primer pair HXrA1F/R is followed successively by SEQ ID NO.9 and SEQ ID NO.10, is disclosed with reference to NCBI
The 2A11 promoter sequences cloned of tomato 2A11 promoter sequences be SEQ ID NO.11；The particular sequence of HXrA1F/R
8 are shown in Table with reaction condition.
8 primer pair HXrA1F/HXrA1R of table and reaction condition
2. purpose iaaM is CDS sequences (the GenBank ID of the iaaM in C58 disclosed in reference NCBI:
AF126446.1 on the basis of), (sequence is followed successively by SEQ ID NO.12 and SEQ ID to design primer pair XXmiF/XXmiR
NO.13) and reaction condition is shown in Table 9, and the sequence that clone obtains purpose iaaM from Agrobacterium tumefaciems C58 bacterial strains is SEQ ID
NO.14。
9 primer pair XXmiF/XXmiR of table and reaction condition
3. the cloning and sequencing process of promoter 2A11 and target gene iaaM is as follows：
A, the extraction of total DNA
The extraction of tomato DNA：Cherry and tomato tender leaf is taken, using plant genome DNA extracts kit, extracts total DNA.
Bacteria Culture：The Agrobacterium tumefaciems C58 bacterial strains for being stored in -80 DEG C are inoculated into 10mL containing Rif20 in 1% ratio
In the YEB fluid nutrient mediums of μ g/mL, it is incubated overnight in 28 DEG C of constant temperature light culture casees.It is aseptically chosen respectively with oese
Take bacterium solution rule on the LB solid mediums of the 20 μ g/mL containing Rif culture draw single bacterium colony.Transfer needle picking single bacterium colony is used again
It is enlarged culture.
The extraction of bacterial genomes DNA：According to bacterial genomes DNA extraction kit specification, to Agrobacterium tumefaciems C58
Genome DNA extraction is carried out, finally with 30 μ L TE buffer solutions DNA.With 1 × TAE buffers, 1.0% agarose
Gel takes the DNA sample that 5 μ L are extracted to carry out electrophoresis, examines the integrality of total DNA, measures DNA's with nucleic acid determination instrument respectively
It is spare to be stored in -20 DEG C of refrigerators for concentration and purity.
B, the PCR amplification of target fragment
Synthesis 5' ends are designed added with restriction endonuclease XbaI, XmaI according to the Nucleotide sequence informations of iaaM
The specific primer of restriction enzyme site is to XXmiF/XXmiR.PCR reaction systems are：Take 1 μ L DNA profilings, sense primer (10 μ
Mol/L), anti-sense primer (10 μm of ol/L) each 1.0 μ L, 2.5 μ L 10 × Ex Taq Buffer (Mg2+Plus), 0.5 μ L
TaKaRa Ex Taq (5U/ μ L), dNTP Mixture (2.5mmol/L) supplement ddH2O (RNase-Free) to 25 μ L.iaaM
The PCR amplification program of gene:94 DEG C of 3min of pre-degeneration；94 DEG C of 30s, 56.5 DEG C of 30s, 72 DEG C of 40s, 30cycles；72℃8min
Extension eventually, 10 DEG C of preservations.Pcr amplification product runs glue with 1.0% Ago-Gel and detects, and observes the integrality of amplified production.
Reaction system and conditioned reference iaaM used in 2A11 clones, but template is tomato total DNA in reaction system, and primer pair is
HXrA1F/HXrA1R, in reaction condition, annealing temperature is 55.3 DEG C, and other conditions are identical with iaaM's.
C, the T clones of target fragment and sequencing
After the PCR product multitube of above-mentioned gained is merged respectively, 100 μ L samples is taken to carry out electricity with 1.2% Ago-Gel
Swimming carries out target fragment purifying recycling to specifications using Ago-Gel DNA QIAquick Gel Extraction Kits.Take 5 μ L recycling gained DNA
Segment carries out electrophoresis detection with 1.0% Ago-Gel.PCR recovery products are connected respectively with pMD19-T simplevector
It connects, linked system is：4 μ L iaaM genes target fragments, 1 μ L pMD19-T simple vector (50ng/ μ L) and 5 μ
LSolutionI, 16 DEG C of water-baths connect overnight.
The preparation of bacillus coli DH 5 alpha competent cell：
1. preculture：It is seeded to from the single bacterium colony of picking DH5 α on LB solid plates in 10mL LB fluid nutrient mediums, 37
DEG C, 200r/min shaken overnight cultures；
Culture is enlarged 2. drawing 0.5mL culture solutions and being seeded in 50mL LB fluid nutrient mediums.
3. bacterium solution is transferred in the sterile centrifugation tube of 50mL, ice bath 10min；
Under the conditions of 4.4 DEG C, 6,000r/min centrifugation 5min abandon supernatant, recycle bacterium solution
5. the 0.1mol/L CaCl good to thalline addition 50mL precoolings2-Mgcl2Solution, featheriness make thalline suspend.
Under the conditions of 6.4 DEG C, 6,000r/min centrifugation 5min abandon supernatant；
7. with the 0.1M CaCl that 1.2mL is ice-cold2Featheriness makes thalline suspend, and is placed in and operates on ice；
8. dispense cell, every part of 100 μ L, be competent cell, be stored in -80 DEG C it is spare.
Connection conversion：
1. 10 μ L connection products are added in 100 μ L competent cells, it is gently mixed uniformly with pipette tips, is placed in ice
30min；
2.42 DEG C of water-bath heat shock 60s, then ice bath 90s；
3. 500 μ L LB fluid nutrient mediums are added in, 37 DEG C, 200r/min, shaken cultivation 45min；
4. thalline is uniformly coated on containing Amp/X-Gal/IPTG (100mg/L:24mg/L:Blue hickie sieve 20mg/L)
It selects on culture medium, 37 DEG C are incubated overnight；
The white single bacterium colony of picking 12 carries out Liquid Culture after foregoing connection product is converted by DH5 α competent cells,
1 μ L bacterium solutions is taken to carry out PCR detections with the combination of corresponding primer, pcr amplification product is coagulated with 1.0% agarose as template after 12h
Glue runs glue detection.
3 bacterial strains that positive recombinant plasmid is accredited as by PCR of picking are enlarged culture, refer to《Molecular cloning guide》
(Huang Peitang, 2002) prepares Plasmid DNA using SDS alkaline lysises, detects plasmid concentration and further uses restriction enzyme
XbaI and XmaI does double digestion verification respectively, and double digestion reaction system is shown in Table 10, reacts 1-2h for 37 DEG C after system mixing,
1.0% Ago-Gel carries out electrophoresis detection, and digestion detection determines positive colony bacterial plaque again, finally obtains pMD-iaaM clones
Positive colony bacterial plaque is sent Hua Da gene Co., Ltd to be sequenced by sub- Escherichia coli bacteria liquid, and sequencing gained sequence is in GenBank data
Storehouse carries out Blast comparisons, analysis.
The double digestion reaction system of table 10pMD-iaaM plasmids
Although the embodiments of the present invention have been disclosed as above, but its be not restricted in specification and embodiment it is listed
With it can be fully applied to various fields suitable for the present invention, for those skilled in the art, can be easily
Realize other modification, therefore without departing from the general concept defined in the claims and the equivalent scope, it is of the invention and unlimited
In specific details and shown here as the legend with description.
SEQUENCE LISTING
<110>Medicinal Garden Of Guangxi Zhuang Autonomous Region
<120>The breeding method of Siraitia grosvenorii parthenocarpy female plant
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence
<400> 1
gaaagagatt atgaaggcg 19
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<400> 2
tagatgtaag cggagaggg 19
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence
<400> 3
cttacgagaa aggcacgac 19
<210> 4
<211> 17
<212> DNA
<213>Artificial sequence
<400> 4
tagatgctgg gcaaacg 17
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
aacactttcc cttaaacatc 20
<210> 6
<211> 18
<212> DNA
<213>Artificial sequence
<400> 6
atttccttgc caacatag 18
<210> 7
<211> 22
<212> DNA
<213>Artificial sequence
<400> 7
ggctttacac tttatgcttc cg 22
<210> 8
<211> 23
<212> DNA
<213>Artificial sequence
<400> 8
cacttcctga ttattgaccc aca 23
<210> 9
<211> 32
<212> DNA
<213>Artificial sequence
<400> 9
aagcttagcc ctttaaaaag tatagtcaat at 32
<210> 10
<211> 32
<212> DNA
<213>Artificial sequence
<400> 10
tctagatttt ggattaattg ctaattgatg ag 32
<210> 11
<211> 1381
<212> DNA
<213>Artificial sequence
<400> 11
aagcttagcc ctttaaaaag tatagtcaat atttacggtg accgtgaatt tcttaattat 60
gatatataat ttaaaagaaa tcatgatcac attctactga tgagaacatg tgctaatcaa 120
gggaaaacat ggatgtgaaa aatacttttt gttaaaagta aaaaaaaatg tgaaattttg 180
ttagttattt actacctata cattatttga gcatgtgcaa actttacaaa tacctaatag 240
aagattttca cctgcctgta tatatgtaaa ttaattataa tgaacactct cacataaaat 300
aattatcagt atatacatta atacttgccc tccacaatga attaaataaa atgtagaaca 360
tgatctacac ttcaataaaa ctaagaccat aaagaataat ttcaaaatat acacatgtca 420
acaataaatt atttgcatat tatattaact tactaaacaa tctttacttt tgaaatataa 480
aaataatcaa gttataagtc tgctcaaagt aaagcacttg ttagactcat ctgattttga 540
gaaggtaagc aaattgatgg tgcataatag tcacaagtaa aatataaaat agatttcatt 600
agtaaaattg ttttttactt tctttatata taattatcaa tatccttcaa tggtaggtta 660
attatattgt taacttcttg ttgaattaaa gcaataagac aagaatatta aagataaaag 720
aacaataaaa atagaaagac taagagataa gagttttctt attcttcttt caataagtat 780
catcaagtgt atacaatata aatttttgta tttttgatct atctatttat aatgttatat 840
ataagcatac aaaagatcag tcataaatat gaccttaatc atgaaaataa tgaaagagat 900
tatgaaggcg taaggttact agaataatag tcattaaaaa aaggggttat ctttataatt 960
gaataattga tgaagtaatg gagataatta gtgagcataa atttttttaa aaaaatggac 1020
atttacacta taatatttta taacactttc ccttaaacat ctaggtataa ataatgagtc 1080
ttgtcaaaat cttagtagga aaaattctgt gaaatttttt tagtgaaaac aaatgatata 1140
aatatcttga atactcatta tttgttgtct cattaaaaat cttatctgac ctataaaata 1200
aattatttgc tcaactcaaa atagtttttc attctaaaat tagtataatt attagtgaat 1260
atttaattaa cataattgta tactaagggg cctataaatt ggattcttct caaagaaaaa 1320
taaaatcacc acacaacttt cttcttctgc tcatcaatta gcaattaatc caaaatctag 1380
a 1381
<210> 12
<211> 38
<212> DNA
<213>Artificial sequence
<400> 12
tctagaatgt cagcttcagc tctccttgat aaccagtg 38
<210> 13
<211> 37
<212> DNA
<213>Artificial sequence
<400> 13
cccgggttaa tttctattgc ggtagttata tctcttc 37
<210> 14
<211> 2280
<212> DNA
<213>Artificial sequence
<400> 14
tctagaatgt cagcttcagc tctccttgat aaccagtgcg atcatttctc taccaaaatg 60
gtggatctga taatggtcga taaggctgat gaattggacc gcagggtttc cgatgccttc 120
tcagaacgtg aagcttctag gggaaggagg attactcaaa tctccggcga gtgcagcgct 180
gggttagctt gcaaaaggct ggccgacggt cgctttcccg agatctcagc tggtgagaag 240
gtagcagccc tctccgctta catctatgtt ggcaaggaaa ttctggggcg gatacttgaa 300
tcggaacctt gggcgcgagc aagagtgagt ggtctcgttg ccatcgacct tgcaccattt 360
tgtatggatt tctccgaagc acaacttctc caaaccctgt ttttgctgag cggtaaaaga 420
tgtgcatcca gcgatcttag tcatttcgtg gccatttcaa tctctaagac tgcccgctcc 480
cgaaccctgc aaatgccgcc ttacgagaaa ggcacgacga aacgcgttac cgggtttacc 540
ctgacccttg aagaggccgt accatttgac atggtagctt atggtcgaaa cctgatgctg 600
aaggcttcgg caggttcctt tccaacaatt gacttgctct atgactacag atcgtttttt 660
gaccaatgtt ccgatagtgg acggatcggc ttctttccgg aagatgttcc taagccaaaa 720
gtggcgatca ttggcgctgg catttccgga ctcgtggtgg caagcgaact gcttcatgct 780
ggtgtagacg atgttacaat atatgaagca agtgatcggg ttggaggcaa gctttggtca 840
catgctttca aggacgctcc cagcgtggtg gccgaaatgg gggcgatgcg atttcctcct 900
gctgcatcgt gcttgttttt cttcctcgag cggtacggcc tgtcttcgat gaggtcgttc 960
ccaaatctcg gcacagtcga cactaacttg gtctaccaag gcctccgata catgtggaaa 1020
gccgggcagc agccaccgaa gctgttccat cgcgtttaca gcggttggcg tgcgttcttg 1080
aaggacggtt tccatgaggg agatattgtg ttggcttcgc ctgttgctat tactcaagcc 1140
ttgaaatcag gagacattag gcgggctcat gactcctggc aaacttggct gaaccgtttc 1200
gggagggagt ccttctcttc agcgatagag aggatctttc tgggcacgca tcctcctggt 1260
ggtgaaacat ggagtttccc tcatgattgg gacctattca agctaatggg aataggatct 1320
ggcgggtttg gtccagtttt tgaaagcggg tttattgaga tccttcgctt ggtcataaac 1380
ggatatgaag aaaatcagcg gatgtgctct gaaggaatct cagaacttcc acgtcgaata 1440
gccactcaag tggttaacgg tgtgtctgta agccagcgta tacgccatgt tcaagtcagg 1500
gcgattgaga aagaaaagac aaaaataaag ataaggctta agagcgggat atctgaactt 1560
tatgataagg tggtggttac atctggactc gcaaatatcc aactcaggca ttgtctgaca 1620
tgcgatacca ccatttttcg tgcaccagtg aaccaagcgg ttgataacag ccatatgaca 1680
ggctcgtcaa aactcttcct gctgactgaa cgaaaatttt ggttagacca tatcctcccg 1740
tcctgtgtcc tcatggacgg gatcgcaaaa gcagtgtact gcctggacta tgagccgcag 1800
gatccgaatg gtaaaggtct ggtgctcatc agttatacat gggaggacga ctcccacaag 1860
ctgttggcgg ttcccgacaa aaaagagcga ttctgtctgc tgcgggacgc aatttcgaga 1920
tctttcccgg cgtttgccca gcatctagtt cccgcctgcg ctgattacga ccaaaatgtt 1980
gttcaacatg attggcttac agacgagaat gccgggggag ctttcaaact caaccggcgt 2040
ggcgaggatt tttattctga agaacttttc tttcaagcgc tggacatgac taatgatacc 2100
ggagtttact tggcgggttg cagttgttcc ttcaccggtg gatgggtgga gggcgctatt 2160
cagaccgcgt gtaacgccgt ctgtgcaatt atccacaatt gtggaggtat tttggcaaag 2220
gacaatcctc tcgaacactc ttggaagaga tataactacc gcaatagaaa ttaacccggg 2280
Claims (8)
1. the breeding method of Siraitia grosvenorii parthenocarpy female plant, which is characterized in that mosaic gene 2A11-iaaM is integrated into Siraitia grosvenorii
The genome of female plant makes gene iaaM be expressed in Siraitia grosvenorii female plant, so as to obtain Siraitia grosvenorii parthenocarpy female plant.
2. the breeding method of Siraitia grosvenorii parthenocarpy female plant as described in claim 1, which is characterized in that with agriculture bacillus mediated turn
Mosaic gene 2A11-iaaM is integrated into the genome of Siraitia grosvenorii female plant by change method.
3. the breeding method of Siraitia grosvenorii parthenocarpy female plant as claimed in claim 2, which is characterized in that described agriculture bacillus mediated
The process of conversion method is：Using being transferred to plant expression vector pBI121- in the During Callus Induction of female plant Siraitia grosvenorii
The Agrobacterium of 2A11-iaaM is infected, and successively by squamous subculture, Multiplying culture, culture of rootage obtain Siraitia grosvenorii female plant
Seedling is screened the Siraitia grosvenorii female plant seedling for obtaining gene iaaM expression using Molecular Detection, will be obtained after its hardening, transplanting and identification
Obtain Siraitia grosvenorii parthenocarpy female plant.
4. the breeding method of Siraitia grosvenorii parthenocarpy female plant as claimed in claim 3, which is characterized in that described agriculture bacillus mediated
The specific steps of conversion method include：
A, the specific steps of female plant Siraitia grosvenorii During Callus Induction include：
A1, the disk that Siraitia grosvenorii female plant aseptic blade is got to multiple a diameter of 0.5cm with sterilized card punch, by disk
The back side and vein scratch, and are seeded on the first inducing culture, and preculture obtains to infect for 4 days under dark condition uses grosvenor momordica leaf
Disk, the formula of first inducing culture are：MS+TDZ0.7mg/L+IBA0.5mg/L；
A2, infecting after step A1 inductions is dipped to the Agrobacterium for being transferred to pBI121-2A11-iaaM with Siraitia grosvenorii leaf dish
In bacterium solution, 150rpm vibrates 10min, the OD of the Agrobacterium bacterium solution at 28 DEG C600For 0.3-0.5；
A3, the Siraitia grosvenorii leaf dish that step A2 is obtained is seeded on the second inducing culture, is co-cultured 3 days under dark condition, institute
The formula for stating the second inducing culture is：MS+TDZ0.7mg/L+IBA0.5mg/L+AS100μM；
A4, it is seeded to the 3rd Fiber differentiation after the Siraitia grosvenorii leaf dish that step A3 is obtained is blotted with sterile water wash, aseptic filter paper
On base, under illumination condition culture is selected to obtain callus in two weeks, the formula of the 3rd inducing culture is：MS+
TDZ0.7mg/L+IBA0.5mg/L+Kan5mg/L+Cef300mg/L；
B, the process of squamous subculture is with being seeded to after sterile water wash on differential medium, in light by callus in step A4
Squamous subculture is to generation adventitious bud, the formula of the differential medium is broken up according under the conditions of：MS+TDZ0.7mg/L+
IBA0.5mg/L+GA30.5mg/L+ brassin lactones 0.5mg/L+Kan5mg/L+Cef100mg/L；
C, the callus of differentiated generation adventitious bud is forwarded to proliferated culture medium, Multiplying culture, institute is carried out under illumination condition
The formula for stating proliferated culture medium is：MS+6-BA0.5mg/L+IBA0.2mg/L+Kan5mg/L+Cef100mg/L；
D, when adventitious bud length is to more than 2cm during Multiplying culture, adventitious bud is cut, and is inserted into root media, looks after item
Culture of rootage is carried out under part is to adventitious root, the formula of the root media is grown：MS+NAA0.5mg/L+IBA0.2mg/L+
Kan5mg/L+Cef100mg/L。
5. the breeding method of Siraitia grosvenorii parthenocarpy female plant as claimed in claim 4, which is characterized in that illumination condition is：Light
According to 25 ± 1 DEG C of temperature, intensity of illumination 2000lx, light application time 12h/d.
6. the breeding method of Siraitia grosvenorii parthenocarpy female plant as claimed in claim 4, which is characterized in that the Agrobacterium bacterium solution
Preparation method it is as follows：The Agrobacterium bacterium solution of plant expression vector pBI121-2A11-iaaM has been transferred to from 80 DEG C of refrigerator taking-ups of ﹣,
It rules on the YEB solid plates for adding 50 μ g/mL of Kan, rif 20 μ g/mL, 28 DEG C are cultivated 48h, then picking single bacterium
Fall, be inoculated into 10mL and add in the YEB fluid nutrient mediums of 50 μ g/mL of Kan, rif 20 μ g/mL, in 28 DEG C, 200rpm vibration trainings
48h is supported, obtains purpose bacterium bacterium solution, purpose bacterium bacterium solution 1mL is taken to add in the YEB fluid nutrient mediums for the antibiotic-free that 50mL is newly prepared,
100 μM of AS is added in simultaneously, in 28 DEG C, 200rpm shaken cultivations 6h so that bacterium solution OD600For 0.3-0.5.
7. the breeding method of Siraitia grosvenorii parthenocarpy female plant as claimed in claim 3, which is characterized in that include mosaic gene
The construction method of the plant expression vector pBI121-2A11-iaaM of 2A11-iaaM is：
1) intermediate carrier pBI121-2A11 is built：By pMD-2A11 plasmids and pBI121-Gus plasmids respectively with HindIII and
XbaI double digestions simultaneously are separately recovered to obtain linear pBI121 genetic fragments and 2A11 genetic fragments, by above-mentioned two genetic fragment
Connection obtains intermediate carrier pBI121-2A11；
2) pBI121-2A11-iaaM carriers are built：PMD-iaaM plasmids and intermediate carrier pBI121-2A11 are used into XbaI respectively
With XmaI double digestions and be separately recovered to obtain linear pBI121-2A11 genetic fragments and iaaM genetic fragments, by above-mentioned two
Genetic fragment connects to obtain pBI121-2A11-iaaM carriers.
8. the breeding method of Siraitia grosvenorii parthenocarpy female plant as claimed in claim 3, which is characterized in that the Molecular Detection
Specific method is：The cauline leaf of the Siraitia grosvenorii female plant seedling of adventitious root has been born using CTAB method Trace bio-elements, has utilized what is designed
Three sets of special primers carry out PCR amplification detection, wherein three sets of special primers are respectively：For fruit differential promoter 2A11
To 2A11F/R, sequence is followed successively by shown in SEQ ID NO.1 and SEQ ID NO.2 the special primer of sequence design；For unisexuality knot
For the special primer of real gene iaaM sequence designs to iaaM F/R, sequence is followed successively by SEQ ID NO.3 and SEQ ID NO.4 institutes
Show；The special primer of across part target gene iaaM sequences and partial promoter 2A11 sequence designs is to AI C F/R, sequence simultaneously
Row are followed successively by shown in SEQ ID NO.5 and SEQ ID NO.6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810141772.5A CN108070612A (en) | 2018-02-11 | 2018-02-11 | The breeding method of Siraitia grosvenorii parthenocarpy female plant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810141772.5A CN108070612A (en) | 2018-02-11 | 2018-02-11 | The breeding method of Siraitia grosvenorii parthenocarpy female plant |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108070612A true CN108070612A (en) | 2018-05-25 |
Family
ID=62155164
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810141772.5A Pending CN108070612A (en) | 2018-02-11 | 2018-02-11 | The breeding method of Siraitia grosvenorii parthenocarpy female plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108070612A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110800604A (en) * | 2019-10-21 | 2020-02-18 | 福州市蔬菜科学研究所 | Breeding method and application of eggplant parthenocarpic inbred line |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101006768A (en) * | 2007-01-24 | 2007-08-01 | 山东省林业科学研究院 | Agrobacterium-mediated Sophora japonica transgenic and tissue-culturing rapid propagation method |
| CN103233040A (en) * | 2013-04-01 | 2013-08-07 | 怀化博雅惠农科技有限公司 | Method for cultivating antiviral momordica grosvenori |
-
2018
- 2018-02-11 CN CN201810141772.5A patent/CN108070612A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101006768A (en) * | 2007-01-24 | 2007-08-01 | 山东省林业科学研究院 | Agrobacterium-mediated Sophora japonica transgenic and tissue-culturing rapid propagation method |
| CN103233040A (en) * | 2013-04-01 | 2013-08-07 | 怀化博雅惠农科技有限公司 | Method for cultivating antiviral momordica grosvenori |
Non-Patent Citations (4)
| Title |
|---|
| 刘迪等: "IAA合成关键基因iaaM研究进展", 《生物技术》 * |
| 张财顺: "用基因工程的方法创造单性结实茄子材料的研究", 《道客巴巴》 * |
| 张财顺: "运用基因工程的方法创造单性结实茄子材料的研究", 《豆丁》 * |
| 涂冬萍: "罗汉果刺激性单性结实果实的生物学特性研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110800604A (en) * | 2019-10-21 | 2020-02-18 | 福州市蔬菜科学研究所 | Breeding method and application of eggplant parthenocarpic inbred line |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hossain et al. | The application of biotechnology to orchids | |
| Zhang et al. | A simple and efficient in planta transformation method for pommelo (Citrus maxima) using Agrobacterium tumefaciens | |
| Dhekney et al. | Advances in papaya biotechnology | |
| CN109735562A (en) | A kind of construction method of the effective root system transgenic system of economic plants | |
| CN108588120A (en) | The preparation method and agriculture bacillus mediated corn transformation method of a kind of corn Agrobacterium-mediated Transformation receptor | |
| Matveeva et al. | Biological traits of naturally transgenic plants and their evolutional roles | |
| CN104770294B (en) | A kind of protocorm based on the sprouting of iris seed is the breeding method of acceptor | |
| CN103966235A (en) | Eggplant anthocyanin synthesis-related gene SmMYB1 as well as recombinant expression vector thereof and application of gene SmMYB1 in purple tomato culture | |
| CN108660140A (en) | Application of the SlSL4 genes in regulating and controlling Fruit Ripening of Tomato | |
| CN106701778A (en) | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes | |
| Tsai et al. | Plant regeneration and stable transformation in the floricultural plant Cleome spinosa, a C 3 plant closely related to the C 4 plant C. gynandra | |
| CN108070612A (en) | The breeding method of Siraitia grosvenorii parthenocarpy female plant | |
| Zayed | Applications of biotechnology on Egyptian clover [(Berseem)(Trifolium alexandrinum L.)]. | |
| CN105936914B (en) | The albumen and application of asparagus chalcone synthase genes and its coding | |
| CN105950644B (en) | The albumen and application of asparagus enzyme, namely chalcone isomerase gene and its coding | |
| CN105255938A (en) | Agrobacterium rhizogenes mediated genetically modified Erigeron breviscapus hairy root transformation method | |
| CN109988761A (en) | A kind of nucleotide sequence and its application in enhancing Genes For Plant Tolerance harmful organism ability | |
| CN105200081B (en) | A kind of method of muskmelon Regeneration in Vitro and its application in muskmelon genetic transformation | |
| CN100381574C (en) | Gentic transforming method of perennial rye grass | |
| CN105039360B (en) | A kind of method for improving anthocyanidin content | |
| CN110484545A (en) | A kind of mosaic disease resisting poison GsCAD1 gene separated from wild soybean, coding albumen and its application | |
| Li et al. | In vitro mutagenesis followed by polymorphism detection using start codon targeted markers to engineer brown spot resistance in Kalanchoe | |
| CN106754970A (en) | A kind of method for cultivating the type of resistance to bolting romaine lettuce by controlling LsFT genes | |
| CN103030685A (en) | Application of paddy gene in cultivating temperature-sensitive sterile line | |
| Mollika et al. | In vitro Regeneration and Agrobacterium-mediated genetic transformation of a cultivated potato variety using marker genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180525 |
|
| RJ01 | Rejection of invention patent application after publication |