CN113980988A

CN113980988A - NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof

Info

Publication number: CN113980988A
Application number: CN202111392074.0A
Authority: CN
Inventors: 焦芳婵; 高玉龙; 王丙武; 赵璐; 隋学艺; 宋中邦; 孔光辉; 吴兴富; 张谊寒; 李永平
Original assignee: Yunnan Academy of Tobacco Agricultural Sciences
Current assignee: Yunnan Academy of Tobacco Agricultural Sciences
Priority date: 2021-11-19
Filing date: 2021-11-19
Publication date: 2022-01-28
Anticipated expiration: 2041-11-19
Also published as: CN113980988B

Abstract

The invention relates to the technical field of genetic engineering, relates to a gene for regulating and controlling the potassium content of tobacco leaves, and particularly relates to a NtYpi1 gene for regulating and controlling the potassium content of tobacco leaves and application thereof. The invention provides an NtYpi1 gene for regulating and controlling the potassium content of tobacco leaves, and the nucleotide sequence of the NtYpi1 gene is shown in SEQ ID NO. 1. The application of the NtYpi1 gene for regulating the potassium content of the tobacco leaves is also provided, the potassium content of the tobacco leaves is obviously reduced compared with a control after the gene is knocked out by the CRISPR/cas9, and the NtYpi1 gene is involved in the regulation of the potassium content of the tobacco leaves. The invention defines the regulation function of the NtYpi1 gene on the potassium content of the tobacco leaves, provides new evidence for analyzing a molecular regulation and control mechanism of the potassium ion content of the tobacco, provides a new idea for cultivating the tobacco with improved potassium content through gene expression regulation and control, and provides a new gene resource for improving the potassium content of the tobacco leaves through a molecular means.

Description

NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, relates to a gene for regulating and controlling the potassium content of tobacco leaves, and particularly relates to a NtYpi1 gene for regulating and controlling the potassium content of tobacco leaves and application thereof.

Background

Tobacco is an important economic crop for leaves in China, and the economic value of the tobacco is seriously influenced by the content of potassium in the tobacco leaves. Potassium ions in tobacco leaves participate in physiological and biochemical reactions of the tobacco leaves, are closely related to the stress resistance of tobacco plants, and influence the inherent quality and industrial availability of the tobacco leaves for tobacco agriculture, so that the potassium content is usually taken as an important index for measuring the quality of the tobacco leaves. Potassium has important influence on the aspects of maturity, flavor, burning property, safety and the like of the tobacco leaves, the improvement of the potassium content of the tobacco leaves can improve the tissue structure of the tobacco leaves, so that the tobacco leaves are fine and smooth in structure, the appearance color and luster of the tobacco leaves can be improved, the tobacco leaves are dark orange, sufficient in fragrance, good in flavor, rich in elasticity and toughness, and enhanced in filling property; in addition, potassium can also enhance the synthesis and accumulation of saccharides, pigments and aromatic substances in the tobacco leaves, so that the higher the potassium content is, the better the quality of the tobacco leaves is.

Aiming at the problem of low potassium content in tobacco leaves in China, the effect of the traditional cultivation and fertilization measures is not ideal. There are studies that suggest that: high potassium application increases nicotine content in the upper leaves, as in Hu national pine, Wang Shi Bin, Rabbit, Korea, Molin, tobacco nicotine accumulation characteristics and the effect of some nutrients on nicotine content [ J ]. Henan agricultural science, 1999(01): 10-14.). There are also studies that suggest: the influence of potassium application on the agronomic characters and nicotine content of tobacco is found, and the result shows that the potassium application can improve the potassium content in tobacco leaves, promote the plant growth and reduce the nicotine content in the tobacco leaves, such as the literature Schlegelia, Chilobrachys caobotrachium, Cao rigor, Linghua, Tianbaming, the analysis on the correlation between the potassium content of the tobacco leaves and the agronomic characters and nicotine content of tobacco plants [ J ] Chinese agronomy report, 2007(02) 275-. Therefore, the potassium content in tobacco leaves cannot be effectively controlled by means of cultivation and fertilization measures alone, so in the current research, the aim of improving the potassium content in the tobacco leaves is achieved by mainly exploring genes related to potassium absorption and transportation in the tobacco leaves.

The protein phosphatase is a kind of enzyme molecules which catalyze phosphorylated protein molecules to generate dephosphorylation reaction, and exists corresponding to protein kinase, and jointly forms a switch system of important protein activity of phosphorylation and dephosphorylation. Protein phosphatase 2A (PP 2A) is a serine/threonine phosphatase most conserved in eukaryotes and one of the most abundant enzymes in eukaryotes. It can dephosphorize a great amount of intracellular proteins such as kinase, signal molecule and the like, and participate in a series of important biological processes related to cell division, apoptosis, gene regulation, protein synthesis and cytoskeleton tissues. The typical PP2A holoenzyme exists as a heterotrimer, consisting of a catalytic subunit C, a structural subunit a, and a regulatory subunit B. Protein phosphatases comprise catalytic and regulatory subunits and are involved in mRNA transcription, protein translation, metabolism, and cell growth and differentiation processes, such as those described in the literature, Bheri, M., Mahiwal, S., Sanyal, S.K., & Pandey, G.K. (2020). The FEBS journal.

Protease inhibitors (protease inhibitors) broadly refer to substances that bind to groups on the active center of a protease molecule and reduce or even eliminate the activity of the protease, without denaturing the enzyme protein. Type 1protein phosphatase inhibitors (inhibitors of type 1protein phosphatase) modulate the function of protein phosphatase inhibitors by interacting with a valency subunit to regulate the function of the protein phosphatase inhibitors to suit environmental or different growth and development needs, such as the literature, MA garca-Gimeno, Iv a n Muoz, Joaqu i Ario, & Sanz, p. (2003). Molecular characterization of type 1, a novel saccharomyces cerevisiae type 1protein phosphatase Inhibitor, journal of Biological Chemistry,278(48),47744-52.

At present, the role of protein phosphatases with Kelch-like domains in the growth and development of plants is disclosed in the prior art, e.g.Maselli Gustavo A, Slamoovits Claudio H, Bianchi Javier I, Vilarrasa-Blasi Josep,

-Delgado Ana I,Mora-García Santiago.Revisiting the evolutionary history and roles of protein phosphatases with Kelch-like domains in plants.[J]plant physiology,2014,164(3), which re-evaluated the role of the BSL (brassicasteroid responsive Brassinosteroid insensitive inhibitor) gene in arabidopsis, mainly based on phylogenetic, functional and genetic evidence, with particular emphasis on BSL1, BSL2 and BSL3, further indicating that these three genes are highly conserved in all terrestrial plants; in contrast, BSU 1-type genes are found only in cruciferae and have aberrantly divergent sequences, which makes them stand out in other conserved families.

Although the prior art discloses the effects of some protein phosphatases and inhibitors on plant growth, development and evolution, no reports on cloning and research of tobacco protein phosphatase inhibitors and no reports on regulation of potassium content in tobacco are found.

Disclosure of Invention

In order to make up for the defects and the blank existing in the field, the invention provides a tobacco NtYpi1 gene for regulating the content of potassium ions in tobacco leaves and cloning and identifying the gene, and the gene is edited by CRISPR/cas9 to find that the gene plays a role in regulating the content of the potassium ions in the tobacco; and provides an application of the NtYpi1 gene capable of regulating and controlling the potassium content of the tobacco leaves. The research result of the invention has important reference for analyzing the molecular regulation of the potassium ion content of the tobacco and provides a new idea for cultivating the tobacco with improved potassium content through gene expression regulation.

The technical scheme of the invention is as follows:

the nucleotide sequence of the NtYpi1 gene capable of regulating and controlling the potassium content of the tobacco leaves is shown in SEQ ID NO. 1.

A protein capable of regulating and controlling the potassium content of tobacco leaves is characterized in that the amino acid sequence of the protein is shown in SEQ ID NO. 2; or the NtYpi1 gene is coded into the protein of the amino acid sequence shown in SEQ ID NO. 2.

The application of the NtYpi1 gene capable of regulating the potassium content of tobacco leaves is characterized in that the NtYpi1 gene or the protein is used for regulating the potassium ion content of tobacco leaves.

A tobacco edited by knocking out the NtYpi1 gene by using CRISPR/cas9 technology or a tobacco edited by over-expressing the NtYpi1 gene.

Use of the NtYpi1 gene edited using CRISPR/cas9 technology and measuring the edited potassium content of tobacco, comprising the following processes:

(1) designing target sites according to the genome sequence of the NtYpi1 gene as follows:

sgRNA:CGAAGAAGAAGAGCGTTTCA；

(2) designing a primer according to the target site in the step (1) to obtain a target site primer, wherein the sequence of the target site primer is as follows:

P1：ATTGCGAAGAAGAAGAGCGTTTCA；

P2：AAACTGAAACGCTCTTCTTCTTCG；

(3) designing detection primers of an editing material on two sides of the target site according to the target site in the step (1) to obtain a detection primer, wherein the detection primer has a sequence as follows:

NtYpi1-SdF：ATGTGAATGCGTGTGGGTTCTT；

NtYpi1-SdR：GCGATCCTCCGATTTACAGCAA；

(4) preparation of dsDNA: forming a complementary DNA oligo by annealing according to the target site primer in the step (2) to obtain dsDNA;

(5) carrying out enzyme digestion on the pHSE401 vector to obtain an enzyme digestion product, and connecting the enzyme digestion product with the dsDNA obtained in the step (4) to obtain a connection product;

(6) sequencing and verifying: converting the ligation product obtained in the step (5) into escherichia coli, screening positive clones and carrying out colony PCR detection; and (3) verifying the correct culture amplification of the positive clone strain through PCR detection, and then further performing sequencing analysis to obtain the CRISPR/cas9 vector.

(7) Obtaining an editing material: transforming the CRISPR/cas9 vector into wild tobacco by using a leaf disc method, amplifying and editing materials by using the detection primers in the step (3), obtaining mutation materials through sequencing, and obtaining a homozygous mutation strain after selfing of the mutation materials;

(8) and (3) measuring the potassium content: and (5) planting the homozygous mutant in the step (7) in a greenhouse, and taking leaf position leaves to detect the potassium content of the tobacco leaves in the flowering period of the tobacco plants.

Preferably, when dsDNA is prepared in step (4), the specific reaction system is: comprises P120 mu L, P220 mu L, 10 × Annealing buffer5 mu L and sterilized double distilled water 5 mu L; the annealing procedure is as follows: 95 ℃ for 5 min; at 90 ℃ for 1 min; at 80 ℃ for 1 min; 1min at 70 ℃; 60 ℃ for 1 min; 50 ℃ for 1 min; at 40 ℃ for 1 min; at 30 ℃ for 1 min; at 20 deg.C for 1 min; 10 ℃ for 1 min.

Preferably, the preparation process of the enzyme digestion product comprises the following steps: the pHSE401 vector is subjected to enzyme digestion by BsaI enzyme, and the enzyme digestion system comprises: plasmid 5. mu.L, 10 XBuffer 5. mu.L, Bsa I2. mu.L, sterile double distilled water 38. mu.L; enzyme digestion is carried out for 1h at 37 ℃; and (3) carrying out electrophoresis detection analysis on the enzyme digestion product after enzyme digestion, wherein an 11520bp band is the enzyme digestion product.

Preferably, the ligation product preparation process comprises: utilizing T4DNA ligase to connect the enzyme digestion product with the dsDNA prepared in the step (4); the connection system comprises: 3 mu L of the enzyme digestion product, 10 mu L of the dsDNA product, 2 mu L of T4DNA buffer, 1 mu L of T4DNA ligase and 4 mu L of sterilized double distilled water; the ligation reaction was carried out overnight at 16 ℃ to finally obtain the ligation product.

Preferably, in the (6) sequencing verification step, the design sequence of the primers used in the colony PCR detection is:

U6-26p-F：TGTCCCAGGATTAGAATGATTAGGC；

U6-26p-R：AAACCGATTCATCGCAACCAATTC。

preferably, in the editing material obtained in the step (7), the leaf disc method includes: transforming the obtained CRISPR/cas9 vector by agrobacterium to obtain agrobacterium clone containing a target vector; then carrying out tobacco transformation, cloning and culturing the obtained agrobacterium containing the target vector to obtain agrobacterium LB liquid culture medium suspension bacteria liquid containing the target vector, adding sliced sterile wild tobacco leaves for culturing, and transferring the cultured sterile wild tobacco leaves into a differentiation culture medium for culturing; and cutting the buds when the buds grow to 3-5 cm, inducing the cut buds to root, transplanting the rooted buds into sterilized nutrient soil to obtain a plurality of T0 generation transgenic tobacco seedlings, namely the wild tobacco transformed by the CRISPR/cas9 vector.

Preferably, in the step (8), the potassium content is measured by using a method of YC/T173-.

The invention proves the function of the tobacco NtYpi1 gene in regulating the content of potassium in tobacco leaves for the first time through system research. Compared with tobacco leaves containing the sequence of SEQ ID NO.1, the content of potassium in the tobacco leaves edited by the CRISPR/cas9 is obviously reduced by about 17 percent. The research of the invention shows that NtYpi1 is a positive regulation factor of the content of potassium ions in tobacco, and provides a new gene resource for improving the content of potassium in tobacco leaves by a molecular means.

Drawings

FIG. 1 is an electrophoretogram of pHSE401-Ypi1 vector for U6-26p-F/U6-26p-R detection. In the figure, lanes are from left to right: (1) DL2000DNA Marker (Takara), (2) PCR product using ddH2O as template, and (3-4) PCR product using plasmid DNA as template. The DL2000DNA Marker (Takara) bands are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom respectively; the size of the amplified product is about 400 bp.

FIG. 2 is an electrophoretogram of NtYpi1-SdF/Sdr detection editing material. In the figure, lanes are from left to right: (1) DL2000DNA marker (Takara) and (2-3) are PCR products using extracted DNA as a template. The DL2000DNA Marker (Takara) bands are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom respectively; the amplification size was 631 bp.

Fig. 3 is CRISPR/cas9 editing material mutation information.

Fig. 4 is a CRISPR/cas9 editing material sequencing peak diagram.

FIG. 5 shows CRISPR/cas9 editing material and potassium ion content of control tobacco leaves, NtYpi1-CP as editing material and CK as control.

Detailed Description

The present invention is further described below in conjunction with the following examples, which are to be understood as being merely illustrative and explanatory of the invention and not limiting the scope of the invention in any way.

Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the field, and are commercially available or prepared according to conventional methods in the field, and the specification is laboratory pure grade; the experimental methods and experimental conditions used are conventional in the art, and reference may be made to relevant experimental manuals (e.g., molecular cloning guidelines), well known literature, or manufacturer's instructions. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

According to the invention, NtYpi1 gene is separated according to the tobacco genome sequencing database information, the nucleotide sequence is shown as SEQ ID NO.1, the sequence length is 378bp, the coded amino acid sequence is shown as sequence SEQ ID NO.2, and the length is 126 amino acids.

According to the invention, after the NtYpi1 gene is knocked out by using the CRISPR/cas9 technology, the content of potassium ions in tobacco leaves can be obviously reduced.

The tobacco NtYpi1 gene is a positive regulation and control factor for the content of potassium ions in tobacco, and the gene can be overexpressed by a gene engineering technology to achieve the effect of improving the content of the potassium ions in tobacco leaves, thereby playing an important role in improving the content of the potassium ions in the tobacco leaves.

Therefore, the first object of the present invention is to provide the tobacco NtYpi1 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

The second purpose of the invention is to provide the protein coded by the tobacco NtYpi1 gene, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.

The third purpose of the invention is to provide the function of the tobacco NtYpi1 gene in regulating the content of potassium in tobacco leaves, namely, the potassium content in the tobacco leaves can be reduced by knocking out the NtYpi1 gene.

The fourth purpose of the invention is to provide the application of using the tobacco NtYpi1 gene to improve or reduce the content of potassium in tobacco by a molecular regulation means.

EXAMPLE 1 cloning of NtYpi1 Gene

1.1 Experimental materials

1.1.1 test strains

Escherichia coli DH5 alpha (Escherichia coli) was also stored in the laboratory and the applicant stated that it could be released to the public for validation experiments within twenty years from the filing date.

1.1.2 tobacco species tested

Tobacco: yunyan 87, a product of this laboratory preservation, the applicant states that it can be released to the public for validation experiments within twenty years from the filing date.

1.1.3 test reagents

Phusion Hi-Fi amplification enzyme reaction system, 5 XPusion HF reaction buffer solution, dNTP, Tris-HCl (PH 8), EDTA, 20% SDS, beta mercaptoethanol, absolute ethanol, isopropanol, DNA extract and 10 XTAE, which are purchased from Biotechnology (Shanghai) Limited company (http:// www.sangon.com).

High-Fidelity DNA Polymerase was obtained from Guangzhou Shengxiao Biotech, Inc.

Blunt II-TOPO from Invitrogen.

LB liquid medium: contains 100mg/L kanamycin and 25mg/L rifampicin. The above culture medium is sterilized by moist heat at 121 deg.C for 20 min.

1.1.5 Experimental instruments

"Xiamen" instruments, Inc. GI-54DS automatic pressure steam sterilizer. Shanghai essence macro experimental facilities GmbH DHG-9240A electric heating constant temperature air-blast drying oven, DNP-90-52 electric heating constant temperature incubator. SW-CJ-2FD superclean bench of Antai air technologies, Tesu. SQP electronic analytical balance, beijing sidoris scientific instruments ltd. Backman Optima L-XP preparative ultracentrifuge. HR220 MiniSmart mini centrifuge from Beijing Ding Hao Yuan science and technology Limited. Eppendorf Centrifuge-54188 refrigerated Centrifuge. MX-S adjustable and fixed blending instrument. The Calyday Biotechnology H203-100C heats and refrigerates the metal bath. BIO-RAD Thermal Cycler PCR instrument. Milli-Q ultrapure water systems Millipore. Shanghai medical analytical instruments factory TGL-16G Ice machine. Bandelin Sonopuls HD 2070 ultrasonication instrument, great Longxing laboratory instruments, Beijing. Beijing, Hexagon DYY-12 electrophoresis apparatus. Alliance 4.7Chroma Uvitec gel imager. Shanghai Zhixin ZX-S22 double-hole stainless steel constant-temperature water bath kettle.

pro amplification apparatus.

1.2 Experimental methods

(1) According to a genome sequencing database (internal data) in the tobacco industry, a solanaceae database (https:// solgenomics. net /) and an arabidopsis thaliana homologous gene, obtaining tobacco NtYpi1 gene sequence CDS sequence information, and designing a cloned gene primer as follows:

SEQ ID NO.	name (R)	Sequence (5 '→ 3')
			3	Ypi1-F	ATGGCGAGAAGCGGAAGACAAT
4	Ypi1-R	TCAATTATCTTCGCAATTGCTGGTA

(2) Extracting tobacco leaf tissue RNA, and performing reverse transcription to obtain first-strand cDNA;

(3) performing PCR amplification by using a first strand cDNA obtained by reverse transcription as a template, wherein a Phusion high-fidelity amplification enzyme reaction system is selected, and the total volume of the system is 50 mu L, and the method comprises the following steps: 200ng cDNA, 10. mu.L of 5 XPPhusion HF reaction buffer, 1. mu.L of 10mM dNTP, 2U

High-Fidelity DNA Polymerase, 1. mu.L each of 10. mu.M forward and reverse primers, and water was added to 50. mu.L. The PCR reaction is carried out in

The pro amplification instrument is used for carrying out the following reaction procedures: 30 seconds at 98 ℃; 35 cycles of 98 ℃, 7 seconds, 60 ℃, 30 seconds, 72 ℃, 30 seconds; extension at 72 ℃ for 7 min; recovering and purifying the PCR product; the forward and reverse primers used in this step were Ypi1-F/Ypi 1-R.

(4) The purified product is connected with a carrier, and the connection system and the process are as follows: 4 μ L of purified product, 1 μ L of salt solution, 1 μ L

-Blunt II-TOPO (Invitrogen) and water bath at 25 deg.C for 30 min; transforming the connected vector into Escherichia coli DH5a by heat shock, adding liquid culture medium, performing shake culture, spreading on LB plate containing 100mg/L kanamycin, culturing overnight, selecting bacterial colony, performing bacterial liquid culture, extracting plasmid, performing PCR detection, screening positive clone, and performing heat shock on the positive cloneAnd (4) sequencing.

Example 2 reduction of Potassium content in tobacco leaves Using CRISPR/cas9 knock-out of NtYpi1 Gene

2.1 materials of the experiment

2.1.1 test strains

Escherichia coli (Escherichia coli) DH5 alpha. Agrobacterium (Agrobacterium) competent cell C58C 1. The above biological materials are also stored in the laboratory and the applicant states that they can be released to the public for verification experiments within twenty years from the filing date.

2.1.2 test tobacco varieties

Tobacco: wild type tobacco yunyan 87, stored in the laboratory, the applicant states that it can be released to the public for validation experiments within twenty years from the filing date.

2.1.3 test reagents

pHSE401 vector, pK2GW7 vector, Trans-T1 competent cell, plasmid extraction kit, PCR product recovery kit, gel recovery kit, plant RNA extraction kit and plant genome extraction kit are purchased from Beijing Quanjin biotechnology limited; LBA4404 competent cells, CRISPR/Cas9 plant expression vector southern laboratory preservation; LR Clonase II enzyme Mix, reverse transcriptase M.MLV, RNase inhibitor from Promega, USA; t4DNA ligase, Bsa I restriction enzyme was purchased from Nelumbo Biotechnology (Beijing) Ltd; DNeasy Plant Mini Kit was purchased from QIAGEN, Germany; SYBR-Premix Ex Taq II Biotech (Dalian) Ltd; annexing Buffer for DNA Oligs (10X) was purchased from Shanghai Biyuntian Biotechnology Ltd; MS powder was purchased from PHyto technology Laboratories, Inc., USA; sucrose and agar were purchased from biotechnology limited, yoqingdingguo; antibiotics such as Ampicillin (ampicilin), Kanamycin (Kanamycin), and rifampin (Rifampicin) were purchased from beijing solibao technologies ltd; primer synthesis and sequencing were performed by Beijing Hua Dagenetechnology, Inc.

2.1.4 test Medium

LB liquid medium: contains 100mg/L kanamycin and 25mg/L rifampicin. The MS culture medium contains 6-BA/6-benzylaminopurine/alpha-naphthylacetic acid (0.02mg/L) and NAA (2 mg/L). Differentiation medium: MS culture medium containing 6-BA/6-benzylaminopurine (0.5mg/L), NAA/alpha-naphthylacetic acid (0.1mg/L), hygromycin (20mg/L), and cefamycin (500 mg/L). The above culture medium is sterilized by moist heat at 121 deg.C for 20 min.

2.1.5 Experimental instruments

2.2 Experimental methods

2.2.1 construction of CRISPR/cas9 vector

(1) Designing a target site according to the NtYpi1 genome sequence as follows:

sgRNA:CGAAGAAGAAGAGCGTTTCA；

specifically, according to the NtYpi1 gene sequence, an online tool ZiFiTTargeter version4.2 is used to select a proper target site, and the screening requirements are as follows: the target site mainly comprises 20 bases, and the 20 bases are followed by a PAM region (PAM) of NGG (N is any base) with 3 bases; ② the target site is selected at the front end of the gene coding region as much as possible.

(2) Designing a primer according to the target site in the step (1) to obtain a target site primer, wherein the target site primer is as follows:

SEQ ID NO.	name (R)	Sequence (5 '→ 3')
			5	P1	ATTGCGAAGAAGAAGAGCGTTTCA
6	P2	AAACTGAAACGCTCTTCTTCTTCG

(3) Designing detection primers of an editing material on two sides of the target site according to the target site in the step (1) to obtain the detection primers, wherein the detection primers are as follows:

SEQ ID NO.	name (R)	Sequence (5 '→ 3')
			7	NtYpi1-SdF	ATGTGAATGCGTGTGGGTTCTT
8	NtYpi1-SdR	GCGATCCTCCGATTTACAGCAA

The amplification length is 631 bp.

(4) Preparation of dsDNA: annealing according to the target site primer obtained in the step (2) to form a complementary DNA oligo, and obtaining dsDNA; the specific reaction system is as follows: the reaction system is 50 μ L, including P120 μ L, P220 μ L, 10 × Annealing buffer5 μ L, and 5 μ L of sterile double distilled water. The annealing procedure is as follows: 95 ℃ for 5 min; at 90 ℃ for 1 min; at 80 ℃ for 1 min; 1min at 70 ℃; 60 ℃ for 1 min; 50 ℃ for 1 min; at 40 ℃ for 1 min; at 30 ℃ for 1 min; at 20 deg.C for 1 min; 10 ℃ for 1 min.

the method comprises the following specific steps: the pHSE401 vector is cut by BsaI enzyme, and the cutting system is 50 mu L, and comprises the following components: 5 mu L of plasmid, 5 mu L of 10 Xbuffer, 2 mu L of Bsa I, 38 mu L of sterilized double distilled water and 1h of enzyme digestion at 37 ℃;

carrying out electrophoresis detection analysis on the enzyme digestion product after enzyme digestion to obtain two bands of 1200bp and 11520bp, and recovering the enzyme digestion product of 11520bp for later use;

and (3) utilizing T4DNA ligase to connect the recovered large fragment enzyme digestion product with the dsDNA prepared in the step (4), wherein the connection system is 20 mu L: 3 mu L of the recovered vector enzyme digestion product, annealing to form a dsDNA product of 10 mu L, T4DNA buffer of 2 mu L, T4DNA ligase of 1 mu L, sterilizing double distilled water of 4 mu L, and connecting overnight at 16 ℃ to obtain a connecting product;

(6) sequencing and verifying: converting the ligation product obtained in the step (5) into escherichia coli, screening positive clones (kanamycin is the resistance of the pHSE401 vector), and carrying out colony PCR detection; when the colony PCR is detected, the primers are designed as follows:

SEQ ID NO.	name (R)	Sequence (5 '→ 3')
			9	U6-26p-F	TGTCCCAGGATTAGAATGATTAGGC
10	U6-26p-R	AAACCGATTCATCGCAACCAATTC

The PCR system was as follows:

the PCR procedure was as follows:

wherein the annealing temperature is adjusted according to the temperature of the primer itself. The PCR product was then removed and the amplification was detected by electrophoresis on a 2% agarose gel.

Carrying out further sequencing analysis after the culture and amplification of the correct positive clone strain is verified by PCR detection, and detecting a pHSE401-Ypi1 carrier electrophoresis picture by U6-26p-F/U6-26p-R to obtain a pHSE401-Ypi1 carrier as shown in figure 1, wherein the size of an amplification product is about 400 bp; the primers used for sequencing were U6-26p-F described above.

And (3) transforming the CRISPR/cas9 vector into wild tobacco by using a leaf disc method, amplifying and editing the material by using the detection primer in the step (3), obtaining a mutation generating material by sequencing, and obtaining a homozygous mutation strain after selfing of the mutation material.

To facilitate an understanding of the invention, the blisk method is described herein. The leaf disc method is a simple and easy method for transforming, selecting and regenerating plant cells. Plant cells are transformed using the methods commonly used for Ti transformation. Specifically, the surface of the leaf of the test material (e.g., tobacco) is first sterilized and then a sterilized stainless steel punch is used to remove a small circular piece, i.e., a leaf disk, from the leaf. In order to inoculate the leaf disc, the leaf disc needs to be soaked in a soil agrobacterium tumefaciens culture solution for 4-5 min, then is sucked dry by using filter paper and is placed on a nursing culture medium for culture, and the back of the leaf needs to be contacted with the culture medium. The nursing culture medium is prepared by uniformly distributing a layer of carrot cells or other cell suspension on a specific solid culture medium and then covering a layer of filter paper. The leaf disks were cultured on a care medium for two days, and then transferred to a selection medium containing an appropriate antibiotic for culture. After several weeks, callus and seedlings were grown around the leaf discs. Further examination of these seedlings allows the determination of whether they contain foreign genes and the expression of foreign genes. The leaf disk method is actually a transformation method created by improving the co-culture method. Leaf explants were infected with Agrobacterium and co-cultured for a short period. During the cultivation, the vir gene of Agrobacterium is induced, its activation may initiate the transfer of T-DNA into plant cells. After co-cultivation, the steps of selection of transformed explants, callus culture, induced differentiation and the like are also performed to obtain regenerated plants. The leaf disc method is simple because protoplast operation and the like are not needed, and the transformation plant is faster to obtain, thus being a good way for transgenosis by using plant explants as materials.

2.2.2 Agrobacterium transformation

After dissolving agrobacterium competent cells C58C1, adding the vector pHSE401-Ypi1 obtained in the step (6) of 2.2.1 construction of CRISPR/cas9 vector to carry out agrobacterium transformation, and obtaining agrobacterium clone containing a target vector. The method specifically comprises the following steps: taking out Agrobacterium-infected competent cells (C58C1) from-80 deg.C refrigerator, placing on ice for dissolving, and adding vector pHSE401-Ypi 14 μ L; quickly freezing for 1 minute by using liquid nitrogen, transferring into a water bath at 37 ℃ for 5 minutes, then performing ice bath for 2 minutes, adding 1mL of LB liquid culture medium into the mixture, and culturing at 28 ℃ and 220rpm for 3-4 hours; the culture is coated on LB solid culture medium containing 100mg/L kanamycin and 25mg/L rifampicin, and is inversely cultured for 2-3 days at 28 ℃, so that agrobacterium clones containing the target vector can be obtained.

2.2.3 tobacco transformation

After streak inoculation is carried out on the obtained agrobacterium tumefaciens clone containing the target vector, propagation is carried out in an LB culture medium containing kanamycin and rifampicin to obtain agrobacterium tumefaciens LB liquid culture medium suspension bacteria liquid containing the target vector; the method specifically comprises the following steps: selecting agrobacterium clone containing a target vector, streaking on an LB (Langerhans) plate containing kanamycin and rifampicin, and culturing for 2-3 days at 28 ℃; scraping streak plaque and inoculating bacteria into an LB culture medium containing kanamycin and rifampicin, performing shake culture at 28 ℃ and 220rpm, and infecting when the concentration of the bacteria liquid reaches OD (0.5-0.8).

Treating wild tobacco leaves with ethanol and HgCl2, washing with sterile water, and removing liquid on the surfaces of the tobacco leaves by suction to obtain sterile wild tobacco leaves; the method specifically comprises the following steps: placing wild tobacco leaf in 500mL jar, adding appropriate amount of 75% ethanol, and rinsing for 1 min; removing the ethanol, adding 0.1% of HgCl2 solution, and placing on a shaking table to oscillate for 15-30 minutes at room temperature; discard the solution and wash with sterile water 6 times.

Cutting the obtained aseptic wild tobacco leaves into small pieces, putting the cut aseptic wild tobacco leaves into the obtained agrobacterium liquid culture medium LB suspension bacteria liquid containing the target carrier for culture, transferring the tobacco leaves into a differentiation culture medium for culture until callus is gradually formed at the cut of the tobacco leaves and the tobacco leaves are differentiated to bud; the method specifically comprises the following steps: taking out the obtained sterile wild tobacco leaves, washing off surface liquid by using sterile absorbent paper, cutting the sterile leaves into small pieces of 1cm multiplied by 1cm by using scissors, putting the cut tobacco leaves into agrobacterium tumefaciens LB liquid culture medium suspension bacteria liquid containing a target vector, and standing for 15-20 min; taking out tobacco leaf, removing excess bacterial liquid with sterile filter paper, and performing dark culture in MS culture medium containing 6-BA (0.02mg/L) and NAA (2mg/L) at 25 deg.C for two days; transferring tobacco leaves into a differentiation culture medium, contacting the cut with the culture medium, wherein the differentiation culture medium is an MS culture medium containing 6-BA (0.5mg/L), NAA (0.1mg/L), hygromycin (20mg/L) and cefamycin (500mg/L), subculturing once every 2-3 weeks, gradually forming callus at the cut, and finally differentiating to bud. When the buds grow to 3-5 cm, cutting the buds, inducing the cut buds to root, transplanting the rooted buds into sterilized nutrient soil to obtain a plurality of T0 generation transgenic tobacco seedlings; the method specifically comprises the following steps: cutting off buds growing to 3-5 cm, transferring the buds into an MS culture medium to induce rooting, taking out the rooted transgenic plants from the rooting culture medium, washing the culture medium with tap water, and transplanting the transgenic plants into sterilized nutrient soil.

2.2.4 sequencing screening editing Material

After the T0 generation transgenic tobacco seedlings of the transgenic plants in the nutrient soil grow for 1 week, selecting leaves to extract DNA, as shown in figure 2, detecting a material electrophoresis diagram of NtYpi1-SdF/Sdr, amplifying by using a detection primer NtYpi1-SdF/Sdr in the step (3) to obtain an amplification product with the amplification size of 631bp, purifying the amplification product, sequencing by using a forward primer, and analyzing a sequencing result to obtain an editing material of the NtYpi1 gene with 1 base T missing at an editing site; planting the editing material to obtain T1 generation plants, screening homozygous mutant individuals by sequencing and harvesting to obtain T2 generation tobacco seeds with NtYpi1 homozygous mutation.

The method specifically comprises the following steps: after the transgenic seedlings of the T0 generation grow for about 1 week, 20 tobacco seedlings are selected, leaves are taken, DNA is extracted by using DNeasy Plant Mini Kit (QIAGEN), primers NtYpi1-SdF/Sdr designed in the step (3) in the CRISPR/cas9 vector construction of 2.2.1 are used for amplification, and the amplification products are purified and sequenced by using forward primers. As shown in fig. 3, the sequencing result is analyzed for CRISPR/cas9 editing material mutation information, and an editing material with 1 base T deletion of the NtYpi1 gene is obtained. The editing material T1 generation plants are planted, homozygous mutant individuals (shown as figure 4, CRISPR/cas9 editing material sequencing peak chart) are screened by sequencing, and seeds are harvested to obtain T2 generation seeds.

Planting the obtained T2 generation tobacco seeds with NtYpi1 homozygous mutation in a greenhouse to obtain a T2 generation tobacco strain, and detecting the potassium content of the tobacco leaves of the plant by using a YC/T173-; the method specifically comprises the following steps: comparing the mutant strain planted in the greenhouse with the wild tobacco plant, taking the 9-11 leaf position leaves (calculated from the lower part) in the flowering period of the tobacco plant, deactivating enzyme, drying, and detecting the potassium content of the tobacco leaves by using the method of YC/T173-2003. YC/T173-2003 is the determination of potassium in tobacco and tobacco products, also known as flame photometry.

Planting the obtained T2 generation tobacco seeds with NtYpi1 homozygous mutation in a greenhouse to obtain a T2 generation tobacco strain, and detecting the potassium content of the tobacco leaves of the plant by using a YC/T173-; the method specifically comprises the following steps: comparing the mutant strain planted in the greenhouse with the wild tobacco plant, taking the 9-11 leaf position leaves (calculated from the lower part) in the flowering period of the tobacco plant, deactivating enzyme, drying, and detecting the potassium content of the tobacco leaves by using the method of YC/T173-2003. The T2 generation of the edited material has significantly reduced potassium content compared to tobacco leaves containing the sequence of SEQ ID No. 1.

As shown in FIG. 5, NtYpi1-CP is the editing material, CK is the control group; compared with the CK group containing the SEQ ID NO.1 sequence, the T2 substitute tobacco NtYpi1-CP of the edited material has the advantage that the potassium content in tobacco leaves is remarkably reduced by about 17%.

In addition to the above specific implementation processes, it should be noted that the present invention should also include a method for knocking out the tobacco edited by the NtYpi1 gene by using CRISPR/cas9 technology, wherein the content of potassium in the tobacco leaves is significantly reduced; of course, tobacco edited by overexpressing the NtYpi1 gene can also be obtained.

The foregoing has described the general principles, principal features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed.

Sequence listing

<110> research institute of tobacco agricultural science in Yunnan province

<120> NtYpi1 gene capable of regulating and controlling potassium content in tobacco leaves and application thereof

<130> 20211116

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 378

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcgagaa gcggaagaca atcaccatta ccggcgacca ccggaacaac aacagcaaca 60

ataaccctaa ccctaaacaa ctcatcggaa tcctcctcct catcgtctga acagctgcag 120

caacatccaa cagaaaccct aactctgaaa ctgaaaccga agaagaagag cgtttcatgg 180

aagcaaggta ctgtggacaa cgagttcctc aacaagagga gctctaagat ttgctgtata 240

tttcacaagg aaaagccttt tgatgaggat gacagcgatg gcgatgaaaa tgaaaatcaa 300

tcagataaaa aagatcacca ttgctgtaaa tcggaggatc gcggtgaagc cagtaccagc 360

aattgcgaag ataattga 378

<210> 2

<211> 125

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ala Arg Ser Gly Arg Gln Ser Pro Leu Pro Ala Thr Thr Gly Thr

1 5 10 15

Thr Thr Ala Thr Ile Thr Leu Thr Leu Asn Asn Ser Ser Glu Ser Ser

20 25 30

Ser Ser Ser Ser Glu Gln Leu Gln Gln His Pro Thr Glu Thr Leu Thr

35 40 45

Leu Lys Leu Lys Pro Lys Lys Lys Ser Val Ser Trp Lys Gln Gly Thr

50 55 60

Val Asp Asn Glu Phe Leu Asn Lys Arg Ser Ser Lys Ile Cys Cys Ile

65 70 75 80

Phe His Lys Glu Lys Pro Phe Asp Glu Asp Asp Ser Asp Gly Asp Glu

85 90 95

Asn Glu Asn Gln Ser Asp Lys Lys Asp His His Cys Cys Lys Ser Glu

100 105 110

Asp Arg Gly Glu Ala Ser Thr Ser Asn Cys Glu Asp Asn

115 120 125

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcgagaa gcggaagaca at 22

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaattatct tcgcaattgc tggta 25

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

attgcgaaga agaagagcgt ttca 24

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaactgaaac gctcttcttc ttcg 24

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgtgaatgc gtgtgggttc tt 22

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcgatcctcc gatttacagc aa 22

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgtcccagga ttagaatgat taggc 25

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aaaccgattc atcgcaacca attc 24

Claims

1. The nucleotide sequence of the NtYpi1 gene capable of regulating and controlling the potassium content of the tobacco leaves is shown in SEQ ID NO. 1.

2. A protein capable of regulating and controlling the potassium content of tobacco leaves is characterized in that the amino acid sequence of the protein is shown in SEQ ID NO. 2; or the NtYpi1 gene according to claim 1 encoding a protein having an amino acid sequence shown in SEQ ID No. 2.

3. The use of the NtYpi1 gene for regulating the content of potassium in tobacco leaves, which is characterized in that the NtYpi1 gene in claim 1 or the protein in claim 2 is used for regulating the content of potassium ions in tobacco leaves.

4. A CRISPR/cas9 technology for knocking out tobacco edited by the NtYpi1 gene of claim 1 or tobacco edited by overexpressing the NtYpi1 gene of claim 1.

5. The use according to claim 3, wherein the use of the CRISPR/cas9 technique to edit the NtYpi1 gene and measure the edited potassium content of tobacco comprises the following processes:

sgRNA: CGAAGAAGAAGAGCGTTTCA；

P1：ATTGCGAAGAAGAAGAGCGTTTCA；

P2：AAACTGAAACGCTCTTCTTCTTCG；

NtYpi1-SdF：ATGTGAATGCGTGTGGGTTCTT；

NtYpi1-SdR：GCGATCCTCCGATTTACAGCAA；

(6) sequencing and verifying: converting the ligation product obtained in the step (5) into escherichia coli, screening positive clones and carrying out colony PCR detection; carrying out further sequencing analysis after the positive clone bacterial strain which is verified to be correct is cultured and amplified through PCR detection to obtain the CRISPR/cas9 vector;

6. The use of claim 5, wherein in step (4), the dsDNA is prepared by a specific reaction system comprising: comprises P120 mu L, P220 mu L, 10 × Annealing buffer5 mu L and sterilized double distilled water 5 mu L; the annealing procedure is as follows: 95 ℃ for 5 min; at 90 ℃ for 1 min; at 80 ℃ for 1 min; 1min at 70 ℃; 60 ℃ for 1 min; 50 ℃ for 1 min; at 40 ℃ for 1 min; at 30 ℃ for 1 min; at 20 deg.C for 1 min; 10 ℃ for 1 min.

7. The use of claim 5, wherein the preparation process of the enzyme digestion product comprises: the pHSE401 vector is subjected to enzyme digestion by BsaI enzyme, and the enzyme digestion system comprises: plasmid 5. mu.L, 10 XBuffer 5. mu.L, Bsa I2. mu.L, sterile double distilled water 38. mu.L; enzyme digestion is carried out for 1h at 37 ℃; and (3) carrying out electrophoresis detection analysis on the enzyme digestion product after enzyme digestion, wherein an 11520bp band is the enzyme digestion product.

8. The use of claim 5, wherein the ligation product preparation process comprises: utilizing T4DNA ligase to connect the enzyme digestion product with the dsDNA prepared in the step (4); the connection system comprises: 3 mu L of the enzyme digestion product, 10 mu L of the dsDNA product, 2 mu L of T4DNA buffer, 1 mu L of T4DNA ligase and 4 mu L of sterilized double distilled water; the ligation reaction was carried out overnight at 16 ℃ to finally obtain the ligation product.

9. The use of claim 5, wherein in the (6) sequencing verification step, the colony PCR assay uses the primer design sequence:

U6-26p-F：TGTCCCAGGATTAGAATGATTAGGC；

U6-26p-R：AAACCGATTCATCGCAACCAATTC。

10. the use according to claim 5, wherein the said (8) determination of potassium content means the detection of potassium content in tobacco leaves by the method of YC/T173-2003.