CN113980988B - NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof - Google Patents

NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof Download PDF

Info

Publication number
CN113980988B
CN113980988B CN202111392074.0A CN202111392074A CN113980988B CN 113980988 B CN113980988 B CN 113980988B CN 202111392074 A CN202111392074 A CN 202111392074A CN 113980988 B CN113980988 B CN 113980988B
Authority
CN
China
Prior art keywords
ntypi1
gene
tobacco
potassium content
tobacco leaves
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111392074.0A
Other languages
Chinese (zh)
Other versions
CN113980988A (en
Inventor
焦芳婵
高玉龙
王丙武
赵璐
隋学艺
宋中邦
孔光辉
吴兴富
张谊寒
李永平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yunnan Academy of Tobacco Agricultural Sciences
Original Assignee
Yunnan Academy of Tobacco Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yunnan Academy of Tobacco Agricultural Sciences filed Critical Yunnan Academy of Tobacco Agricultural Sciences
Priority to CN202111392074.0A priority Critical patent/CN113980988B/en
Publication of CN113980988A publication Critical patent/CN113980988A/en
Application granted granted Critical
Publication of CN113980988B publication Critical patent/CN113980988B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03016—Phosphoprotein phosphatase (3.1.3.16), i.e. calcineurin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of genetic engineering, relates to a gene for regulating and controlling the potassium content of tobacco leaves, in particular to an NtYpi1 gene capable of regulating and controlling the potassium content of tobacco leaves and application thereof. The invention provides an NtYpi1 gene for regulating and controlling the potassium content of tobacco leaves, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1. The application of the NtYpi1 gene for regulating and controlling the potassium content of the tobacco leaves is also provided, the potassium content of the tobacco leaves is obviously reduced compared with a control after the CRISPR/cas9 knockout of the gene, and the NtYpi1 gene is seen to participate in regulating and controlling the potassium content of the tobacco leaves. The invention makes clear the regulation and control function of the NtYpi1 gene on the potassium content of tobacco leaves, provides new evidence for analyzing a molecular regulation and control mechanism of the potassium ion content of tobacco leaves, also provides a new thought for cultivating tobacco with increased potassium content through gene expression regulation and control, and provides new gene resources for increasing the potassium content of tobacco leaves through a molecular means.

Description

NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, relates to a gene for regulating and controlling the potassium content of tobacco leaves, in particular to an NtYpi1 gene capable of regulating and controlling the potassium content of tobacco leaves and application thereof.
Background
Tobacco is an important leaf-use commercial crop in China, and the potassium content of the tobacco leaves seriously influences the economic value of the tobacco leaves. The potassium ions in the tobacco leaves participate in physiological and biochemical reactions of the tobacco leaves and are closely related to stress resistance of tobacco plants, and for tobacco agriculture, the potassium ions also influence the intrinsic quality and industrial availability of the tobacco leaves, so that the potassium content is generally used as an important index for measuring the quality of the tobacco leaves. The potassium has important influence on the maturity, the aroma, the combustibility, the safety and the like of the tobacco leaves, the tissue structure of the tobacco leaves can be improved by improving the potassium content of the tobacco leaves, the structure of the tobacco leaves is fine, the appearance and the color of the tobacco leaves can be improved, the tobacco leaves are deep orange, the aroma is sufficient, the taste is good, the elasticity and the toughness are high, and the filling property is enhanced; in addition, the potassium can also enhance the synthesis and accumulation of saccharides, pigments and aromatic substances in tobacco leaves, so that the higher the potassium content is, the better the quality of tobacco leaves is.
Aiming at the problem of low potassium content in tobacco leaves in China, the traditional cultivation and fertilization measures are not ideal. There are studies that consider: the high potassium application rate increases the nicotine content in the upper leaves as in documents Hu Guosong, wang Zhibin, wang Ling, han Jinfeng, mu Lin. The cumulative nature of flue-cured tobacco nicotine and the effect of some nutritional elements on nicotine content [ J ]. Henan agricultural science, 1999 (01): 10-14. There are also studies that consider: effect of potassium application on agronomic traits and nicotine content in tobacco, it was found that potassium application increased potassium content in tobacco, promoted plant growth, reduced nicotine content in tobacco, as in documents Shu Haiyan, yang Tie, cao Gangjiang, ling Hua, tian Baoming. Analysis of potassium content in tobacco in relation to agronomic traits and nicotine content in tobacco plants [ J ]. Chinese agronomic announcements, 2007 (02): 275-278. Therefore, the potassium content in the tobacco leaves cannot be effectively controlled by solely relying on cultivation fertilization measures, so that in the current research, the aim of improving the potassium content in the tobacco leaves is achieved by focusing on the development of genes related to potassium absorption and transport in the tobacco leaves.
Protein phosphatases are a class of enzyme molecules that catalyze the dephosphorylation reaction of protein molecules that have been phosphorylated, and exist in correspondence to protein kinases, together forming a switch system for the important protein activity of phosphorylation and dephosphorylation. Protein phosphatase 2A (Protein phosphatase A, P2A) is the most conserved serine/threonine phosphatase in eukaryotes and is one of the most abundant enzymes in eukaryotes. It can dephosphorylate a large number of intracellular proteins such as kinase, signal molecules and the like, and participate in a series of important biological processes related to cell division, apoptosis, gene regulation, protein synthesis and cytoskeletal organization. Typical PP2A holoenzymes exist in the form of heterotrimers, consisting of catalytic subunit C, structural subunit a, and regulatory subunit B. Protein phosphatases comprise catalytic and regulatory subunits involved in mRNA transcription, protein translation, metabolism, and cell growth and differentiation processes, such as those described in literature, bheri, m., mahiwal, s., sanyal, s.k., & Pandey, g.k. (2020): plant protein phosphatases: what do we know about their mechanism of action? The FEBS journal.
Protease inhibitors (protease inhibitor) are broadly defined as substances that bind to groups in the center of protease molecular activity, causing the protease to decrease or even disappear, but not denature the enzyme protein. Type 1protein phosphatase inhibitors (Inhibitor of type 1protein phosphatase) modulate the function of protein phosphatase inhibitors by interaction with a valency subunit to adapt to the environment or to different growth and development needs, such as described in literature, MA garcinia-gineo, iv a Muoz, joaqu i n Ario, & Sanz, p. (2003) Molecular characterization of ypi1, a novel saccharomyces cerevisiae type 1protein phosphatase inhibitor.Journal of Biological Chemistry,278 (48), 47744-52.
Currently, in the prior art, the role of protein phosphatases with Kelch-like domains in plant growth and development is disclosed, as in documents, maselli Gustavo A, slamovits Claudio H, bianchi Javier I, vilarrasa-Blasi Josep,
Figure BDA0003364502540000021
-Delgado Ana I,Mora-García Santiago.Revisiting the evolutionary history and roles of protein phosphatases with Kelch-like domains in plants.[J].Plant physiology,2014,164 (3), which reevaluates the role of the BSL (Brassinosteroid insensitive suppressor brassinosteroid insensitivity inhibitor) gene in arabidopsis based mainly on phylogenetic, functional and genetic evidence, particularly emphasizes BSL1, BSL2 and BSL3, further indicating that these three genes are highly conserved in all terrestrial plants; in contrast, BSU type 1 genes are found only in crucifers and have abnormally divergent sequences, which makes them stand out in other conserved families.
Although the prior art discloses the action of some protein phosphatases and inhibitors in plant growth, development and evolution, no report on cloning and research of tobacco protein phosphatase inhibitors is known, and no report on potassium content regulation in tobacco is known.
Disclosure of Invention
In order to make up for the defects and the blank existing in the field, the invention clones and identifies a tobacco NtYpi1 gene for regulating and controlling the potassium ion content of tobacco leaves, and CRISPR/cas9 edits the gene to find that the gene plays a role in regulating and controlling the potassium ion content of tobacco leaves; and provides an application of the NtYpi1 gene capable of regulating and controlling the potassium content of tobacco leaves. The research result of the invention has important reference for analyzing the molecular regulation of the potassium ion content of the tobacco, and also provides a new thought for cultivating the tobacco with improved potassium content through gene expression regulation.
The technical scheme of the invention is as follows:
a NtYpi1 gene capable of regulating and controlling the potassium content of tobacco leaves has a nucleotide sequence shown in SEQ ID NO. 1.
The protein capable of regulating and controlling the potassium content of tobacco leaves is characterized in that the amino acid sequence is shown as SEQ ID NO. 2; or the protein coded into the amino acid sequence shown in SEQ ID NO.2 according to the NtYpi1 gene.
The application of the NtYpi1 gene capable of regulating and controlling the potassium content of tobacco leaves is characterized in that the application of the NtYpi1 gene or the protein in regulating and controlling the potassium ion content of tobacco leaves is adopted.
Knocking out the tobacco after the NtYpi1 gene editing by using a CRISPR/cas9 technology or the tobacco after the NtYpi1 gene editing by over-expression.
An application of using CRISPR/cas9 technology to edit the NtYpi1 gene and measure the potassium content of edited tobacco, comprising the following processes:
(1) Designing target sites according to the genome sequence of the NtYpi1 gene:
sgRNA:CGAAGAAGAAGAGCGTTTCA；
(2) Designing a primer according to the target site in the step (1) to obtain a target site primer, wherein the sequence of the target site primer is as follows:
P1：ATTGCGAAGAAGAAGAGCGTTTCA；
P2：AAACTGAAACGCTCTTCTTCTTCG；
(3) According to the target site in the step (1), designing detection primers of editing materials at two sides of the target site to obtain detection primers, wherein the sequences of the detection primers are as follows:
NtYpi1-SdF：ATGTGAATGCGTGTGGGTTCTT；
NtYpi1-SdR：GCGATCCTCCGATTTACAGCAA；
(4) Preparation of dsDNA: annealing the target site primer according to step (2) to form a complementary DNA oligo to obtain dsDNA;
(5) Cutting pHSE401 carrier to obtain cut product, connecting the cut product with dsDNA obtained in step (4) to obtain connecting product;
(6) Sequencing and verification: converting the connection product obtained in the step (5) into escherichia coli, screening positive clones and performing colony PCR detection; and (3) after the PCR detection verifies that the correct positive clone strain is cultured and amplified, further sequencing analysis is carried out, and the CRISPR/cas9 vector is obtained.
(7) Obtaining editing material: converting the CRISPR/cas9 vector into wild tobacco by using a leaf disc method, amplifying the edited material by using the detection primer in the step (3), obtaining a mutant material through sequencing, and obtaining a homozygous mutant strain after selfing the mutant material;
(8) Measuring the potassium content: planting the homozygous mutant in the step (7) in a greenhouse, and taking leaf position leaves to detect the potassium content of tobacco leaves in the flowering phase of tobacco plants.
Preferably, in the preparation of dsDNA in step (4), the specific reaction system is: comprises P1 and P2, respectively, 20 mu L,10×connecting buffer5 mu L and sterilized double distilled water 5 mu L; the annealing procedure is as follows: 95 ℃ for 5min;90 ℃ for 1min;80 ℃ for 1min;70 ℃ for 1min;60 ℃ for 1min;50 ℃ for 1min;40 ℃ for 1min;30 ℃ for 1min;20 ℃ for 1min;10 ℃ for 1min.
Preferably, the preparation process of the enzyme digestion product comprises the following steps: the pHSE401 vector is subjected to enzyme digestion by using BsaI enzyme, and the enzyme digestion system comprises: plasmid 5. Mu.L, 10 Xbuffer 5. Mu.L, bsa I2. Mu.L, sterilized double distilled water 38. Mu.L; enzyme cutting for 1h at 37 ℃; and (3) carrying out electrophoresis detection analysis on the enzyme digestion product after enzyme digestion, wherein a 11520bp band is the enzyme digestion product.
Preferably, the ligation product preparation process comprises: ligating the digested product with the dsDNA prepared in step (4) using T4DNA ligase; the connection system comprises: 3 mu L of the enzyme digestion product, 10 mu L of the dsDNA product, 2 mu L of the T4DNA buffer, 1 mu L of the T4DNA ligase and 4 mu L of sterilized double distilled water; the ligation was carried out at 16℃overnight to finally obtain the ligation product.
Preferably, in the step of (6) sequencing verification, the primer design sequence used in the colony PCR detection is:
U6-26p-F：TGTCCCAGGATTAGAATGATTAGGC；
U6-26p-R：AAACCGATTCATCGCAACCAATTC。
preferably, in the editing material obtained in the step (7), the blisk method includes: the CRISPR/cas9 vector is transformed by agrobacterium to obtain agrobacterium clone containing a target vector; then carrying out tobacco transformation, cloning and culturing the obtained agrobacterium containing the target vector to obtain agrobacterium LB liquid culture medium suspension containing the target vector, adding sliced sterile wild tobacco leaves for culturing, and transferring the cultured sterile wild tobacco leaves into a differentiation culture medium for culturing; cutting buds when the buds grow to 3-5 cm, inducing the cut buds to root, transplanting the buds into sterilized nutrient soil after rooting to obtain a plurality of T0 generation transgenic tobacco seedlings, namely wild type tobacco transformed by the CRISPR/cas9 vector.
Preferably, in the step (8) of measuring the potassium content, the method of YC/T173-2003 is used for measuring the potassium content of tobacco leaves.
Through systematic research, the function of the tobacco NtYpi1 gene in regulating and controlling the potassium content of tobacco leaves is proved for the first time. Compared with tobacco leaves containing SEQ ID NO.1 sequence, the tobacco leaves prepared by using CRISPR/cas9 edited materials have remarkably reduced potassium content by about 17%. The study of the invention shows that NtYpi1 is a positive control factor of the potassium ion content of tobacco, and provides a new gene resource for improving the potassium content of tobacco leaves by a molecular means.
Drawings
FIG. 1 shows the electrophoresis pattern of the U6-26p-F/U6-26p-R detection pHSE 401-YI 1 vector. In the figure, lanes are from left to right: (1) DL2000DNA Marker (Takara), (2) PCR product with ddH2O as template, (3-4) PCR product with plasmid DNA as template. The DL2000DNA Marker (Takara) bands are 2000bp,1000bp,750bp,500bp,250bp and 100bp from top to bottom respectively; the size of the amplified product is about 400 bp.
FIG. 2 is an electrophoretogram of NtYpi1-SdF/SdR detection editing material. In the figure, lanes are from left to right: (1) DL2000DNA Marker (Takara), (2-3) is a PCR product using the extracted DNA as a template. The DL2000DNA Marker (Takara) bands are 2000bp,1000bp,750bp,500bp,250bp and 100bp from top to bottom respectively; the amplification size was 631bp.
FIG. 3 is CRISPR/cas9 compiled material mutation information.
FIG. 4 is a plot of CRISPR/cas9 compiled material sequencing peaks.
FIG. 5 shows the potassium ion content of CRISPR/cas9 edited material and control tobacco, ntYI 1-CP for edited material and CK for control.
Detailed Description
The invention is further described below in connection with the following examples, which are to be understood as merely illustrative and explanatory of the invention, and are not in any way limiting of the scope of the invention.
Unless otherwise indicated, all reagents used in the examples below are conventional in the art, and are commercially available or formulated according to conventional methods in the art, and are of laboratory grade; the experimental methods and conditions used are conventional in the art, and reference may be made to relevant experimental manuals (e.g., molecular cloning Experimental guidelines), well-known literature or manufacturer's instructions. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
According to the information of a tobacco genome sequencing database, the NtYpi1 gene is separated, the nucleotide sequence of the gene is shown as SEQ ID NO.1, the length of the sequence is 378bp, the coded amino acid sequence is shown as SEQ ID NO.2, and the length of the coded amino acid sequence is 126 amino acids.
According to the invention, after the NtYpi1 gene is knocked out by using the CRISPR/cas9 technology, the potassium ion content of tobacco leaves can be obviously reduced.
The tobacco NtYpi1 gene is a positive regulating factor of the potassium ion content of tobacco, and the effect of improving the potassium ion content of tobacco can be achieved by over-expressing the gene through a genetic engineering technology, so that the gene plays an important role in improving the potassium ion content of tobacco.
Accordingly, a first object of the present invention is to provide a tobacco NtYpi1 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.
The second object of the invention is to provide the protein coded by the tobacco NtYpi1 gene, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.
The third purpose of the invention is to provide the function of the tobacco NtYpi1 gene in regulating and controlling the potassium content of tobacco leaves, namely, the NtYpi1 gene can be knocked out to reduce the potassium content of the tobacco leaves.
The fourth object of the invention is to provide the application of the tobacco NtYpi1 gene in improving or reducing the potassium content of tobacco by means of molecular regulation and control.
EXAMPLE 1 cloning of the NtYpi1 Gene
1.1 Experimental materials
1.1.1 test strains
Coli DH 5. Alpha. Is also kept in the laboratory, and the applicant states that it is possible to distribute the laboratory to the public for verification experiments within twenty years from the date of application.
1.1.2 test tobacco variety
Tobacco: cloud 87, the laboratory save, applicants state that it is possible to distribute the verification experiments to the public for twenty years from the date of application.
1.1.3 test Agents
Phusion high-fidelity amplification enzyme reaction system, 5 XPhusion HF reaction buffer solution, dNTP, tris-HCl (PH 8), EDTA, 20% SDS, beta mercaptoethanol, absolute ethanol, isopropanol, DNA extract solution and 10 xTAE, all of which are purchased from the biological technology (Shanghai) limited company (http:// www.sangon.com).
Figure BDA0003364502540000051
High-Fidelity DNA Polymerase was obtained from Guangzhou Shengsha biosciences Co.
Figure BDA0003364502540000052
Blunt II-TOPO was purchased from Invitrogen corporation.
LB liquid medium: contains 100mg/L kanamycin and 25mg/L rifampicin. The culture medium is sterilized by damp heat at 121 ℃ for 20 min.
1.1.5 laboratory apparatus
GI-54DS automatic pressure steam sterilizer of the micro (Xiamen) instruments limited company. DHG-9240A electrothermal constant temperature blast drying oven, DNP-90-52 electrothermal constant temperature incubator. Ultra clean bench of SW-CJ-2FD, inc. of Antai air technologies, st.Job. SQP electronic analytical balance (Beijing Sidodoskom instruments Co.). Backman Optima L-XP preparative ultracentrifuge. Beijing Ding Hao source technology Co.Ltd HR220 MiniSmart mini centrifuge. Eppendorf Centrifuge-54188 refrigerated centrifuge. MX-S adjustable and fixed mixer. Card You Di biotech H203-100C heating and cooling type metal bath. BIO-RAD Thermal Cycler PCR instrument. Millipore, a Milli-Q ultra-pure water system. TGL-16G ice maker of Shanghai medical analytical instrument factory. An ultrasonic breaker Bandelin Sonopuls HD 2070 of Beijing Dalong Xinghuang laboratory instruments Co. Beijing Liuyi Instrument factory DYY-12 electrophoresis apparatus. Alliance 4.7Chroma Uvitec gel imager. Shanghai know signal ZX-S22 double-hole stainless steel constant temperature water bathAnd (3) a pot.
Figure BDA0003364502540000061
A pro-amplification instrument.
1.2 Experimental methods
(1) According to a tobacco industry genome sequencing database (internal data), a Solanaceae database (https:// solgenomics. Net /) and an Arabidopsis thaliana homologous gene, tobacco NtYpi1 gene sequence CDS sequence information is obtained, and clone gene primers are designed as follows:
SEQ ID NO. name of the name Sequence (5 '. Fwdarw.3')
3 Ypi1-F ATGGCGAGAAGCGGAAGACAAT
4 Ypi1-R TCAATTATCTTCGCAATTGCTGGTA
(2) Extracting tobacco leaf tissue RNA, and carrying out reverse transcription to obtain a first strand cDNA;
(3) Performing PCR amplification by using the first strand cDNA obtained by reverse transcription as a template, and selecting a Phusion high-fidelity amplification enzyme reaction system, wherein the total volume of the system is 50 mu L, and the method comprises the following steps: 200ng cDNA,5 XPhusion HF reaction buffer 10. Mu.L, 10mM dNTP 1. Mu.L, 2U
Figure BDA0003364502540000062
High-Fidelity DNA PolymThe erase, 10. Mu.M forward and reverse primer were each 1. Mu.L, and water was added to 50. Mu.L. PCR reaction is->
Figure BDA0003364502540000063
The pro amplification is carried out on a pro amplification instrument, and the reaction procedure is as follows: 98 ℃ for 30 seconds; 98 ℃,7 seconds, 60 ℃,30 seconds, 72 ℃,30 seconds, 35 cycles; extending at 72 ℃ for 7 minutes; recovering and purifying the PCR product; the forward and reverse primers used in this step were Ypi1-F/Ypi1-R. />
(4) The purified product was attached to a support with the following attachment system and procedure: 4. Mu.L of purified product, 1. Mu.L of salt solution, 1. Mu.L
Figure BDA0003364502540000064
mixing-Blunt II-TOPO (Invitrogen), and water-bathing at 25deg.C for 30min; e.coli DH5a is transformed by heat shock of the connected carrier, the carrier is applied to LB plate containing 100mg/L kanamycin for overnight culture after shaking culture with liquid culture medium, bacterial colony is picked for bacterial liquid culture, plasmid extraction and PCR detection, positive clone is screened, and sequencing is carried out on the positive clone.
Example 2 reduction of tobacco Potassium content Using CRISPR/cas9 knockout of the NtYpi1 Gene
2.1 Experimental materials
2.1.1 test strains
Coli (Escherichia coli) DH 5. Alpha. Agrobacterium competent cell C58C1. The above biological materials are also kept in the laboratory, and the applicant states that they can be issued to the public for validation experiments within twenty years from the date of application.
2.1.2 test tobacco variety
Tobacco: the wild tobacco cloud 87, kept in the laboratory, applicants stated that it was available to the public for validation experiments within twenty years from the date of application.
2.1.3 test Agents
pHSE401 vector, pK2GW7 vector, trans-T1 competent cell, plasmid extraction kit, PCR product recovery kit, gel recovery kit, plant RNA extraction kit, plant genome extraction kit are all purchased from Beijing full-scale gold biotechnology Co., ltd; LBA4404 competent cells and CRISPR/Cas9 plant expression vector are preserved in the south laboratory; LR ClonaseTM II enzyme Mix, reverse transcriptase M.MLV, RNase inhibitor from Promega, USA; t4DNA ligase, bsa I restriction endonuclease were purchased from New England Biotechnology (Beijing); DNeasy Plant Mini Kit from QIAGEN, germany; SYBR-Premix Ex Taq II purchased from BAO bioengineering (Dalian) Co., ltd; annealing Buffer for DNA Oligos (10 x) was purchased from Shanghai Biyun biotechnology Co., ltd; MS powder was purchased from us PHytoTechnology Laboratories company; sucrose, agar was purchased from Chongqing Ding national biotechnology Co., ltd; antibiotics such as Ampicillin (Ampicillin), kanamycin (Kanamycin), and Rifampicin (Rifampicin) were purchased from beijing sonebao technologies limited; primer synthesis and sequencing were performed by Beijing Kyowa major technologies, inc.
2.1.4 test Medium
LB liquid medium: contains 100mg/L kanamycin and 25mg/L rifampicin. The MS culture medium contains 6-BA/6-benzylaminopurine/alpha-naphthylacetic acid (0.02 mg/L) and NAA (2 mg/L). Differentiation medium: MS medium containing 6-BA/6-benzylaminopurine (0.5 mg/L), NAA/alpha-naphthylacetic acid (0.1 mg/L), hygromycin (20 mg/L) and cephalosporin (500 mg/L). The culture medium is sterilized by damp heat at 121 ℃ for 20 min.
2.1.5 laboratory apparatus
GI-54DS automatic pressure steam sterilizer of the micro (Xiamen) instruments limited company. DHG-9240A electrothermal constant temperature blast drying oven, DNP-90-52 electrothermal constant temperature incubator. Ultra clean bench of SW-CJ-2FD, inc. of Antai air technologies, st.Job. SQP electronic analytical balance (Beijing Sidodoskom instruments Co.). Backman Optima L-XP preparative ultracentrifuge. Beijing Ding Hao source technology Co.Ltd HR220 MiniSmart mini centrifuge. Eppendorf Centrifuge-54188 refrigerated centrifuge. MX-S adjustable and fixed mixer. Card You Di biotech H203-100C heating and cooling type metal bath. BIO-RAD Thermal Cycler PCR instrument. Millipore, a Milli-Q ultra-pure water system. TGL-16G ice maker of Shanghai medical analytical instrument factory. An ultrasonic breaker Bandelin Sonopuls HD 2070 of Beijing Dalong Xinghuang laboratory instruments Co. Beijing Liuyi Instrument factory DYY-12 electrophoresis apparatus. Alliance 4.7Chroma Uvitec gel imager. Shanghai know signal ZX-S22 double-hole stainless steel constant temperature water bath kettle.
2.2 Experimental methods
2.2.1 construction of CRISPR/cas9 vectors
(1) The target site was designed from the NtYpi1 genomic sequence as:
sgRNA:CGAAGAAGAAGAGCGTTTCA；
specifically, according to the NtYpi1 gene sequence, a proper target site is selected by using an online tool ZiFiTTarger version4.2, and screening requirements are as follows: (1) the target site consists essentially of 20 bases, and this 20 bases is followed by a PAM region (Protospacer adjacent motif, PAM) of NGG (N is any base) 3 bases; (2) the target site is selected as far as possible at the front end of the coding region of the gene.
(2) Designing a primer according to the target site in the step (1) to obtain a target site primer, wherein the target site primer is as follows:
SEQ ID NO. name of the name Sequence (5 '. Fwdarw.3')
5 P1 ATTGCGAAGAAGAAGAGCGTTTCA
6 P2 AAACTGAAACGCTCTTCTTCTTCG
(3) According to the target site in the step (1), designing detection primers of editing materials at two sides of the target site to obtain detection primers, wherein the detection primers are as follows:
SEQ ID NO. name of the name Sequence (5 '. Fwdarw.3')
7 NtYpi1-SdF ATGTGAATGCGTGTGGGTTCTT
8 NtYpi1-SdR GCGATCCTCCGATTTACAGCAA
The amplification length was 631bp.
(4) Preparation of dsDNA: annealing the target site primer obtained in the step (2) to form a complementary DNA oligo to obtain dsDNA; the specific reaction system is as follows: 50. Mu.L of the reaction system, including P1. Mu.L, P2. Mu.L, 10×Annealing buffer 5. Mu.L, sterilized double distilled water 5. Mu.L. The annealing procedure is as follows: 95 ℃ for 5min;90 ℃ for 1min;80 ℃ for 1min;70 ℃ for 1min;60 ℃ for 1min;50 ℃ for 1min;40 ℃ for 1min;30 ℃ for 1min;20 ℃ for 1min;10 ℃ for 1min.
(5) Cutting pHSE401 carrier to obtain cut product, connecting the cut product with dsDNA obtained in step (4) to obtain connecting product;
the method comprises the following specific steps: the pHSE401 vector was digested with BsaI enzyme, and the digestion system was 50. Mu.L, comprising: plasmid 5. Mu.L, 10 Xbuffer 5. Mu.L, bsa I2. Mu.L, sterilized double distilled water 38. Mu.L, digested at 37℃for 1h;
after enzyme digestion, the enzyme digestion products are subjected to electrophoresis detection and analysis, two bands of 1200bp and 11520bp can be seen, and 11520bp of enzyme digestion products are recovered for later use;
ligating the recovered large fragment cleavage product with the dsDNA prepared in step (4) using T4DNA ligase, ligation system 20. Mu.L: 3 mu L of the recovered vector enzyme digestion product, 10 mu L of the dsDNA product formed by annealing, 2 mu L of T4DNA buffer, 1 mu L of T4DNA ligase, 4 mu L of sterilized double distilled water and overnight connection at 16 ℃ to obtain a connection product;
(6) Sequencing and verification: converting the ligation product obtained in the step (5) into escherichia coli, screening positive clones (kanamycin for pHSE401 vector resistance) and performing colony PCR detection; in the colony PCR detection, the primers used are designed as follows:
SEQ ID NO. name of the name Sequence (5 '. Fwdarw.3')
9 U6-26p-F TGTCCCAGGATTAGAATGATTAGGC
10 U6-26p-R AAACCGATTCATCGCAACCAATTC
The PCR system is as follows:
Figure BDA0003364502540000091
the PCR procedure was as follows:
Figure BDA0003364502540000092
wherein the annealing temperature is adjusted according to the temperature of the primer itself. The PCR product was then removed and the amplification result was detected by 2% agarose gel electrophoresis.
After the PCR detection verifies that the correct positive clone strain is cultured and amplified, sequencing analysis is further carried out, as shown in figure 1, the U6-26p-F/U6-26p-R is used for detecting the pHSE 401-YI 1 carrier electrophoresis pattern, and the pHSE 401-YI 1 carrier is obtained, and the amplified product size is about 400 bp; the primers used in the sequencing were U6-26p-F as described above.
Converting the CRISPR/cas9 vector into wild tobacco by using a leaf disc method, amplifying the edited material by using the detection primer in the step (3), and obtaining a mutant material through sequencing, wherein the mutant material is selfed to obtain a homozygous mutant line.
In order to facilitate an understanding of the present invention, a leaf disc method will be described herein. The leaf disc method is a simple and feasible method for transforming, selecting and regenerating plant cells. Plant cells are transformed by the usual methods of Ti. The method comprises sterilizing the surface of the leaf of the experimental material (such as tobacco), and removing the round small pieces (leaf discs) from the leaf with a sterilized stainless steel puncher. In order to inoculate the leaf disk, the leaf disk is soaked in a soil agrobacterium culture solution for 4-5 min, then is sucked to dryness by filter paper, and is placed on a nursing culture medium for culture, and the back of the leaf disk is required to be contacted with the culture medium. The nursing medium is prepared by uniformly distributing a layer of carrot cells or other cell suspension on a specific solid medium and then covering a layer of filter paper. After two days of culture on the care medium, the leaf discs were transferred to selection medium containing the appropriate antibiotics for culture. After several weeks, callus grows around the leaf discs and seedlings differentiate. Further examination of these seedlings allowed determination of whether they contained the exogenous gene or not and the expression of the exogenous gene. The leaf disc method is actually a transformation method which is established after the improvement of the co-culture method. Leaf explants were infected with Agrobacterium and co-cultured for a short period of time. During the cultivation process, the vir genes of Agrobacterium are induced, and their activation initiates the transfer of T-DNA into plant cells. After co-cultivation, the transformed explants are also subjected to screening, callus culture, induced differentiation and other steps to obtain regenerated plants. The leaf disc method is simple in method, and can obtain transformed plant faster without protoplast operation, so that the leaf disc method is a good way for carrying out transgene by using plant explants as materials.
2.2.2 Agrobacterium transformation
And (3) dissolving the agrobacterium competent cells C58C1, adding the vector pHSE401-Ypi1 obtained in the step (6) of constructing the CRISPR/cas9 vector by 2.2.1, and carrying out agrobacterium transformation to obtain the agrobacterium clone containing the target vector. The method comprises the following steps: agrobacterium competent cells (C58C 1) were removed from the-80℃refrigerator, placed on ice for lysis and then added with vector pHSE401-Ypi 14. Mu.L; quick-freezing with liquid nitrogen for 1 minute, transferring into 37 ℃ water bath for 5 minutes, further ice-bathing for 2 minutes, adding 1mL of LB liquid medium into the mixture, and culturing for 3-4 hours at 28 ℃ and 220 rpm; the culture was spread on LB solid medium containing 100mg/L kanamycin and 25mg/L rifampicin, and cultured upside down at 28℃for 2-3 days, and Agrobacterium clones containing the objective vector were visualized.
2.2.3 tobacco conversion
Carrying out streak inoculation on the obtained agrobacterium clone containing the target vector, and then carrying out propagation in an LB (LB) culture medium containing kanamycin and rifampicin to obtain an agrobacterium LB liquid culture medium suspension containing the target vector; the method comprises the following steps: agrobacteria clone containing target carrier is selected, streaked on LB plate containing kanamycin and rifampicin, cultured for 2-3 days at 28 ℃; scraping streak bacterial plaque, inoculating the streak bacterial plaque into LB culture medium containing kanamycin and rifampicin, performing shake culture at 28 ℃ and 220rpm, and infecting when the bacterial liquid concentration reaches OD=0.5-0.8.
Taking wild tobacco leaves, treating the wild tobacco leaves by using ethanol and HgCl2, flushing the wild tobacco leaves by using sterile water, and sucking liquid on the surfaces of the tobacco leaves to obtain the sterile wild tobacco leaves; the method comprises the following steps: placing the wild tobacco leaves in a 500mL wide-mouth bottle, adding a proper amount of 75% ethanol, and rinsing for 1min; removing ethanol, adding 0.1% HgCl2 solution, and placing on a shaking table to oscillate for 15-30 minutes at room temperature; the solution was discarded and rinsed 6 times with sterile water.
Cutting the obtained sterile wild tobacco leaves into small pieces, putting the small pieces into an agrobacterium LB liquid culture medium suspension containing a target carrier for culturing, and transferring the tobacco leaves into a differentiation culture medium for culturing until callus is gradually formed at the cut of the tobacco leaves and buds are differentiated; the method comprises the following steps: taking out the obtained sterile wild tobacco leaves, washing off surface liquid by using sterile absorbent paper, cutting the sterile leaves into small pieces of 1cm multiplied by 1cm by using scissors, putting the tobacco leaves cut into the small pieces into agrobacterium LB liquid culture medium suspension containing a target carrier, and standing for 15-20 min; taking out tobacco leaves, sucking excessive bacterial liquid by sterile filter paper, and dark culturing in MS culture medium containing 6-BA (0.02 mg/L) and NAA (2 mg/L) at 25deg.C for two days; transferring tobacco leaves into a differentiation medium, contacting the incision with the medium, wherein the differentiation medium is an MS medium containing 6-BA (0.5 mg/L), NAA (0.1 mg/L), hygromycin (20 mg/L) and cephalosporin (500 mg/L), carrying out secondary culture every 2-3 weeks, gradually forming callus at the incision, and finally differentiating and sprouting. Cutting buds when the buds grow to 3-5 cm, inducing the cut buds to root, and transplanting the buds into sterilized nutrient soil after rooting to obtain a plurality of T0 generation transgenic tobacco seedlings; the method comprises the following steps: cutting off buds growing to 3-5 cm, transferring into an MS culture medium to induce rooting, taking out the transgenic plants after rooting from the rooting culture medium, washing the culture medium with tap water, and transplanting the transgenic plants into sterilized nutrient soil.
2.2.4 sequencing screening editing Material
After T0 generation transgenic tobacco seedlings of the transgenic plants grow in nutrient soil for 1 week, selecting leaves to extract DNA, detecting an electrophoresis pattern of an editing material as shown in figure 2, amplifying by using detection primers NtYpi1-SdF/SdR in the step (3) to obtain an amplification product with 631bp, sequencing the amplification product by using a forward primer after purifying, and analyzing a sequencing result to obtain the editing material with the NtYpi1 gene missing 1 base T at an editing site; planting the editing material to obtain T1 generation plant, sequencing, screening homozygous mutant single plant and harvesting to obtain T2 generation tobacco seed with NtYpi1 homozygous mutation.
The method comprises the following steps: and (3) after the T0 generation transgenic seedlings grow for about 1 week, selecting 20 tobacco seedlings, taking leaves, extracting DNA by using DNeasy Plant Mini Kit (QIAGEN), amplifying the primers NtYpi1-SdF/SdR designed in the step (3) in which the CRISPR/cas9 vector is constructed by using 2.2.1, and sequencing by using forward primers after the amplified products are purified. As shown in FIG. 3, the CRISPR/cas9 edited material mutation information is analyzed to obtain an edited material with 1 base T deleted from the NtYpi1 gene. The editing material T1 generation plants are planted, homozygous mutant single plants (shown in figure 4, CRISPR/cas9 editing material sequencing peak diagram) are screened through sequencing, and T2 generation seeds are obtained through seed collection.
Planting the obtained T2 generation tobacco seeds with the NtYpi1 homozygous mutation in a greenhouse to obtain a T2 generation tobacco strain, and detecting the potassium content of tobacco leaves of the plants by using a YC/T173-2003 method; the method comprises the following steps: and (3) comparing the mutant strain obtained by greenhouse planting with a wild tobacco plant, taking 9-11 leaves (calculated from the lower part) in the flowering period of the tobacco plant, deactivating enzyme, drying, and detecting the potassium content of the tobacco leaves by using a YC/T173-2003 method. YC/T173-2003 refers to the measurement of potassium in tobacco and tobacco products, also known as flame photometry.
Planting the obtained T2 generation tobacco seeds with the NtYpi1 homozygous mutation in a greenhouse to obtain a T2 generation tobacco strain, and detecting the potassium content of tobacco leaves of the plants by using a YC/T173-2003 method; the method comprises the following steps: and (3) comparing the mutant strain obtained by greenhouse planting with a wild tobacco plant, taking 9-11 leaves (calculated from the lower part) in the flowering period of the tobacco plant, deactivating enzyme, drying, and detecting the potassium content of the tobacco leaves by using a YC/T173-2003 method. Compared with tobacco leaves containing SEQ ID NO.1 sequence, the potassium content of the T2 generation tobacco of the edited material is obviously reduced.
As shown in fig. 5, ntYpi1-CP is an editing material, CK is a control group; compared with the CK group containing the SEQ ID NO.1 sequence, the T2-generation tobacco NtYpi1-CP of the edited material has the advantages that the potassium content in tobacco leaves is obviously reduced by about 17 percent.
In addition to the above specific implementation process, it should be noted that the invention also includes a method for knocking out the NtYpi1 gene edited tobacco by using CRISPR/cas9 technology, wherein the potassium content of the tobacco is obviously reduced; it is of course also possible to obtain tobacco edited by over-expression of the NtYpi1 gene.
The foregoing has outlined the basic principles, features, and advantages of the present invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims.
Sequence listing
<110> tobacco agricultural science institute of Yunnan province
<120> NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof
<130> 20211116
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 378
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atggcgagaa gcggaagaca atcaccatta ccggcgacca ccggaacaac aacagcaaca 60
ataaccctaa ccctaaacaa ctcatcggaa tcctcctcct catcgtctga acagctgcag 120
caacatccaa cagaaaccct aactctgaaa ctgaaaccga agaagaagag cgtttcatgg 180
aagcaaggta ctgtggacaa cgagttcctc aacaagagga gctctaagat ttgctgtata 240
tttcacaagg aaaagccttt tgatgaggat gacagcgatg gcgatgaaaa tgaaaatcaa 300
tcagataaaa aagatcacca ttgctgtaaa tcggaggatc gcggtgaagc cagtaccagc 360
aattgcgaag ataattga 378
<210> 2
<211> 125
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Ala Arg Ser Gly Arg Gln Ser Pro Leu Pro Ala Thr Thr Gly Thr
1 5 10 15
Thr Thr Ala Thr Ile Thr Leu Thr Leu Asn Asn Ser Ser Glu Ser Ser
20 25 30
Ser Ser Ser Ser Glu Gln Leu Gln Gln His Pro Thr Glu Thr Leu Thr
35 40 45
Leu Lys Leu Lys Pro Lys Lys Lys Ser Val Ser Trp Lys Gln Gly Thr
50 55 60
Val Asp Asn Glu Phe Leu Asn Lys Arg Ser Ser Lys Ile Cys Cys Ile
65 70 75 80
Phe His Lys Glu Lys Pro Phe Asp Glu Asp Asp Ser Asp Gly Asp Glu
85 90 95
Asn Glu Asn Gln Ser Asp Lys Lys Asp His His Cys Cys Lys Ser Glu
100 105 110
Asp Arg Gly Glu Ala Ser Thr Ser Asn Cys Glu Asp Asn
115 120 125
<210> 3
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atggcgagaa gcggaagaca at 22
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
tcaattatct tcgcaattgc tggta 25
<210> 5
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
attgcgaaga agaagagcgt ttca 24
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
aaactgaaac gctcttcttc ttcg 24
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atgtgaatgc gtgtgggttc tt 22
<210> 8
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gcgatcctcc gatttacagc aa 22
<210> 9
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
tgtcccagga ttagaatgat taggc 25
<210> 10
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
aaaccgattc atcgcaacca attc 24

Claims (7)

1. The application of the NtYpi1 gene capable of regulating and controlling the potassium content of tobacco leaves is characterized in that the NtYpi1 gene with a nucleotide sequence shown as SEQ ID NO.1 or the application of the NtYpi1 gene with an encoded protein with an amino acid sequence shown as SEQ ID NO.2 in regulating and controlling the potassium content of tobacco leaves is used.
2. The use according to claim 1, characterized in that the use of CRISPR/cas9 technology to edit the NtYpi1 gene and to measure the potassium content of the tobacco after editing comprises the following processes:
(1) Designing target sites according to the genome sequence of the NtYpi1 gene:
sgRNA: CGAAGAAGAAGAGCGTTTCA；
(2) Designing a primer according to the target site in the step (1) to obtain a target site primer, wherein the sequence of the target site primer is as follows:
P1：ATTGCGAAGAAGAAGAGCGTTTCA；
P2：AAACTGAAACGCTCTTCTTCTTCG；
(3) According to the target site in the step (1), designing detection primers of editing materials at two sides of the target site to obtain detection primers, wherein the sequences of the detection primers are as follows:
NtYpi1-SdF：ATGTGAATGCGTGTGGGTTCTT；
NtYpi1-SdR：GCGATCCTCCGATTTACAGCAA；
(4) Preparation of dsDNA: annealing the target site primer according to step (2) to form a complementary DNA oligo to obtain dsDNA;
(5) Cutting pHSE401 carrier to obtain cut product, connecting the cut product with dsDNA obtained in step (4) to obtain connecting product;
(6) Sequencing and verification: converting the connection product obtained in the step (5) into escherichia coli, screening positive clones and performing colony PCR detection; the PCR detection verifies that the correct positive clone strain is cultured and amplified and then further sequenced analysis is carried out, so that the CRISPR/cas9 vector is obtained;
(7) Obtaining editing material: converting the CRISPR/cas9 vector obtained in the step (6) into wild tobacco by using a leaf disc method, amplifying the edited material by using the detection primer in the step (3), obtaining a mutant material through sequencing, and obtaining a homozygous mutant line after selfing the mutant material;
(8) Measuring the potassium content: planting the homozygous mutant in the step (7) in a greenhouse, and taking leaf position leaves to detect the potassium content of tobacco leaves in the flowering phase of tobacco plants.
3. The use according to claim 2, wherein in step (4) of preparing dsDNA, the specific reaction system is: comprises P1 and P2, respectively, 20 mu L,10×connecting buffer5 mu L and sterilized double distilled water 5 mu L; the annealing procedure is as follows: 95 ℃ for 5min;90 ℃ for 1min;80 ℃ for 1min;70 ℃ for 1min;60 ℃ for 1min;50 ℃ for 1min;40 ℃ for 1min;30 ℃ for 1min;20 ℃ for 1min;10 ℃ for 1min.
4. The use according to claim 2, wherein the preparation of the cleavage product comprises: the pHSE401 vector is subjected to enzyme digestion by using BsaI enzyme, and the enzyme digestion system comprises: plasmid 5. Mu.L, 10 Xbuffer 5. Mu.L, bsa I2. Mu.L, sterilized double distilled water 38. Mu.L; enzyme cutting for 1h at 37 ℃; and (3) carrying out electrophoresis detection analysis on the enzyme digestion product after enzyme digestion, wherein a 11520bp band is the enzyme digestion product.
5. The use according to claim 2, wherein the ligation product preparation process comprises: ligating the digested product with the dsDNA prepared in step (4) using T4DNA ligase; the connection system comprises: 3 mu L of the enzyme digestion product, 10 mu L of the dsDNA product, 2 mu L of the T4DNA buffer, 1 mu L of the T4DNA ligase and 4 mu L of sterilized double distilled water; the ligation was carried out at 16℃overnight to finally obtain the ligation product.
6. The use of claim 2, wherein in step (6) of sequencing validation, the primer design sequence used in the colony PCR detection is:
U6-26p-F：TGTCCCAGGATTAGAATGATTAGGC；
U6-26p-R：AAACCGATTCATCGCAACCAATTC。
7. the use according to claim 2, wherein in said (8) determining the potassium content, the potassium content of the tobacco leaves is detected by the method of YC/T173-2003.
CN202111392074.0A 2021-11-19 2021-11-19 NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof Active CN113980988B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111392074.0A CN113980988B (en) 2021-11-19 2021-11-19 NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111392074.0A CN113980988B (en) 2021-11-19 2021-11-19 NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof

Publications (2)

Publication Number Publication Date
CN113980988A CN113980988A (en) 2022-01-28
CN113980988B true CN113980988B (en) 2023-05-02

Family

ID=79749980

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111392074.0A Active CN113980988B (en) 2021-11-19 2021-11-19 NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof

Country Status (1)

Country Link
CN (1) CN113980988B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114507271B (en) * 2022-02-24 2023-06-09 山东省农业科学院 Small molecular protein for improving tobacco leaf quality

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113528537A (en) * 2021-08-11 2021-10-22 云南省烟草农业科学研究院 NtQPT2 gene mutant for reducing nicotine content in tobacco leaves and application thereof
CN113943740B (en) * 2021-11-19 2024-02-09 云南省烟草农业科学研究院 NtCHA1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof

Also Published As

Publication number Publication date
CN113980988A (en) 2022-01-28

Similar Documents

Publication Publication Date Title
US9756871B2 (en) TAL-mediated transfer DNA insertion
AU2008344053B2 (en) Woody plants having improved growth charateristics and method for making the same using transcription factors
CN110904071B (en) Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance
WO2014144094A1 (en) Tal-mediated transfer dna insertion
CN111187778B (en) Wheat salt-tolerant gene TaFLZ2 and application thereof
CN111574605B (en) Application of rice gene OsLAT5 in regulation of absorption and accumulation of diquat
CN110128514A (en) Rise&#39;s boot period cold resistance GAP-associated protein GAP CTB4b and encoding gene and application
CN110643589B (en) Protein for improving drought resistance of plants and application thereof
CN113980988B (en) NtYpi1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof
CN113528537A (en) NtQPT2 gene mutant for reducing nicotine content in tobacco leaves and application thereof
CN112143738B (en) Tobacco receptor protein gene and cloning method and application thereof
CN104404043A (en) Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana
CN113943740B (en) NtCHA1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof
CA3154052A1 (en) Plants having a modified lazy protein
CN113461794B (en) Kit and method for regulating seed germination and application thereof
WO2018196744A1 (en) Transgenic soybean event gc1-1 exogenous insert flanking sequence and application thereof
CN113980979B (en) NtLHY1 gene capable of regulating and controlling potassium content of tobacco leaves and application thereof
CN111560055B (en) Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat
CN110452914B (en) Gene BnC04BIN2-like1 for regulating brassinolide signal transduction and application thereof
CN113046361A (en) Application of NtFER gene-based modification in improvement of bacterial wilt resistance of plants
KR102573947B1 (en) Gene editing system for increasing of soybean gene editing efficiency and uses thereof
CN104651326B (en) The carboxylic oxidase of 1 amino-cyclopropane 1 and its encoding gene, mutational site and application in resistance to the action of a drug barnyard grass
AU2020242361A1 (en) A method to improve the agronomic characteristics of plants
CN116590331A (en) Application of SmD3-b in regulating drought and salt stress resistance of plants
CN115820674A (en) use of up20 sequences for enhancing gene expression and methods therefor

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant