CN113980960A - Specific primer and method for searching combination of known promoter sequence and unknown protein - Google Patents
Specific primer and method for searching combination of known promoter sequence and unknown protein Download PDFInfo
- Publication number
- CN113980960A CN113980960A CN202111438720.2A CN202111438720A CN113980960A CN 113980960 A CN113980960 A CN 113980960A CN 202111438720 A CN202111438720 A CN 202111438720A CN 113980960 A CN113980960 A CN 113980960A
- Authority
- CN
- China
- Prior art keywords
- probe
- magnetic
- protein
- magnetic bead
- biotin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
- C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a specific primer and a method for searching a known promoter sequence combined with unknown protein, belonging to the technical field of molecular biology, wherein the specific primer sequence is as follows: AGAGCATTGCGACCAGCGGCTTGAC are provided. The invention also provides a method for searching a known promoter sequence and an unknown protein (transcription factor) by using the universal primer, which specifically comprises the steps of preparing a promoter fragment containing a biotin label, pretreating magnetic beads, preparing a probe-magnetic bead compound, extracting active total protein of tissues, and detecting the active total protein by vertical electrophoresis of DNA pulldown and SDS-PAGE. The invention reduces the cost of DNA pulldown experiment by designing the specific universal primer of the biotin label.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a specific primer and a method for searching a known promoter sequence combined with unknown protein.
Background
DNA interacting proteins play an important role in many biological processes, including gene regulation. These proteins bind to DNA sequences or interact with other DNA binding proteins to regulate gene expression. The identification of DNA interacting proteins is useful for understanding their role in gene regulation and for discovering regulatory mechanisms.
The binding of transcription factors to specific regulatory elements on the promoter region is critical in gene expression and regulation. The activity of activating transcription requires a DNA-binding transactivator to recruit transcription coactivators or repressors, and a number of related proteins that interact with the underlying transcription factors, and thus analysis of these large DNA-binding protein complexes is an important step in elucidating the mechanisms regulating gene expression.
The currently known DNA-protein interaction techniques mainly include: DNA pulldown, CHIP, EMSA, dual luciferase, yeast single hybrid, and the like.
The basis for the successful implementation of DNA pull down is that short DNA fragments, which may be naturally occurring or formed from oligonucleotides, contain sites with high affinity for DNA binding proteins. It is known that biotin and streptavidin in a biotin/streptavidin purification system can form a tight and substantially irreversible complex, biotinylated nucleotide molecules are incorporated into the ends of DNA fragments (i.e., probes), and the DNA fragments are used to incubate with beads, taking advantage of the high affinity of biotin for avidin, to obtain DNA fragments containing biotin labels. Active protein is then added to the DNA-magnetic bead complex, thereby forming a mixture comprising protein, DNA, magnetic beads, and DNA-protein-magnetic beads. The mixture is washed repeatedly by the attraction of the magnetic frame to the beads, and finally the target protein is eluted from the remaining DNA-protein-beads with a high salt buffer.
The advantage of DNA pull down compared to EMSA is that a large number of proteins in the complex can be analyzed simultaneously.
Wu-Guo Deng et al incubated the cyclooxygenase-2 promoter as a probe with nuclear extracts and finally the proteins in the complex were evaluated by immunoblotting and a series of transcription factors were detected.
In order to explore the binding proteins in protein mixtures, mass spectrometry techniques allow for more in-depth quantitative analysis of protein complexes.
Diem Hong Tran et al identified six proteins that bound to the 5' flanking region of the human D-amino acid oxidase gene by combining DNA pull down with two-dimensional gel electrophoresis and mass spectrometry.
However, there are few studies related to the study of the interaction between a promoter and a transcription factor to elucidate the mechanism of regulation of gene expression using the DNA pulldown method.
Disclosure of Invention
The invention provides a DNA pulldown method which can save manpower and material resources and reduce cost in order to solve various problems existing in the prior promoter transcription factor interaction technology.
In order to achieve the purpose, the invention adopts the following technical scheme:
a specific primer for searching a known promoter sequence to bind to an unknown protein is disclosed, wherein the specific primer has the following sequence: AGAGCATTGCGACCAGCGGCTTGAC are provided.
The invention also provides a method for searching the known promoter sequence to bind to the unknown protein (transcription factor) by using the universal primer, which specifically comprises the following steps:
step one, preparing a promoter fragment containing a biotin label: designing a specific universal primer with a biotin label, and obtaining a probe with the biotin label by using a nested PCR (polymerase chain reaction) combined touchdown PCR method;
step two, magnetic bead pretreatment: washing the magnetic beads three times by using a Wash/Binding Buffer;
step three, preparing a probe-magnetic bead compound: combining the promoter fragment with the biotin label in the step one with the magnetic beads pretreated in the step two;
step four, extracting active total protein of the tissue;
step five, DNA pulldown: adding the total tissue active protein prepared in the fourth step into the probe-magnetic bead compound prepared in the third step, adding a protease inhibitor and DTT (draw texturing yarn) for co-incubation for 5 hours at 4 ℃;
step six, SDS-PAGE vertical electrophoresis detection: and placing the incubation product in the fifth step on a magnetic frame to stand for more than 2min, collecting magnetic beads, adding ice-cold PBS into the magnetic beads for washing, collecting a protein-probe-magnetic bead compound, adding PBS and a protein loading buffer solution into the protein-probe-magnetic bead compound, heating at 95 ℃ for 5min, placing the protein-probe-magnetic bead compound on the magnetic frame to stand for more than 2min, and taking supernatant to perform SDS-PAGE vertical electrophoresis detection. Preferably, the first step of preparing the promoter fragment containing the biotin label comprises the following steps: selecting upstream 2000bp and downstream 500bp of transcription initiation site of target gene, designing outer primer in the region, and amplifying by PCR technology to improve template quality; and designing an inner primer by taking the primary PCR product as a template, and carrying out secondary amplification by using a specific universal primer marked by the biotin and a touchdown PCR technology to obtain a specific promoter fragment containing the biotin mark.
Preferably, the method for magnetic bead pretreatment in the second step comprises the following steps: washing the magnetic beads marked by the streptavidin by using the Wash/Binding Buffer, placing the magnetic beads on a magnetic frame for standing for more than 2min, removing the Wash/Binding Buffer washing solution, and repeating the steps for three times; the formula of the Wash/Binding Buffer is as follows: 0.5M NaCl, 20mM Tris-HCl pH 7.5, 1mM EDTA.
Preferably, the method for preparing the probe-magnetic bead complex in the third step comprises the following steps: adding the biotin-labeled promoter fragment prepared in the first step into the magnetic beads pretreated in the second step, whirling to suspend the magnetic beads, standing overnight at 4 ℃, placing the centrifuge tube with the probe-magnetic bead complex on a magnetic frame after standing overnight, standing for more than 2min, removing the supernatant, collecting the probe-magnetic bead complex, adding a Wash/Binding Buffer into the probe-magnetic bead complex for washing three times, placing the centrifuge tube on the magnetic frame for standing for more than 2min after washing each time, collecting the probe-magnetic bead complex adsorbed on the wall of the centrifuge tube, and adding an electrophoresis Buffer into the probe-magnetic bead complex collected after washing the last time to obtain the probe-magnetic bead complex; the Elution Buffer formula comprises the following components: Tris-HCl (10 mM pH 7.5), EDTA (1 mM).
Preferably, the sixth step is washing three times with ice-cold PBS added to the magnetic beads.
The invention firstly designs the outer primers of nested PCR in a region of 2000bp upstream and 500bp downstream of a transcription initiation site of a target gene, the template quality is improved through primary PCR amplification, the product obtained through amplification is used as a template of secondary PCR, the inner primers are designed on the basis, specific universal primers of biotin labels are utilized, and secondary amplification is carried out through touchdown PCR to obtain a promoter fragment of the biotin labels; streptavidin coupled on magnetic beads has high affinity with biotin; incubating the total tissue active protein and the magnetic bead-probe compound together, specifically combining the action protein (transcription factor) with the probe magnetic bead, and eluting to obtain a magnetic bead-probe-protein compound; and finally, adding PBS and 5 Xprotein loading buffer solution into the magnetic bead-probe-protein compound, placing the mixture into a water bath kettle, heating the mixture for 5min at 95 ℃, and taking the supernatant to perform SDS-PAGE vertical electrophoresis detection.
Compared with the prior art, the invention has the following beneficial effects:
(1) the invention reduces the cost of DNA pulldown experiment by designing the specific universal primer of the biotin label.
(2) The invention prepares the promoter fragment containing the biotin label by combining the nested PCR with touchdown PCR, thereby effectively improving the specificity and sensitivity of amplification.
(3) By utilizing the magnetic binding effect of the magnetic beads and the magnetic frame, compared with the traditional agarose beads, the invention can more effectively remove the supernatant, more effectively remove non-specifically bound genes and proteins and improve the specificity of the reaction; the magnetic beads replace agarose beads, so that a centrifugation step is omitted, and the experiment time is saved.
(4) According to the invention, by utilizing the characteristic that biotin and streptavidin have high affinity, a promoter fragment marked by biotin is obtained by a PCR technology and then is combined with the streptavidin coupled on magnetic beads, so that the specificity of combination of the magnetic beads and target fragments is ensured.
Drawings
FIG. 1: the electrophoresis result of the primary PCR product is shown in the figure, wherein lane 1 is DL2000 Marker, lane 2 is lambda-Hind lll, lanes 3 and 4 are primary product target band of Takifugu rubripes chemokine CCL25b, and lanes 5 and 6 are primary product target band of Takifugu rubripes chemokine CCR9 b;
FIG. 2: the electrophoresis result of the secondary PCR product is shown in the figure, wherein lanes 1 and 5 are DL2000 Marker, lanes 2 and 3 are CCR9b promoter fragment obtained by secondary PCR amplification, lanes 6 and 7 are CCL25b promoter fragment obtained by secondary PCR amplification, and lanes 4 and 8 are negative control;
FIG. 3: the effect of the interactive protein (transcription factor) obtained by the DNA pulldown method is shown in the following, wherein lane 1 is a protein Marker, lane 2 is a protein (transcription factor) obtained by the CCR9b promoter in the brain, lane 3 is a protein (transcription factor) obtained by the CCR9b promoter in the gill, lane 4 is a CCR9b promoter fragment, lane 5 is a DL2000 Marker, lane 6 is a protein (transcription factor) obtained by the CCL25b promoter in the brain, lane 7 is a protein (transcription factor) obtained by the CCL25b promoter in the gill, and lane 8 is a CCL25b promoter fragment.
Detailed Description
For a better understanding of the present invention, reference is made to the following detailed description taken in conjunction with the accompanying drawings. The reagents or instruments used in the present invention are commercially available, and the detection methods and the like used are well known in the art and will not be described herein.
Example 1: fugu rubripes chemokine CCL25b and clone of promoter sequence with biotin label of receptor CCR9b gene
In this example, the applicant first obtained the takifugu rubripes CCL25b and CCR9b gene transcription start site upstream 2000bp and downstream 500bp through NCBI online website, and designed a pair of outer primers (CCL25bF1, CCL25bR1, CCR9bF1, CCR9bR1) in this region. Taking fugu rubripes genome DNA as a template, and amplifying by using rTaq enzyme to obtain promoter fragments of 2013bp (CCL25b) and 2040bp (CCR9b) respectively; and designing a pair of inner primers (CCL25bF2b, CCL25bR2U, CCR9bF2b and CCR9bR2U) by taking the primary PCR product as a template, and performing secondary touchdown PCR amplification by using a biotin-labeled specific Universal Primer (UPL) and using Phanta Max Super-Fidelity DNA Polymerase to obtain 1120bp (CCL25b) and 1130bp (CCR9b) promoter fragments respectively.
(1) The sequences of the outer, inner and labelled universal primers used are shown in Table 1:
TABLE 1 primer sequences
(2) The experimental method comprises the following steps:
the DNA of the muscle tissue of the takifugu rubripes is extracted by a traditional method, the DNA extraction method is well known to a person skilled in the art, and the tissue active total protein is extracted by using a one-step animal tissue active protein extraction kit (C500006) of the biological engineering (Shanghai) GmbH: shearing 100mg of tissue into small pieces, adding an appropriate amount of ice-cold PBS, washing twice, centrifuging at 4 ℃ and 3000rpm for 3min, and removing supernatant; adding cold extraction reagent into the collected tissues, adding 1 mu l DTT, 10 mu l PMSF and 1 mu l protease inhibitor into 1mL extraction reagent before use, placing the mixture on a glass homogenizer for homogenization for 30-50 times, transferring tissue fluid after homogenization into a sterile enzyme-free EP tube, carrying out vortex oscillation at the maximum speed for 10s, placing the mixture on ice for 20min, taking out the mixture for oscillation for 3-5 times, centrifuging the mixture at 4 ℃ and 12000rpm for 10min to precipitate tissues, and transferring supernatant as an active tissue total protein part. After the extraction of the DNA is finished, the integrity of the DNA is detected by agarose gel electrophoresis, a pipetting gun is used for sucking 2 mu l of DNA solution and 1 mu l of 6 XLoading Buffer to be mixed uniformly, then the sample is applied, electrophoresis is carried out for 20min at 170V, and the integrity of the DNA is detected by observing the electrophoresis result through a gel imaging system.
The method comprises the steps of carrying out nested PCR reaction by taking genomic DNA of takifugu rubripes as a template, firstly designing a pair of external primers (table 1) by using Primer Primer5.0, wherein CCL25bF1 and CCL25bR1 are external primers used for CCL25b genes, CCR9bF1 and CCR9bR1 are external primers used for CCR9b genes, CCL25bF1, CCL25bR1, CCR9bF1 and CCR9bR1 primers are all synthesized by Shanghai Czeri bioengineering limited company, carrying out common PCR reaction to clone promoter fragments, and obtaining a reaction system (20 mu l) shown in table 2.
TABLE 2 PCR reaction System
Reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 59 ℃ for 30s, and extension at 72 ℃ for 2min for 10s, for a total of 34 cycles; extending for 10min at 72 ℃, and storing at 4 ℃.
Detecting whether the size of the PCR product strip is correct or not by using 1% agarose gel electrophoresis (figure 1), wherein a Lane 1 is a DL2000 Marker, a Lane 2 is lambda-hindlll, Lanes 3 and 4 are target fragments of CCL25b amplified by PCR, the size of the target fragment is a single strip of 2013bp, Lanes 5 and 6 are target fragments of CCR9b amplified by PCR, the size of the target fragment is a single strip of 2040bp, and after the PCR product strip is detected to be qualified, a DNA gel recovery kit of Tiangen Biochemical technology (Beijing) Limited company is used for recovering and purifying the correct strip, and the experimental step refers to the method provided by the kit.
The recovered gene fragment is used as a template of secondary PCR, a pair of inner primers is designed by using Primer Primer5.0, wherein CCR9bF2b and CCR9bR2U are inner primers of CCR9b nested PCR, CCL25bF2b and CCL25bR2U are inner primers of CCL25b nested PCR, and UPL is a specific universal Primer with biotin labels. CCL25bF2b, CCL25bR2U, CCR9bF2b, CCR9bR2U and biotin-labeled specific universal primers were synthesized from the wara gene and subjected to touchdown PCR to clone a promoter fragment carrying a biotin label, and the reaction system (20. mu.l) was as shown in Table 3.
TABLE 3 touchdown PCR reaction System
Reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 72 ℃ and extension for 1min30s, for 5 cycles; denaturation at 94 ℃ for 30s, annealing at 68 ℃ for 30s, and extension at 72 ℃ for 1min for 10s, for 5 cycles; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 1min for 10s, for 25 cycles; extending for 10min at 72 ℃, and storing at 4 ℃.
The PCR product band size was checked for correctness by 2% agarose gel electrophoresis (FIG. 2), in which lanes 1 and 5 are DL2000 Marker; lane 2 is a single band with 1155bp size, which is a CCR9b promoter fragment labeled with biotin; lane 3 is the nonbiotin-labeled CCR9b promoter fragment with a single band size of 1130 bp; lane 4 is a negative control, and no band should appear; lane 6 shows a single band of 1145bp size of the promoter fragment of CCL25b with biotin labeling; lane 7 is a single band of 1120bp in size of CCL25b promoter fragment not labeled with biotin; run 8 is a negative control and should have no bands present. Under the condition that the size of the detected product band is normal, collecting the promoter fragment with the biotin label and purifying the promoter fragment by using a common DNA product purification kit, wherein the experimental steps refer to the method provided by the kit. The purified biotin-labeled promoter fragment was assayed for concentration using Thermo NanoDrop2000 and stored at-20 ℃ for downstream experiments.
The average concentration of the CCR9b promoter fragment with the biotin label is 139.62 ng/. mu.l, and the average concentration of the CCL25b promoter fragment is 118.18 ng/. mu.l.
Example 2: preparation of Probe-magnetic bead complexes
According to the binding capacity of Magnetic Beads and nucleic acids in the specification of Streptavidin Magnetic Beads, more than 500pmol of single-stranded 25bp biotin-labeled oligonucleotide can be bound to each 1mg of Magnetic Beads, and the concentration of the biotin-labeled promoter fragment measured in example 1 is combined, and the Magnetic Beads and the biotin-labeled promoter fragment are incubated together, and the following steps are performed:
(1) the magnetic beads stored at 4 ℃ were taken, gently agitated and thoroughly suspended for 30s or mixed by end-to-end inversion for >5 min;
(2) respectively placing 30 μ l of magnetic beads in two sterile enzyme-free centrifuge tubes, respectively adding 200 μ l of Wash/Binding Buffer, vortexing to suspend the magnetic beads, placing on a magnetic frame, standing for 2min, removing supernatant, and repeating for three times;
(3) adding 420 mu l of biotin-labeled CCR9b promoter fragment into one washed magnetic bead, adding 520 mu l of biotin-labeled CCL25b promoter fragment into the other washed magnetic bead, (adding according to the principle that the magnetic bead is 1.5 times of the standard of the bound nucleotide), vortexing to suspend the magnetic bead, standing at 4 ℃ overnight, placing on a magnetic frame for 2min, and removing a supernatant;
(4) adding 500 mu l of Wash/Binding Buffer into the precipitate obtained in the step 4, vortexing to suspend magnetic beads, placing on a magnetic frame, standing for 2min, removing supernatant, and repeating for three times;
(5) and (3) adding 100 mu l of TE into the precipitate obtained in the step (5) to obtain a probe-magnetic bead complex.
Example 3: preparation and concentration determination of fugu rubripes gill tissue active protein
Extracting active total protein of branchia and brain tissue of takifugu rubripes by using a one-step animal tissue active protein extraction kit (C500006) of biological engineering (Shanghai) GmbH, and storing at-80 ℃ for later use, wherein the active total protein of the tissue obtained by extraction is subjected to protein standard curve drawing by using a BCA protein concentration determination kit (BL521A) and an ultraviolet spectrophotometer, and the extracted protein concentration is calculated by using an experimental step according to a method provided by the kit.
The gill protein concentration was calculated to be 4.04. mu.g/. mu.l and the brain protein concentration was calculated to be 4.56. mu.g/. mu.l.
Example 4: preparation of protein-probe-magnetic bead complexes
According to the total protein concentration of the branchia and brain tissue of the takifugu rubripes measured in example 3, a protein-probe-magnetic bead complex was prepared according to the standard of adding 500. mu.g of total tissue protein to 30. mu.l of magnetic beads by the following steps:
(1) and taking out the total protein of the extracted gill and brain tissue from-80 ℃, slowly rewarming in an ice box, respectively taking 110 mu l of brain tissue protein sample and 170 mu l of gill tissue protein sample, adding 2 mu l of protease inhibitor and 2 mu l of DTT into the samples, uniformly mixing, and adding the mixture into the probe-magnetic bead compound.
(2) The mixture obtained in step 1 was mixed well by inversion and incubated at 4 ℃ for 5 h.
(3) And (3) placing the mixture incubated in the step (2) on a magnetic frame, standing for 2min, removing supernatant, and collecting magnetic beads.
(4) The magnetic beads collected in step 3 were washed with ice-cold PBS (500. mu.l) three times, the supernatant was removed as much as possible, and the precipitate was collected to obtain a protein-probe-magnetic bead complex.
Example 5: SDS-PAGE vertical electrophoretic detection
To the protein-probe-magnetic bead complex obtained in example 4, 48. mu.l of PBS and 12. mu.l of 5 XProtein loading buffer were added, and the mixture was heated at 95 ℃ for 5min, and the supernatant was subjected to SDS-PAGE vertical electrophoresis (FIG. 3). Lane 1 is a protein Marker, lane 2 is a protein (transcription factor) hooked by the CCR9b promoter in the brain, lane 3 is a protein (transcription factor) hooked by the CCR9b promoter in the gill, lane 4 is a CCR9b promoter fragment, lane 5 is a DL2000 Marker, lane 6 is a protein (transcription factor) hooked by the CCL25b promoter in the brain, lane 7 is a protein (transcription factor) hooked by the CCL25b promoter in the gill, and lane 8 is a CCL25b promoter fragment.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention.
Sequence listing
<110> university of Dalian ocean
<120> specific primer and method for searching for known promoter sequence to bind unknown protein
<160> 9
<170> SIPOSequenceListing 1.0
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccgactggtc ctttagcct 19
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgctgagatg cagagacaga g 21
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tctggtattc cctcttaaca cg 22
<210> 5
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ccagcggctt gacactcaga caggcacgac cga 33
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggtgtcgtcg ttatgaatcg 20
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
caggctcacg tacatgcag 19
<210> 8
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gcagtagcgc gcagtcgt 18
<210> 9
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ccagcggctt gactgtctgt gcagcttgtg gtg 33
<210> 10
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
agagcattgc gaccagcggc ttgac 25
Claims (6)
1. A specific primer for searching a known promoter sequence to bind to an unknown protein is characterized in that the specific primer sequence is as follows: AGAGCATTGCGACCAGCGGCTTGAC are provided.
2. Method for finding the binding of a known promoter sequence to an unknown protein using the universal primer of claim 1, characterized in that it comprises in particular the following steps:
step one, preparing a promoter fragment containing a biotin label: designing a specific universal primer with a biotin label, and obtaining a probe with the biotin label by using a nested PCR (polymerase chain reaction) combined touchdown PCR method;
step two, magnetic bead pretreatment: washing the magnetic beads three times by using a Wash/Binding Buffer;
step three, preparing a probe-magnetic bead compound: combining the promoter fragment with the biotin label prepared in the step one with the magnetic beads pretreated in the step two;
step four, extracting active total protein of the tissue;
step five, DNA pulldown: adding the active total protein prepared in the fourth step into the probe-magnetic bead compound prepared in the third step, adding a protease inhibitor and DTT (draw texturing yarn) for co-incubation for 5 hours at 4 ℃;
step six, SDS-PAGE vertical electrophoresis detection: and placing the incubation product in the fifth step on a magnetic frame to stand for more than 2min, collecting magnetic beads, adding ice-cold PBS into the magnetic beads for washing, collecting a protein-probe-magnetic bead compound, adding PBS and a protein loading buffer solution into the protein-probe-magnetic bead compound, heating at 95 ℃ for 5min, placing the protein-probe-magnetic bead compound on the magnetic frame to stand for more than 2min, and taking supernatant to perform SDS-PAGE vertical electrophoresis detection.
3. The method of claim 2, wherein the first step of preparing the promoter fragment containing the biotin label comprises: selecting upstream 2000bp and downstream 500bp of transcription initiation site of target gene, designing outer primer in the region, and amplifying by PCR technology to improve template quality; and designing an inner primer by taking the primary PCR product as a template, and carrying out secondary amplification by using a specific universal primer marked by the biotin and a touchdown PCR technology to obtain a specific promoter fragment containing the biotin mark.
4. The method of claim 2, wherein the step two magnetic bead pretreatment method comprises: washing the magnetic beads marked by the streptavidin by using the Wash/Binding Buffer, placing the magnetic beads on a magnetic frame for standing for more than 2min, removing the Wash/Binding Buffer washing solution, and repeating the steps for three times; the formula of the Wash/Binding Buffer is as follows: 0.5M NaCl, 20mM Tris-HCl pH 7.5, 1mM EDTA.
5. The method of claim 2, wherein the probe-magnetic bead complexes prepared in step three are prepared by: adding the biotin-labeled promoter fragment prepared in the first step into the magnetic beads pretreated in the second step, whirling to suspend the magnetic beads, standing overnight at 4 ℃, placing the centrifuge tube with the probe-magnetic bead complex on a magnetic frame after standing overnight, standing for more than 2min, removing the supernatant, collecting the probe-magnetic bead complex, adding a Wash/Binding Buffer into the probe-magnetic bead complex for washing three times, placing the centrifuge tube on the magnetic frame for standing for more than 2min after washing each time, collecting the probe-magnetic bead complex adsorbed on the wall of the centrifuge tube, and adding an electrophoresis Buffer into the probe-magnetic bead complex collected after washing the last time to obtain the probe-magnetic bead complex; the Elution Buffer formula comprises the following components: Tris-HCl (10 mM pH 7.5), EDTA (1 mM).
6. The method of claim 2, wherein step six comprises three washes with ice-cold PBS added to the magnetic beads.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111438720.2A CN113980960A (en) | 2021-11-29 | 2021-11-29 | Specific primer and method for searching combination of known promoter sequence and unknown protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111438720.2A CN113980960A (en) | 2021-11-29 | 2021-11-29 | Specific primer and method for searching combination of known promoter sequence and unknown protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113980960A true CN113980960A (en) | 2022-01-28 |
Family
ID=79732596
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111438720.2A Withdrawn CN113980960A (en) | 2021-11-29 | 2021-11-29 | Specific primer and method for searching combination of known promoter sequence and unknown protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113980960A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL2034227B1 (en) * | 2022-10-26 | 2024-05-14 | Acad Of Military Medical Sciences | Method for efficiently enriching chromatin open region binding proteins and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080254516A1 (en) * | 2004-02-27 | 2008-10-16 | St John Judith | Method of Isolating Nucleic Acid Targets |
| CN102887938A (en) * | 2012-02-28 | 2013-01-23 | 中国农业大学 | Method for excavating difference protein of eucaryotic gene transcriptional regulation group |
| CN104862384A (en) * | 2015-03-04 | 2015-08-26 | 福建师范大学 | Method for screening protein capable of interacting with promoter |
| CN106093437A (en) * | 2016-08-03 | 2016-11-09 | 广州伯信生物科技有限公司 | A kind of DNA pulldown method and test kit |
| CN109517029A (en) * | 2018-11-26 | 2019-03-26 | 福建农林大学 | A method of rice starter DNA binding protein of effectively fishing |
-
2021
- 2021-11-29 CN CN202111438720.2A patent/CN113980960A/en not_active Withdrawn
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080254516A1 (en) * | 2004-02-27 | 2008-10-16 | St John Judith | Method of Isolating Nucleic Acid Targets |
| CN102887938A (en) * | 2012-02-28 | 2013-01-23 | 中国农业大学 | Method for excavating difference protein of eucaryotic gene transcriptional regulation group |
| CN104862384A (en) * | 2015-03-04 | 2015-08-26 | 福建师范大学 | Method for screening protein capable of interacting with promoter |
| CN106093437A (en) * | 2016-08-03 | 2016-11-09 | 广州伯信生物科技有限公司 | A kind of DNA pulldown method and test kit |
| CN109517029A (en) * | 2018-11-26 | 2019-03-26 | 福建农林大学 | A method of rice starter DNA binding protein of effectively fishing |
Non-Patent Citations (2)
| Title |
|---|
| JUN CUI ET AL.: ""Transciptome Analysis of the Gill and Swimbladder of Takifugu rubripes by RNA-Seq"" * |
| 尚凤芹 等: ""红鳍东方鲀结合CCL25b核心启动子区转录因子的鉴定"" * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL2034227B1 (en) * | 2022-10-26 | 2024-05-14 | Acad Of Military Medical Sciences | Method for efficiently enriching chromatin open region binding proteins and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2846018B2 (en) | Amplification and detection of nucleic acid sequences | |
| US20100311602A1 (en) | Sequencing method | |
| Martin et al. | [14] Principles of differential display | |
| JPS63500007A (en) | Method and kit for performing nucleic acid hybridization assays | |
| CN110853708B (en) | Design method of nucleic acid capture probe for HLA typing | |
| JP2015516814A (en) | Enrichment and sequencing of targeted DNA | |
| CN109837345B (en) | Primer and method for detecting residual DNA of mouse cells | |
| WO2017215517A1 (en) | Method for removing 5' and 3' linker connection by-products in sequencing library construction | |
| CN109628573B (en) | Kit for noninvasive prenatal detection of 12 chromosome microdeletion and microduplication syndrome and special probe set thereof | |
| CN113980960A (en) | Specific primer and method for searching combination of known promoter sequence and unknown protein | |
| CN105734679A (en) | Preparation method of nucleic acid target sequence capture sequencing library | |
| CN110747514A (en) | High-throughput single-cell small RNA library construction method | |
| JP3853161B2 (en) | Method for amplifying trace amounts of mRNA and cDNA | |
| CN111349631A (en) | Aptamer specifically combined with finotoxin-1 and application thereof | |
| CA2354682A1 (en) | Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation | |
| CN110600082B (en) | Nucleic acid capture probe for HLA typing and design method thereof | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN111363749B (en) | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof | |
| US20080293585A1 (en) | 5'/3' Ratioing Procedure for Detection of Gene Rearrangements | |
| US20060121461A1 (en) | Methods for identifying and isolating unique nucleic acid sequences | |
| CN112858693A (en) | Biomolecule detection method | |
| US20210040540A1 (en) | Parallel liquid-phase hybrid capture method for simultaneously capturing sense and antisense double strands of genomic target region | |
| CN111424069A (en) | Sample processing method suitable for detecting human long-chain non-coding RNA by third-generation sequencing technology | |
| US6743578B1 (en) | Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation | |
| WO2008124111A2 (en) | System for pulling out regulatory elements in vitro |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20220128 |