CN110747514A

CN110747514A - High-throughput single-cell small RNA library construction method

Info

Publication number: CN110747514A
Application number: CN201910921843.8A
Authority: CN
Inventors: 蔡涛; 李佳
Original assignee: National Institute of Biological Sciences Beijin
Current assignee: National Institute of Biological Sciences Beijin
Priority date: 2019-09-27
Filing date: 2019-09-27
Publication date: 2020-02-04
Anticipated expiration: 2039-09-27
Also published as: CN110747514B

Abstract

The invention provides a method for constructing a high-throughput single-cell small RNA library. The method comprises the following steps: preparing single cell suspension, adding the single cell suspension into the micropores of the chip of the single cell operation system, and selecting the micropores of single living cells for experiment; sequentially carrying out cell lysis reaction, 3 'end connection reaction, free joint removal reaction, 5' end connection reaction, reverse transcription reaction and twice PCR reaction; purifying and screening and recovering the product to obtain a single-cell small RNA library which can be directly used for on-machine sequencing; in the process of carrying out the 3 'end connection reaction, the nucleotide sequence of the adopted 3' joint is shown as SEQ ID NO: 1 is shown in the specification; in the process of carrying out the 5 'end connection reaction, the nucleotide sequence of the adopted 5' linker is shown as SEQ ID NO: 2, respectively. The method has the advantages of high accuracy, high sensitivity, good repeatability and the like.

Description

High-throughput single-cell small RNA library construction method

Technical Field

The invention belongs to the technical field of single-cell small RNA sequencing, and relates to a high-throughput single-cell small RNA library construction method.

Background

miRNA is a non-coding RNA that is widely present in eukaryotes and can regulate the expression of other genes. mirnas are partially complementary to one or more mRNA molecules and down-regulate gene expression in various ways, including translational inhibition, mRNA cleavage and deadenylation, and play an important role in regulating gene expression, cell cycle, timing of organism development, and the like. mirnas also play a key role in the development of related diseases such as cancer, and have been used in the diagnosis, staging, progression, prognosis of cancer, and assessment of responsiveness to treatment.

In the prior art, companies such as Illumina and NEB adopt small RNA standard library building kits. The sample requires high initial amount, the lowest total RNA is 100ng, and the single cell (10pg/cell) level can not be achieved; a plurality of samples cannot be mixed to build a library without designing a barcode; UMI was not designed, and the preference introduced by PCR could not be reduced; the number of self-ligation products and non-specific products of the adaptor is large, so that the target fragment is difficult to ligate and amplify, and the library building efficiency is low; the PAGE gel recovery experiment is complicated to operate and high in risk. Faridani et al disclose about a single cell small RNA library building process in 2016 Nature biotechnology journal and 2018 natureprotocol journal, and the scheme is characterized in that the number of joints is too large, and target fragments are not screened and recovered in the experimental process, so that the yield of the joint in a product is extremely high, the content of the target product is less than 1%, the data amount required by sequencing is greatly increased, and great waste is caused; the scheme has no single-cell molecular label, so that the flux of an experiment cannot be improved, and a plurality of cells cannot be operated simultaneously; this scheme has no modifications to the 3 'and 5' linkers for adding random sequences to the ends, so that during the ligation reaction, the ligation reaction may be biased.

Therefore, no feasible method has been developed to analyze miRNA expression profiles of single cells in highly heterogeneous tumor samples. Tumor samples usually contain normal cells and cancer cells, and the expression profile of mirnas in cancer cells is often masked by data analysis. Therefore, a high-sensitivity and high-throughput method for constructing a single-cell small RNA sequencing library is needed.

Disclosure of Invention

Based on the defects in the prior art, the invention aims to provide a method for constructing a high-throughput single-cell small RNA library. The invention also aims to provide a single-cell small RNA library constructed by the method. The method has the advantages of high accuracy, high sensitivity, good repeatability and the like.

The purpose of the invention is realized by the following technical means:

in one aspect, the invention provides a method for constructing a high-throughput single-cell small RNA library, which comprises the following steps:

preparing single cell suspension, adding the single cell suspension into the micropores of the chip of the single cell operation system, and selecting the micropores of single living cells for experiment;

sequentially carrying out cell lysis reaction, 3 'end connection reaction, free joint removal reaction, 5' end connection reaction, reverse transcription reaction and twice PCR reaction;

purifying and screening and recovering the product to obtain a single-cell small RNA library which can be directly used for on-machine sequencing;

in the process of carrying out the 3 'end connection reaction, the nucleotide sequence of the adopted 3' joint (RA3-A2N) is shown as SEQ ID NO: 1 is shown in the specification;

in the process of carrying out the 5 'end connection reaction, the nucleotide sequence of the adopted 5' joint (SR5F) is shown as SEQ ID NO: 2, respectively.

The invention utilizes a single cell operating system and the designed parallel single cell small RNA sequencing (PSCSR-seq) process to improve a 3' joint and a 5' joint by modification, wherein the nucleotide sequence of the 3' joint is as follows:

SEQ ID NO：1：/rApp/NNCTGTAGGCACCATCAAT/ddC/(5’→3’)

(rApp means acylated adenosine; ddC means dideoxycytidine; underlined is the specific molecular tag 3' UMI, N means A, G, C or T, random sequence)

The nucleotide sequence of the 5' linker is as follows:

SEQ ID NO：2：

rGrArCrArGrArCrArArArUrCrArCrGrArArArNrNrArArArNrNrArArArNrN(5’→3’)

(underlined is the specific molecular tag 5' UMI, rN A, C, G or U, random sequence).

In the invention, two ends of a3 'joint are modified and improved, a random sequence is arranged at the same time, and 3' UMI is introduced into one end; one end of the 5 'linker was redesigned, introducing 5' UMI with random sequence meaning. The 5' linker sequence was divided into two parts, the 5' end was designed as the optimal sequence combination by the simulation calculation, and the 3' end was designed as the UMI sequence NNAAANNAAANN with a spacer sequence, which was designed to avoid non-specific binding during reverse transcription due to consecutive 6N. The optimized 5 'joint and 3' joint improves the connection efficiency and accuracy, and reduces the influence caused by the preference of the joints in the connection process.

In the above method, the process of preparing the single cell suspension further comprises the steps of staining and counting the cells.

In the above method, the cells are added to the plurality of microwells of the single cell manipulation system chip, and each microwell is photographed to select a microwell of a single living cell.

In the above method, preferably, the cell lysis reaction is performed by adding a cell lysate to the selected microwells, and then transferring the chip to a PCR instrument for incubation and heating reaction.

In the above method, preferably, the components of the cell lysate include Triton x-100 lysate and an RNase inhibitor.

In the above method, it is further preferred that the composition of the cell lysate comprises 0.5% Triton x-100 lysate and 0.14u RNase inhibitor per 35nl of cell lysate.

In the above method, preferably, the incubation temperature for cell lysis is 25 ℃ and the incubation time is 5 min; the heating reaction temperature is 75 ℃, and the heating time is 5 min.

In the above method, there are few intracellular free small RNA molecules, and heating is required to release small RNA from the protein complex (RISC). The inventor researches and discovers that when cell lysis is carried out, the heating reaction temperature is set to be 75 ℃ for 5min, under the condition, miRNA can be released from an RNA-induced silencing complex (RISC) in an assisting mode, and the product yield of miRNA is improved. The invention optimizes the cell lysis solution and the cell lysis reaction conditions, can realize that RNA does not need to be purified after cell lysis, and does not influence the subsequent experiment.

In the above method, preferably, the 3' end ligation reaction is performed by adding the 3' end ligation reaction solution to the selected microwells and performing the 3' end ligation reaction procedure.

In the above method, the 3 '-end ligation reaction solution preferably comprises a 3' -linker, T4RNA ligase 2 (truncated KQ), a T4RNA ligation buffer, and a ribonuclease inhibitor.

In the above method, it is further preferred that the 3' -end ligation reaction solution comprises 0.07pmol of 3' -linker, 2.1u of T4RNA ligase 2 (truncated KQ), 0.9X of T4RNA ligation buffer, and 0.05u of ribonuclease inhibitor ("x" represents the dilution factor based on the original commercial concentration) (3 ' -end ligation reaction solution per 35 nl).

In the method, preferably, the 3' end connection reaction process comprises incubation at 25 ℃ for 6h, then reaction at 4 ℃ for 8-10 h, and finally heating at 65 ℃ for 20 min.

In the above method, preferably, before the reaction for removing the free linker is performed, the reverse transcription mixture is added to the selected microwell, and then the chip is moved to a PCR instrument for a heating reaction.

Preferably, the components of the reverse transcription mixture comprise tagged reverse transcription primer and Lambda exonuclease reaction buffer.

In the above method, it is further preferred that the reverse transcription mixture comprises 0.7pmol of tagged reverse transcription primer and 0.5X Lambda exonuclease reaction buffer (per 35nl of reverse transcription mixture).

The sequence of the tagged reverse transcription primer comprises the sequence set forth in SEQ ID NO: 3 to SEQ ID NO: 74, respectively.

In the above method, the nucleotide sequence of the tagged reverse transcription primer is specifically as follows: (5 '→ 3')

CTTGGCACCCGAGAATTCCAGATCGCNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：3)

CTTGGCACCCGAGAATTCCAGCAGGANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：4)

CTTGGCACCCGAGAATTCCAGTCACTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：5)

CTTGGCACCCGAGAATTCCATCCTGTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：6)

CTTGGCACCCGAGAATTCCATTGAGGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：7)

CTTGGCACCCGAGAATTCCAAACCACNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：8)

CTTGGCACCCGAGAATTCCAACTAGTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：9)

CTTGGCACCCGAGAATTCCAAATGGANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：10)

CTTGGCACCCGAGAATTCCAACTTCGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：11)

CTTGGCACCCGAGAATTCCAAGCGTTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：12)

CTTGGCACCCGAGAATTCCAATACCANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：13)

CTTGGCACCCGAGAATTCCACAGTTCNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：14)

CTTGGCACCCGAGAATTCCACGAAGTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：15)

CTTGGCACCCGAGAATTCCACGTGAGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：16)

CTTGGCACCCGAGAATTCCACTCCTGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：17)

CTTGGCACCCGAGAATTCCAGAACTTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：18)

CTTGGCACCCGAGAATTCCAGACTGGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：19)

CTTGGCACCCGAGAATTCCAGCATACNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：20)

CTTGGCACCCGAGAATTCCATCAATGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：21)

CTTGGCACCCGAGAATTCCATGAGCCNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：22)

CTTGGCACCCGAGAATTCCATGGCATNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：23)

CTTGGCACCCGAGAATTCCAAATCTGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：24)

CTTGGCACCCGAGAATTCCAAAGACTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：25)

CTTGGCACCCGAGAATTCCAAGCTGANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：26)

CTTGGCACCCGAGAATTCCAATAGACNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：27)

CTTGGCACCCGAGAATTCCACCACATNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：28)

CTTGGCACCCGAGAATTCCACGAGTANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：29)

CTTGGCACCCGAGAATTCCACTAACGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：30)

CTTGGCACCCGAGAATTCCACTCGGTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：31)

CTTGGCACCCGAGAATTCCAGAGAACNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：32)

CTTGGCACCCGAGAATTCCAGTGCGANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：33)

CTTGGCACCCGAGAATTCCATACGCANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：34)

CTTGGCACCCGAGAATTCCATCGTAGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：35)

CTTGGCACCCGAGAATTCCAGAGTCANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：36)

CTTGGCACCCGAGAATTCCATGTTCTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：37)

CTTGGCACCCGAGAATTCCAAGGATGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：38)

CTTGGCACCCGAGAATTCCAATCAGCNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：39)

CTTGGCACCCGAGAATTCCACCGTCTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：40)

CTTGGCACCCGAGAATTCCACTTCACNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：41)

CTTGGCACCCGAGAATTCCAGAAGAGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：42)

CTTGGCACCCGAGAATTCCAGGAACANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：43)

CTTGGCACCCGAGAATTCCAGGCTTCNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：44)

CTTGGCACCCGAGAATTCCAGGTGGTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：45)

CTTGGCACCCGAGAATTCCATCACGCNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：46)

CTTGGCACCCGAGAATTCCAACTCACNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：47)

CTTGGCACCCGAGAATTCCAAGAGATNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：48)

CTTGGCACCCGAGAATTCCAAGGACANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：49)

CTTGGCACCCGAGAATTCCAATCCGTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：50)

CTTGGCACCCGAGAATTCCAATGTTGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：51)

CTTGGCACCCGAGAATTCCACACGACNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：52)

CTTGGCACCCGAGAATTCCACAGATTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：53)

CTTGGCACCCGAGAATTCCAGATGTANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：54)

CTTGGCACCCGAGAATTCCAGCACCTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：55)

CTTGGCACCCGAGAATTCCAGCCATGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：56)

CTTGGCACCCGAGAATTCCAGGCTAANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：57)

CTTGGCACCCGAGAATTCCATAGCGANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：58)

CTTGGCACCCGAGAATTCCATCATTCNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：59)

CTTGGCACCCGAGAATTCCATTGGCTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：60)

CTTGGCACCCGAGAATTCCAAAGGAGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：61)

CTTGGCACCCGAGAATTCCAACCTTANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：62)

CTTGGCACCCGAGAATTCCACATCCTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：63)

CTTGGCACCCGAGAATTCCACGACAANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：64)

CTTGGCACCCGAGAATTCCACTAATCNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：65)

CTTGGCACCCGAGAATTCCACTCTATNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：66)

CTTGGCACCCGAGAATTCCAGACACANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：67)

CTTGGCACCCGAGAATTCCAGGATTGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：68)

CTTGGCACCCGAGAATTCCATAAGGTNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：69)

CTTGGCACCCGAGAATTCCAAACAGGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：70)

CTTGGCACCCGAGAATTCCAACAGTGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：71)

CTTGGCACCCGAGAATTCCAAGTTAGNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：72)

CTTGGCACCCGAGAATTCCAATGAATNNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：73)

CTTGGCACCCGAGAATTCCACCAAGANNNNNNGATTGATGGTGCCTACAG(SEQ ID NO：74)

(wherein the drawn line part is a label and is 3' barcode)

In the above method, the heating reaction is preferably carried out at a temperature of 70 ℃ for a reaction time of 2 min.

In the above method, preferably, the step of performing the reaction of removing free linkers is to add the reaction solution of removing linkers to the selected microwells, then move the chip to the PCR instrument, and perform the reaction procedure of removing linkers.

In the above method, it is preferable that the linker reaction solution is removed from the reaction mixture by a method comprising Lambda exonuclease, 5' adenylate transferase and ribonuclease inhibitor.

In the above method, it is further preferred that the linker reaction solution is removed from the mixture by a method comprising 0.087u of Lambda exonuclease, 0.23u of 5' adenylate oxidase and 0.05u of ribonuclease inhibitor per 35nl of the linker reaction solution.

In the above method, preferably, the decapping reaction is performed by incubating at 30 ℃ for 30min, then at 37 ℃ for 60min, and finally at 75 ℃ for 10 min.

In the above method, preferably, the 5' end ligation reaction is performed by adding the 5' end ligation reaction solution to the selected microwell, and then transferring the chip to a PCR instrument to perform the 5' end ligation reaction procedure.

In the above method, the 5 '-end ligation reaction solution preferably comprises a 5' -linker, T4RNA ligase 1 (at a high concentration), a T4RNA ligation buffer, and a ribonuclease inhibitor.

In the above method, it is further preferable that the 5' -end ligation reaction solution comprises 0.07pmol of 5' -linker, 0.315u of T4RNA ligase 1 (high concentration), 0.9X of T4RNA ligation buffer, and 0.05u of ribonuclease inhibitor (5 ' -end ligation reaction solution per 35 nl).

In the above method, preferably, the 5' end ligation reaction is performed by incubating at 37 ℃ for 1h and then heating at 65 ℃ for 20 min.

In the above method, preferably, the reverse transcription reaction is performed by adding the reverse transcription reaction solution to the selected microwell, and then transferring the chip to a PCR instrument to perform the reverse transcription reaction procedure.

In the above method, preferably, the reverse transcription reaction solution comprises a strand synthesis buffer, DTT, dNTP, a RNase inhibitor and Superscript III reverse transcriptase.

In the above method, it is further preferred that the reverse transcription reaction solution comprises 0.75 Xsingle strand synthesis buffer, 7mM DTT, 0.2mM dNTP, 0.074u RNase inhibitor and 1.1u Superscript III reverse transcriptase (per 35nl of reverse transcription reaction solution).

In the above method, preferably, the reverse transcription reaction is carried out at 55 ℃ for 50min and then at 70 ℃ for 15 min.

In the reverse transcription process, Superscript III reverse transcriptase is adopted and reacts at the enzyme binding temperature of 55 ℃, the temperature is increased by 42 ℃ compared with the conventional reaction temperature, the production of specific binding products is reduced, and the initial concentration of miRNA can be accurately reflected.

In the above method, preferably, the first PCR reaction is performed by adding the PCR-1 reaction solution to the selected microwell, then transferring the chip to a PCR instrument, and performing the PCR-1 reaction procedure; collecting reaction liquid, purifying the PCR-1 product by using magnetic beads, and then screening and recovering fragments of the PCR-1 product.

In the above method, the PCR-1 reaction solution preferably includes a labeled PCR-1 primer, dNTPs, a PCR buffer and a DNA polymerase.

In the above method, it is further preferred that the PCR-1 reaction solution comprises 1uM of the labeled PCR-1 primer, 0.1mM of dNTP, 0.4 Xof PCR buffer and 0.007u of DNA polymerase (per 35nl of PCR-1 reaction solution).

In the above method, preferably, the sequence of the tagged PCR-1 primer comprises the sequence as set forth in SEQ ID NO: 75 to SEQ ID NO: 146.

In the above method, the nucleotide sequence of the tagged PCR-1 primer is specifically as follows: (5 '→ 3')

GTTCAGAGTTCTACAGTCCGACGATCAACCAAGACAGACAAATCACGAAA(SEQ ID NO：75)

GTTCAGAGTTCTACAGTCCGACGATCCGATAGGACAGACAAATCACGAAA(SEQ ID NO：76)

GTTCAGAGTTCTACAGTCCGACGATCAGAAGAGACAGACAAATCACGAAA

(SEQ ID NO：77)

GTTCAGAGTTCTACAGTCCGACGATCGAGCCTGACAGACAAATCACGAAA(SEQ ID NO：78)

GTTCAGAGTTCTACAGTCCGACGATCTAGTCAGACAGACAAATCACGAAA(SEQ ID NO：79)

GTTCAGAGTTCTACAGTCCGACGATCACTGCAGACAGACAAATCACGAAA(SEQ ID NO：80)

GTTCAGAGTTCTACAGTCCGACGATCCAGCATGACAGACAAATCACGAAA(SEQ ID NO：81)

GTTCAGAGTTCTACAGTCCGACGATCCCGCCTGACAGACAAATCACGAAA(SEQ ID NO：82)

GTTCAGAGTTCTACAGTCCGACGATCCCTAGCGACAGACAAATCACGAAA(SEQ ID NO：83)

GTTCAGAGTTCTACAGTCCGACGATCCGCAACGACAGACAAATCACGAAA(SEQ ID NO：84)

GTTCAGAGTTCTACAGTCCGACGATCTGGCCTGACAGACAAATCACGAAA(SEQ ID NO：85)

GTTCAGAGTTCTACAGTCCGACGATCGCGGTTGACAGACAAATCACGAAA(SEQ ID NO：86)

GTTCAGAGTTCTACAGTCCGACGATCAGTCAAGACAGACAAATCACGAAA(SEQ ID NO：87)

GTTCAGAGTTCTACAGTCCGACGATCAGTTCCGACAGACAAATCACGAAA(SEQ ID NO：88)

GTTCAGAGTTCTACAGTCCGACGATCATGTCAGACAGACAAATCACGAAA(SEQ ID NO：89)

GTTCAGAGTTCTACAGTCCGACGATCCCGTCCGACAGACAAATCACGAAA(SEQ ID NO：90)

GTTCAGAGTTCTACAGTCCGACGATCGTAGAGGACAGACAAATCACGAAA(SEQ ID NO：91)

GTTCAGAGTTCTACAGTCCGACGATCGTCCGCGACAGACAAATCACGAAA(SEQ ID NO：92)

(SEQ ID NO：93)

(SEQ ID NO：94)

(SEQ ID NO：95)

(SEQ ID NO：96)

(SEQ ID NO：97)

(SEQ ID NO：98)

(SEQ ID NO：99)

(SEQ ID NO：100)

(SEQ ID NO：101)

(SEQ ID NO：102)

(SEQ ID NO：103)

(SEQ ID NO：104)

(SEQ ID NO：105)

(SEQ ID NO：106)

(SEQ ID NO：107)

(SEQ ID NO：108)

(SEQ ID NO：109)

(SEQ ID NO：110)

(SEQ ID NO：111)

(SEQ ID NO：112)

(SEQ ID NO：113)

(SEQ ID NO：114)

(SEQ ID NO：115)

(SEQ ID NO：116)

(SEQ ID NO：117)

(SEQ ID NO：118)

(SEQ ID NO：119)

(SEQ ID NO：120)

(SEQ ID NO：121)

(SEQ ID NO：122)

(SEQ ID NO：123)

(SEQ ID NO：124)

(SEQ ID NO：125)

(SEQ ID NO：126)

(SEQ ID NO：127)

(SEQ ID NO：128)

(SEQ ID NO：129)

(SEQ ID NO：130)

(SEQ ID NO：131)

(SEQ ID NO：132)

(SEQ ID NO：133)

(SEQ ID NO：134)

(SEQ IDNO：135)

(SEQ ID NO：136)

(SEQ ID NO：137)

(SEQ ID NO：138)

(SEQ ID NO：139)

(SEQ ID NO：140)

(SEQ ID NO：141)

(SEQ ID NO：142)

(SEQ ID NO：143)

(SEQ ID NO：144)

(SEQ ID NO：145)

(SEQ ID NO：146)

(wherein the scribed portion is a label, noted 5' barcode;

the part of (a) is a 0 to 3 base fragment inserted into a primer tag

In the PCR-1 primer sequence, the cell label is added in the primer, and 0-3 bases are inserted in the design, so that the parts with the same sequence in the sequencing process sequentially move backwards and are staggered with each other, the sequencing efficiency of a sequencer can be higher, and the problem of signal interference in the subsequent library sequencing process is solved.

In the method, the PCR-1 reaction process is preferably carried out by reacting at 95 ℃ for 3min, then reacting at 95 ℃ for 20s in 12-14 cycles, then reacting at 65 ℃ for 20s, then reacting at 72 ℃ for 20s, and finally reacting at 72 ℃ for 5 min.

In the above method, PCR-1 products are preferably purified using Ampure XP magnetic beads (preferably 1.7X) and the product fragment size distribution is detected with an Agilent2100 bioanalyzer followed by quantification with the Qubit dsDNA HS detection kit.

In the above method, the second PCR is preferably performed by preparing a PCR-2 reaction solution using the recovered PCR-1 product as a template and performing a PCR-2 reaction procedure.

In the above method, preferably, the PCR-2 reaction solution comprises the primer SCSR-PCR-1, the primer SCSR-PCR-2, dNTP, PCR buffer and DNA polymerase.

In the above method, it is further preferred that the PCR-2 reaction solution comprises 0.35uM of the SCSR-PCR-1 primer, 0.35uM of the SCSR-PCR-2 primer, 0.35uM of the dNTP, 1 XPCR buffer and 0.02u of the DNA polymerase (per 35. mu.l of the PCR-2 reaction solution).

In the above method, preferably, the sequence of the SCSR-PCR-1 primer is as shown in SEQ ID NO: 147, the sequence of the SCSR-PCR-2 primer includes the sequence shown in SEQ ID NO: 148 to SEQ ID NO: 159, respectively.

The sequence of the SCSR-PCR-1 primer is as follows: (5 '→ 3')

AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGA(SEQ ID NO：147)

The sequence of the SCSR-PCR-2 primer is as follows: (5 '→ 3')

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：148)

CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：149)

CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：150)

CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：151)

CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：152)

CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：153)

CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：154)

CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：155)

CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：156)

CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：157)

CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：158)

CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO：159)

In the method, the PCR-1 reaction process is preferably carried out by reacting at 95 ℃ for 3min, then reacting at 95 ℃ for 20s in 7-13 cycles, then reacting at 67 ℃ for 20s, then reacting at 72 ℃ for 20s, and finally reacting at 72 ℃ for 5 min.

In the above method, preferably, Ampure XP magnetic beads (1.5X) are used to purify PCR-2 products, and PiplinPrep (185-220 nt) is used to screen product fragments; the content of the library was determined with a Qubit high sensitivity kit, its size distribution was determined with an Agilent2100 bioanalyzer, and its quality was determined with a library quantification kit.

In the method, through two-step PCR reaction, the purification and fragment screening steps are added in the middle, so that the reaction efficiency is higher, and the proportion of non-specific products is effectively reduced.

In the above method, preferably, the single-cell operating system is ICELL 8.

In the method, cells, cell lysate, 3 'end ligation reaction liquid, reverse transcription primers with labels, linker removal reaction liquid, 5' end ligation reaction liquid, reverse transcription reaction liquid and PCR-1 reaction liquid are all added into selected micropores through a liquid separation device MSND in an ICELL8 single cell operation system.

In the method, a liquid separation device MSND in an ICELL8 single-cell operation system is adopted, the MSND utilizes a micropore injection technology and can inject 35nl of 3' end connecting reaction liquid to realize nano-upgrading reaction.

In the above method, preferably, the cells include a549 cells, human peripheral blood mononuclear cells, or mouse B16F10 cells, but are not limited thereto. The method can analyze the miRNA spectra of different types of single cells, achieves good effect, and shows that the method has no cell type specificity.

On the other hand, the invention also provides a high-throughput single-cell small RNA library constructed by the method.

The invention has the beneficial effects that:

(1) the invention develops a parallel single-cell small RNA sequencing technology (PSCSR-seq) by utilizing an ICELL8 single-cell operating system, and effectively constructs and obtains a high-throughput single-cell small RNA library by utilizing the technology of the invention.

(2) According to the invention, the joint and the primer adopted in the library construction process are modified and improved, a random sequence and a label are added, the connection efficiency and accuracy are improved, the influence caused by the preference of the joint and the primer in the connection and amplification processes is reduced, the cell label is added into the primer, 0-3 bases are inserted in the design process, and the problem of signal interference in the subsequent library sequencing process is reduced.

(3) In the process of constructing the library, an experimental system is optimized, for example: optimization aiming at cell lysate, optimization aiming at reverse transcription reaction solution and the like; experimental conditions were optimized, for example: MSND micropore injection reaction system, optimization of reaction temperature in the cracking process and the like are adopted; the ligation efficiency and the reverse transcription efficiency are improved, so that the library building efficiency is obviously improved, non-target fragments are reduced by effectively removing residual linkers, screening fragments and the like, and the cost of subsequent library sequencing is saved.

(4) The method for constructing the library has wide application range, no cell type specificity, good effect on culturing cells, blood and even tissue samples and low biological risk.

Drawings

FIG. 1 is a flow chart of the construction method of the high-throughput single-cell small RNA library of the present invention;

FIG. 2 is a graph showing a comparison of the amount of ligation reaction solution used in comparative example 1 of the present invention with respect to the yield of a small RNA library;

FIG. 3 is a graph showing a comparison of the different conditions of the cell lysis reaction in comparative example 2 of the present invention with the yield of a small RNA library;

FIG. 4 is a graph comparing the connection efficiency of the method for building a library according to the present invention with that of the conventional method for building a library according to comparative example 3;

FIG. 5 is a comparison of small RNA libraries using the present banking method with the prior art banking method of comparative example 4.

Detailed Description

The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention is not limited to the practical scope of the present invention.

The chemicals used in the following examples are commercially available unless otherwise specified. The process conditions not specified in the examples were carried out according to the conventional techniques in the art or as suggested in the specification. The following table 1 shows the names of the main reagents according to the present invention in Chinese and English, and the manufacturers and specifications thereof.

TABLE 1

Example 1 high throughput Single cell Small RNA library construction of A549 cells (scheme shown in FIG. 1)

(1) Preparation of A549 cells

10% (v/v) fetal bovine serum and 1% penicillin-streptomycin were added to DMEM/F-12 minimal medium as an A549 cell line culture environment. The A549 cell line was cultured in a humidified incubator at an ambient temperature of 37 ℃ and a carbon dioxide content of 5%. For the experiments, fresh cells were taken, washed twice with 1X phosphate buffered saline (DPBS), after which the cells were suspended in 1X DPBS containing 0.04% bovine serum albumin. The cell suspension was stained with 4', 6-diamidino-2-phenylindole (DIPA) to mark dead cells. Sorting and enriching the living cells by a BD FACSAria III flow cytometer to obtain cell suspension.

(2) Staining and counting the cells to prepare a single cell suspension

The Cell suspension was stained with Hoechst-33342 and propidium iodide, left on ice for 20min with the Ready probes Cell Viabilityimaging Kit, centrifuged 300x g for 5min, and the cells resuspended in 1ml of 1 XPPBS containing 0.04% BSA. After cell counting, the cell suspension was supplemented with 1 Xsecond Diluent and 0.4u ("u" means unit of enzyme activity) Recombinant

The mixture of Ribonucleae Inhibitor was diluted to a concentration of 1 cell/35 nl.

(3) Using ICELL8 single cell manipulation system, the cell suspension was dispensed into 5184 wells of a SMARTERICELL 8350 v chip. The microwells of all ICELL8 chips were imaged with a fluorescence microscope (olympus bx43) and the images were analyzed using CellSelect software (Takara) to determine viable cells and cell numbers.

(4) After single cell sorting, a mixture containing 0.5% triton x-100(T9284, Sigma-Aldrich) and 0.14u Ribonuclease Inhibitor was added to selected microwells for cell lysis reaction, and the chips were transferred to a PCR instrument (Bio-Rad), incubated at 25 ℃ for 5 minutes, heated at 75 ℃ for 5 minutes, and immediately placed on ice.

(5) A mixture containing 0.07pmol of 3 '-linker (RA3-A2N) (the nucleotide sequence of which is shown in SEQ ID NO: 1), 2.1u T4RNA Ligase 2, truncated KQ, 0.9x T4RNA Ligase buffer and 0.05u Ribonucleus inhibitor was prepared, and the mixture was added to selected microwells to perform 3' -terminal ligation. The microchip was incubated at 25 ℃ for 6 hours, reacted at 4 ℃ for 8-10 hours, and then heated at 65 ℃ for 20 minutes.

(6) After 3' linker ligation, a reverse transcriptase mixture (0.7pmol of tagged reverse transcription primer [ SCSR-RTP ] (nucleotide sequence shown in SEQ ID NO: 3 to SEQ ID NO: 74), 0.5X Lambda Exonuclease buffer) was added to the A5-P8, A9-D9, A10-D10 wells of the 384-well plate. The "index 1" program was executed to dispense 35nl of tagged reverse transcription primer into selected microwells. The chip was placed on a PCR apparatus and heated at 70 ℃ for 2 minutes, and then allowed to stand on ice.

(7) Linker removal reaction solutions (0.087u Lambda Exonuclease, 0.23u 5' Deadenylase, 0.05u Ribonucleae Inhibitor) were prepared and distributed to selected microwells for the linker removal reaction procedure. The chip was centrifuged and placed in a PCR instrument and incubated at 30 ℃ for 30 minutes, 37 ℃ for 60 minutes and then heated at 75 ℃ for 10 minutes.

(8) 0.7pmol of 5' linker (SR5F) (nucleotide sequence shown in SEQ ID NO: 2) and 1mM ATP were incubated at 70 ℃ for 2 minutes, then added to a 5' ligation mixture (0.315u T4RNA Ligase 1(ssRNA Ligase), HighConnection, 0.9x T4RNA Ligase buffer, 0.05u Ribonucleae Inhibitor), dispensed into selected microwells for a 5' ligation reaction procedure, ligated at 37 ℃ for 1 hour, and heated at 65 ℃ for 20 minutes.

(9) Carrying out reverse transcription: the reverse transcription reaction solution was composed of 0.75 Xfirst-strand buffer, 7mM DTT, 0.2mM dNTP, 0.074u Ribonucleae Inhibitor, and 1.1u Superscript III reverse transcriptase, and was added to the well and reacted at 55 ℃ for 50 minutes, and heated at 70 ℃ for 15 minutes.

(10) Performing PCR-1 reaction: 1um tagged PCR-1 primer (SR5F-P1) (with the nucleotide sequence shown in SEQ ID NO: 75-SEQ ID NO: 146) was mixed with 0.1mM dNTP, 0.4X PCR buffer, 0.007u Phanta HSsuper-Fidelity DNA Polymerase, added to a 384 well plate (positions A13-P16, A17-D17, A18-D18), and the 35n1PCR-1 mixture was injected into the wells via the "index-2" program. The chip was placed on a PCR apparatus and reacted at 95 ℃ for 3 minutes, then 12 to 14 cycles of 95 ℃ for 20 seconds, 65 ℃ for 20 seconds, 72 ℃ for 20 seconds, and finally 72 ℃ for 5 minutes. After the reaction the chip was inverted and centrifuged at 3000Xg for 10min and the product collected in a centrifuge tube.

The collected PCR-1 product was purified and recovered with 1.7X Ampure XP magnetic beads. The product fragment size distribution was detected with an Agilent2100 bioanalyzer and quantified with the Qubit dsDNA HS detection kit. The product was recovered by fragment selection using the Pippin Prep, with a recovery range of 105 nt and 160 nt.

(11) Performing PCR-2 reaction: the recovered DNA was used as a template for PCR-2 reaction. The reaction system is as follows: 0.35mM dNTP, 1x PCR buffer, 0.02u Phanta Max Super-Fidelity DNA Polymerase, 0.35uMSCSR-PCR-1 primer (the nucleotide sequence is shown as SEQ ID NO: 147), 0.35uM SCSR-PCR-2 primer (the nucleotide sequence is shown as SEQ ID NO: 148-SEQ ID NO: 159), and the reaction conditions are as follows: the reaction was carried out at 95 ℃ for 3 minutes, followed by 12 cycles of 95 ℃ for 20 seconds, 67 ℃ for 20 seconds, 72 ℃ for 20 seconds, and finally at 72 ℃ for 5 minutes.

The PCR-2 product was recovered by purification with 1.5X Ampure XP magnetic beads and the size of the product was screened with 185-220nt Pippin Prep to construct a single-cell small RNA library that could be used directly for on-machine sequencing.

(12) Library sequencing: the content of PSCSR-seq library was measured with a Qubit high sensitivity kit, its size distribution was measured with an Agilent2100 bioanalyzer, and its quality was measured with a library quantification kit. Samples were sequenced using Illumina HiSeq2500 and HiSeq X Ten instruments.

Example 2 high throughput Single cell Small RNA library construction of human Peripheral Blood Mononuclear Cells (PBMCs)

(1) Preparation of human peripheral blood mononuclear cells

Venous blood from healthy donors was collected into collection tubes containing heparin sodium anticoagulant and Peripheral Blood Mononuclear Cells (PBMCs) were isolated by Ficoll density gradient centrifugation. Heparinized blood was solubilized with an equal volume of 1 × DPBS and added to a SepMateTM-15 separation tube containing an equal volume of HISTOPAQUE-1077. After centrifugation of the separation tube at 1200Xg for 10 minutes, PBMCs were quickly poured into a new 50ml tube and washed twice with 1 xPBS, and the cells were suspended in 1 xPBS. Cells were stained with CD45, CD3, CD19+, CD20, CD56+, CD14+ and sorted for enrichment using BD FACSAriaIII flow cytometer.

The construction of a high-throughput small single-cell RNA library from human peripheral blood mononuclear cells was performed in the same manner as in example 1.

Example 3 high throughput Single cell Small RNA library construction of mouse B16F10 cells

(1) Culture and tumor implantation of mouse B16F10 cells

10% (v/v) fetal bovine serum and 1% penicillin-streptomycin were added to DMEM minimal medium as a culture environment for melanoma cell line B16F 10. The B16F10 cells were cultured in a humidified incubator with an ambient temperature of 37 ℃ and a carbon dioxide content of 5%.

5C 57bl/6 female mice, 8-10 weeks old, were free to eat and drink under Specific Pathogen Free (SPF) conditions. Mice were placed in IVC cages with 12 hours light-dark cycle and fed with laboratory feed sterilized with Co60 radiation. On the day of the implantation experiment, cells were harvested after 4 hours of culture in fresh medium and suspended in cold 1 xPBS to a final concentration of 3x10⁵cell/ml. Experimental lung metastases were generated by injecting 100ul of cell suspension into the tail vein of each animal. Animals were euthanized with carbon dioxide starting on day 12 after cell inoculation and lung metastatic tissue was collected. The metastases from one mouse were pooled with the surrounding lung tissue and cut into 2-4 mm pieces. These fragments were separated into single cell suspensions using a tumor isolation kit. The cell suspension is dissolved by using an ACK dissolving solution, dead cells are removed by using a dead cell removal kit, and then the cell suspension is filtered by using a 40ul filter screen. The cell suspension was stained with DAPI and sorted for enrichment using a BD FACSAriaIII flow cytometer.

The construction of a high-throughput single-cell small RNA library from mouse B16F10 cells was performed in the same manner as in example 1.

Comparative example 1:

the results of comparison of the amounts of the 3' -end ligation reaction solutions (reaction volume decreased from 10. mu.l to 1nl) are shown in FIG. 2:

in fig. 2, (a) to (c) are before optimization, and (d) to (f) are after optimization.

(a) Before and after optimization, 1pg of synthesized miRNA is used as a database building sample;

(b) and (e) before and after optimization, using 100pg Universal Human miRNA Reference RNA standard (total RNA) as a library establishing sample;

(c) and (f) before and after optimization, 100A 549 cells were used as the sample for banking.

As can be seen from fig. 2: under the same reaction solution concentration condition, the reaction system is reduced (from 10 mu l to 1nl) so as to obviously increase the efficiency of the ligation reaction, further improve the library building efficiency and increase the yield of the library.

Comparative example 2:

in the course of cell lysis reaction, comparison of reaction temperature and time was carried out for 8 experiments. Wherein:

(a) at 25 ℃ for 10 min; (b) at 37 ℃ for 10 min; (c)75 ℃ for 10 min; (d) 10min at 80 ℃; (e) at 85 ℃ for 10 min; (f) at 95 ℃ for 10 min; (g) 5min at 70 ℃; (h)75 ℃ for 5min (example 1). The results of the experiment are shown in FIG. 3.

As can be seen from fig. 3: the results of graphs (a) to (f) in FIG. 3 illustrate that the variation of reaction temperature can lead to different small RNA library products within the same treatment time, with the highest yield at 75-80 ℃; FIGS. 3 (g) to (h) illustrate that shortening the reaction time to 5min did not affect the small RNA release yield. Finally, it is concluded that 5min of reaction at 75 ℃ is the optimal reaction condition.

Comparative example 3:

comparative experiments were carried out using the single cell small RNA banking procedure and the banking method of the present invention, published in 2016 Nature biotechnology, Faridani et al, and the results are shown in FIG. 4. The experimental results figures show, from left to right, comparative example, example 1, example 2 (two parallel experiments), example 3.

The indexes for embodying the connection efficiency are as follows: the ratio of sequences with valid linker information in the sequencing data obtained. As can be seen from fig. 4: the method of the comparative example had less than 1% of the total sequencing data; in the experimental result of the invention, the effective data information accounts for more than 70%.

Comparative example 4:

a comparative experiment is carried out on the single-cell smallRNA banking process and the banking method in the embodiment 1 of the invention in the nature protocol journal of 2018 by Faridani et al, and the experimental result is shown in FIG. 5. FIGS. 5 (a) to (c) are the small RNA library, blank control and fragment recovery product of the comparative example in this order, and it can be seen that the small RNA library is almost identical to the blank control, indicating that the highest peak in the graph is a non-target fragment; in the figure, (d) to (f) are the small RNA library, blank control and fragment recovery products of example 1 of the present invention, and it can be seen that: FIG. 5 (a) shows the non-target fragment (linker dimer) in the experimental results of the comparative example, while in FIG. 5 (d) shows the small RNA library products in this example are evident, and equal to the primer dimer peak height; after recovery by fragments, in FIG. 5 (c), the products recovered by the comparative example are all non-target fragments, and the small RNA library is hardly visible, while in FIG. 5 (f), the experimental example can efficiently isolate a single small RNA library product.

Sequence listing

<110> Beijing institute of Life sciences

<120> construction method of high-throughput single-cell small RNA library

<130>GAI19CN2678

<160>159

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(1)..(1)

<223>n=rApp

<220>

<221>misc_feature

<222>(2)..(3)

<223> n = a or g or c or t

<220>

<221>misc_feature

<222>(21)..(21)

<223>n=ddC

<400>1

nnnctgtagg caccatcaat n 21

<210>2

<211>30

<212>RNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(19)..(20)

<223> n = a or g or c or u

<220>

<221>misc_feature

<222>(24)..(25)

<223> n = a or g or c or u

<220>

<221>misc_feature

<222>(29)..(30)

<223> n = a or g or c or u

<400>2

gacagacaaa ucacgaaann aaannaaann 30

<210>3

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>3

cttggcaccc gagaattcca gatcgcnnnn nngattgatg gtgcctacag 50

<210>4

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>4

cttggcaccc gagaattcca gcaggannnn nngattgatg gtgcctacag 50

<210>5

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>5

cttggcaccc gagaattcca gtcactnnnn nngattgatg gtgcctacag 50

<210>6

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>6

cttggcaccc gagaattcca tcctgtnnnn nngattgatg gtgcctacag 50

<210>7

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>7

cttggcaccc gagaattcca ttgaggnnnn nngattgatg gtgcctacag 50

<210>8

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>8

cttggcaccc gagaattcca aaccacnnnn nngattgatg gtgcctacag 50

<210>9

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>9

cttggcaccc gagaattcca actagtnnnn nngattgatg gtgcctacag 50

<210>10

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>10

cttggcaccc gagaattcca aatggannnn nngattgatg gtgcctacag 50

<210>11

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>11

cttggcaccc gagaattcca acttcgnnnn nngattgatg gtgcctacag 50

<210>12

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>12

cttggcaccc gagaattcca agcgttnnnn nngattgatg gtgcctacag 50

<210>13

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>13

cttggcaccc gagaattcca ataccannnn nngattgatg gtgcctacag 50

<210>14

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>14

cttggcaccc gagaattcca cagttcnnnn nngattgatg gtgcctacag 50

<210>15

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>15

cttggcaccc gagaattcca cgaagtnnnn nngattgatg gtgcctacag 50

<210>16

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>16

cttggcaccc gagaattcca cgtgagnnnn nngattgatg gtgcctacag 50

<210>17

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>17

cttggcaccc gagaattcca ctcctgnnnn nngattgatg gtgcctacag 50

<210>18

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>18

cttggcaccc gagaattcca gaacttnnnn nngattgatg gtgcctacag 50

<210>19

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>19

cttggcaccc gagaattcca gactggnnnn nngattgatg gtgcctacag 50

<210>20

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>20

cttggcaccc gagaattcca gcatacnnnn nngattgatg gtgcctacag 50

<210>21

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>21

cttggcaccc gagaattcca tcaatgnnnn nngattgatg gtgcctacag 50

<210>22

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>22

cttggcaccc gagaattcca tgagccnnnn nngattgatg gtgcctacag 50

<210>23

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>23

cttggcaccc gagaattcca tggcatnnnn nngattgatg gtgcctacag 50

<210>24

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>24

cttggcaccc gagaattcca aatctgnnnn nngattgatg gtgcctacag 50

<210>25

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>25

cttggcaccc gagaattcca aagactnnnn nngattgatg gtgcctacag 50

<210>26

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>26

cttggcaccc gagaattcca agctgannnn nngattgatg gtgcctacag 50

<210>27

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>27

cttggcaccc gagaattcca atagacnnnn nngattgatg gtgcctacag 50

<210>28

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>28

cttggcaccc gagaattcca ccacatnnnn nngattgatg gtgcctacag 50

<210>29

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>29

cttggcaccc gagaattcca cgagtannnn nngattgatg gtgcctacag 50

<210>30

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>30

cttggcaccc gagaattcca ctaacgnnnn nngattgatg gtgcctacag 50

<210>31

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>31

cttggcaccc gagaattcca ctcggtnnnn nngattgatg gtgcctacag 50

<210>32

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>32

cttggcaccc gagaattcca gagaacnnnn nngattgatg gtgcctacag 50

<210>33

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>33

cttggcaccc gagaattcca gtgcgannnn nngattgatg gtgcctacag 50

<210>34

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>34

cttggcaccc gagaattcca tacgcannnn nngattgatg gtgcctacag 50

<210>35

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>35

cttggcaccc gagaattcca tcgtagnnnn nngattgatg gtgcctacag 50

<210>36

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>36

cttggcaccc gagaattcca gagtcannnn nngattgatg gtgcctacag 50

<210>37

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>37

cttggcaccc gagaattcca tgttctnnnn nngattgatg gtgcctacag 50

<210>38

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>38

cttggcaccc gagaattcca aggatgnnnn nngattgatg gtgcctacag 50

<210>39

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>39

cttggcaccc gagaattcca atcagcnnnn nngattgatg gtgcctacag 50

<210>40

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>40

cttggcaccc gagaattcca ccgtctnnnn nngattgatg gtgcctacag 50

<210>41

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>41

cttggcaccc gagaattcca cttcacnnnn nngattgatg gtgcctacag 50

<210>42

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>42

cttggcaccc gagaattcca gaagagnnnn nngattgatg gtgcctacag 50

<210>43

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>43

cttggcaccc gagaattcca ggaacannnn nngattgatg gtgcctacag 50

<210>44

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>44

cttggcaccc gagaattcca ggcttcnnnn nngattgatg gtgcctacag 50

<210>45

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>45

cttggcaccc gagaattcca ggtggtnnnn nngattgatg gtgcctacag 50

<210>46

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>46

cttggcaccc gagaattcca tcacgcnnnn nngattgatg gtgcctacag 50

<210>47

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>47

cttggcaccc gagaattcca actcacnnnn nngattgatg gtgcctacag 50

<210>48

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>48

cttggcaccc gagaattcca agagatnnnn nngattgatg gtgcctacag 50

<210>49

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>49

cttggcaccc gagaattcca aggacannnn nngattgatg gtgcctacag 50

<210>50

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>50

cttggcaccc gagaattcca atccgtnnnn nngattgatg gtgcctacag 50

<210>51

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>51

cttggcaccc gagaattcca atgttgnnnn nngattgatg gtgcctacag 50

<210>52

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>52

cttggcaccc gagaattcca cacgacnnnn nngattgatg gtgcctacag 50

<210>53

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>53

cttggcaccc gagaattcca cagattnnnn nngattgatg gtgcctacag 50

<210>54

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>54

cttggcaccc gagaattcca gatgtannnn nngattgatg gtgcctacag 50

<210>55

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>55

cttggcacccgagaattcca gcacctnnnn nngattgatg gtgcctacag 50

<210>56

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>56

cttggcaccc gagaattcca gccatgnnnn nngattgatg gtgcctacag 50

<210>57

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>57

cttggcaccc gagaattcca ggctaannnn nngattgatg gtgcctacag 50

<210>58

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>58

cttggcaccc gagaattcca tagcgannnn nngattgatg gtgcctacag 50

<210>59

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>59

cttggcaccc gagaattcca tcattcnnnn nngattgatg gtgcctacag 50

<210>60

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>60

cttggcaccc gagaattcca ttggctnnnn nngattgatg gtgcctacag 50

<210>61

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>61

cttggcaccc gagaattcca aaggagnnnn nngattgatg gtgcctacag 50

<210>62

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>62

cttggcaccc gagaattcca accttannnn nngattgatg gtgcctacag 50

<210>63

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>63

cttggcaccc gagaattcca catcctnnnn nngattgatg gtgcctacag 50

<210>64

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>64

cttggcaccc gagaattcca cgacaannnn nngattgatg gtgcctacag 50

<210>65

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>65

cttggcaccc gagaattcca ctaatcnnnn nngattgatg gtgcctacag 50

<210>66

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>66

cttggcaccc gagaattcca ctctatnnnn nngattgatg gtgcctacag 50

<210>67

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>67

cttggcaccc gagaattcca gacacannnn nngattgatg gtgcctacag50

<210>68

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>68

cttggcaccc gagaattcca ggattgnnnn nngattgatg gtgcctacag 50

<210>69

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>69

cttggcaccc gagaattcca taaggtnnnn nngattgatg gtgcctacag 50

<210>70

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>70

cttggcaccc gagaattcca aacaggnnnn nngattgatg gtgcctacag 50

<210>71

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>71

cttggcaccc gagaattcca acagtgnnnn nngattgatg gtgcctacag 50

<210>72

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>72

cttggcaccc gagaattcca agttagnnnn nngattgatg gtgcctacag 50

<210>73

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>73

cttggcaccc gagaattcca atgaatnnnn nngattgatg gtgcctacag 50

<210>74

<211>50

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(27)..(32)

<223> n = a or g or c or t

<400>74

cttggcaccc gagaattcca ccaagannnn nngattgatg gtgcctacag 50

<210>75

<211>50

<212>DNA

<213> Artificial sequence ()

<400>75

gttcagagtt ctacagtccg acgatcaacc aagacagaca aatcacgaaa 50

<210>76

<211>50

<212>DNA

<213> Artificial sequence ()

<400>76

gttcagagtt ctacagtccg acgatccgat aggacagaca aatcacgaaa 50

<210>77

<211>50

<212>DNA

<213> Artificial sequence ()

<400>77

gttcagagtt ctacagtccg acgatcagaa gagacagaca aatcacgaaa 50

<210>78

<211>50

<212>DNA

<213> Artificial sequence ()

<400>78

gttcagagtt ctacagtccg acgatcgagc ctgacagaca aatcacgaaa 50

<210>79

<211>50

<212>DNA

<213> Artificial sequence ()

<400>79

gttcagagtt ctacagtccg acgatctagt cagacagaca aatcacgaaa 50

<210>80

<211>50

<212>DNA

<213> Artificial sequence ()

<400>80

gttcagagtt ctacagtccg acgatcactg cagacagaca aatcacgaaa 50

<210>81

<211>50

<212>DNA

<213> Artificial sequence ()

<400>81

gttcagagtt ctacagtccg acgatccagc atgacagaca aatcacgaaa 50

<210>82

<211>50

<212>DNA

<213> Artificial sequence ()

<400>82

gttcagagtt ctacagtccg acgatcccgc ctgacagaca aatcacgaaa 50

<210>83

<211>50

<212>DNA

<213> Artificial sequence ()

<400>83

gttcagagtt ctacagtccg acgatcccta gcgacagaca aatcacgaaa 50

<210>84

<211>50

<212>DNA

<213> Artificial sequence ()

<400>84

gttcagagtt ctacagtccg acgatccgca acgacagaca aatcacgaaa 50

<210>85

<211>50

<212>DNA

<213> Artificial sequence ()

<400>85

gttcagagtt ctacagtccg acgatctggc ctgacagaca aatcacgaaa 50

<210>86

<211>50

<212>DNA

<213> Artificial sequence ()

<400>86

gttcagagtt ctacagtccg acgatcgcgg ttgacagaca aatcacgaaa 50

<210>87

<211>50

<212>DNA

<213> Artificial sequence ()

<400>87

gttcagagtt ctacagtccg acgatcagtc aagacagaca aatcacgaaa 50

<210>88

<211>50

<212>DNA

<213> Artificial sequence ()

<400>88

gttcagagtt ctacagtccg acgatcagtt ccgacagaca aatcacgaaa 50

<210>89

<211>50

<212>DNA

<213> Artificial sequence ()

<400>89

gttcagagtt ctacagtccg acgatcatgt cagacagaca aatcacgaaa 50

<210>90

<211>50

<212>DNA

<213> Artificial sequence ()

<400>90

gttcagagtt ctacagtccg acgatcccgt ccgacagaca aatcacgaaa 50

<210>91

<211>50

<212>DNA

<213> Artificial sequence ()

<400>91

gttcagagtt ctacagtccg acgatcgtag aggacagaca aatcacgaaa 50

<210>92

<211>50

<212>DNA

<213> Artificial sequence ()

<400>92

gttcagagtt ctacagtccg acgatcgtcc gcgacagaca aatcacgaaa50

<210>93

<211>51

<212>DNA

<213> Artificial sequence ()

<400>93

gttcagagtt ctacagtccg acgatcgtga aaggacagac aaatcacgaa a 51

<210>94

<211>51

<212>DNA

<213> Artificial sequence ()

<400>94

gttcagagtt ctacagtccg acgatcgtgg ccggacagac aaatcacgaa a 51

<210>95

<211>51

<212>DNA

<213> Artificial sequence ()

<400>95

gttcagagtt ctacagtccg acgatcgttt cgggacagac aaatcacgaa a 51

<210>96

<211>51

<212>DNA

<213> Artificial sequence ()

<400>96

gttcagagtt ctacagtccg acgatccgta cgggacagac aaatcacgaa a 51

<210>97

<211>51

<212>DNA

<213> Artificial sequence ()

<400>97

gttcagagtt ctacagtccg acgatcgagt ggggacagac aaatcacgaa a 51

<210>98

<211>51

<212>DNA

<213> Artificial sequence ()

<400>98

gttcagagtt ctacagtccg acgatcggta gcggacagac aaatcacgaa a 51

<210>99

<211>51

<212>DNA

<213> Artificial sequence ()

<400>99

gttcagagtt ctacagtccg acgatcactg atggacagac aaatcacgaa a 51

<210>100

<211>51

<212>DNA

<213> Artificial sequence ()

<400>100

gttcagagtt ctacagtccg acgatcatga gcggacagac aaatcacgaa a 51

<210>101

<211>51

<212>DNA

<213> Artificial sequence ()

<400>101

gttcagagtt ctacagtccg acgatcattc ctggacagac aaatcacgaa a 51

<210>102

<211>51

<212>DNA

<213> Artificial sequence ()

<400>102

gttcagagtt ctacagtccg acgatccaaa agggacagac aaatcacgaa a 51

<210>103

<211>51

<212>DNA

<213> Artificial sequence ()

<400>103

gttcagagtt ctacagtccg acgatccaac taggacagac aaatcacgaa a 51

<210>104

<211>51

<212>DNA

<213> Artificial sequence ()

<400>104

gttcagagtt ctacagtccg acgatccacc ggggacagac aaatcacgaa a 51

<210>105

<211>51

<212>DNA

<213> Artificial sequence ()

<400>105

gttcagagtt ctacagtccg acgatccacg atggacagac aaatcacgaa a 51

<210>106

<211>51

<212>DNA

<213> Artificial sequence ()

<400>106

gttcagagtt ctacagtccg acgatccact caggacagac aaatcacgaa a 51

<210>107

<211>51

<212>DNA

<213> Artificial sequence ()

<400>107

gttcagagtt ctacagtccg acgatccagg cgggacagac aaatcacgaa a 51

<210>108

<211>51

<212>DNA

<213> Artificial sequence ()

<400>108

gttcagagtt ctacagtccg acgatccatg gcggacagac aaatcacgaa a 51

<210>109

<211>51

<212>DNA

<213> Artificial sequence ()

<400>109

gttcagagtt ctacagtccg acgatccatt ttggacagac aaatcacgaa a 51

<210>110

<211>51

<212>DNA

<213> Artificial sequence ()

<400>110

gttcagagtt ctacagtccg acgatcccaa caggacagac aaatcacgaa a 51

<210>111

<211>52

<212>DNA

<213> Artificial sequence ()

<400>111

gttcagagtt ctacagtccg acgatccgga ataggacaga caaatcacga aa 52

<210>112

<211>52

<212>DNA

<213> Artificial sequence ()

<400>112

gttcagagtt ctacagtccg acgatcctag ctaggacaga caaatcacga aa 52

<210>113

<211>52

<212>DNA

<213> Artificial sequence ()

<400>113

gttcagagtt ctacagtccg acgatcctat acaggacaga caaatcacga aa 52

<210>114

<211>52

<212>DNA

<213> Artificial sequence ()

<400>114

gttcagagtt ctacagtccg acgatcctca gaaggacaga caaatcacga aa 52

<210>115

<211>52

<212>DNA

<213> Artificial sequence ()

<400>115

gttcagagtt ctacagtccg acgatcgacg acaggacaga caaatcacga aa 52

<210>116

<211>52

<212>DNA

<213> Artificial sequence ()

<400>116

gttcagagtt ctacagtccg acgatctaat cgaggacaga caaatcacga aa 52

<210>117

<211>52

<212>DNA

<213> Artificial sequence ()

<400>117

gttcagagtt ctacagtccg acgatctaca gcaggacaga caaatcacga aa 52

<210>118

<211>52

<212>DNA

<213> Artificial sequence ()

<400>118

gttcagagtt ctacagtccg acgatctata ataggacaga caaatcacga aa 52

<210>119

<211>52

<212>DNA

<213> Artificial sequence ()

<400>119

gttcagagtt ctacagtccg acgatctcat tcaggacaga caaatcacga aa 52

<210>120

<211>52

<212>DNA

<213> Artificial sequence ()

<400>120

gttcagagtt ctacagtccg acgatctccc gaaggacaga caaatcacga aa 52

<210>121

<211>52

<212>DNA

<213> Artificial sequence ()

<400>121

gttcagagtt ctacagtccg acgatctcga agaggacaga caaatcacga aa 52

<210>122

<211>52

<212>DNA

<213> Artificial sequence ()

<400>122

gttcagagtt ctacagtccg acgatctcgg caaggacaga caaatcacga aa 52

<210>123

<211>52

<212>DNA

<213> Artificial sequence ()

<400>123

gttcagagtt ctacagtccg acgatcggag ttaggacaga caaatcacga aa 52

<210>124

<211>52

<212>DNA

<213> Artificial sequence ()

<400>124

gttcagagtt ctacagtccg acgatccctt caaggacaga caaatcacga aa 52

<210>125

<211>52

<212>DNA

<213> Artificial sequence ()

<400>125

gttcagagtt ctacagtccg acgatccgaa taaggacaga caaatcacga aa 52

<210>126

<211>52

<212>DNA

<213> Artificial sequence ()

<400>126

gttcagagtt ctacagtccg acgatccgga gaaggacaga caaatcacga aa 52

<210>127

<211>53

<212>DNA

<213> Artificial sequence ()

<400>127

gttcagagtt ctacagtccg acgatcacta agtaggacag acaaatcacg aaa 53

<210>128

<211>53

<212>DNA

<213> Artificial sequence ()

<400>128

gttcagagtt ctacagtccg acgatcgaag cttaggacag acaaatcacg aaa 53

<210>129

<211>53

<212>DNA

<213> Artificial sequence ()

<400>129

gttcagagtt ctacagtccg acgatcgact attaggacag acaaatcacg aaa 53

<210>130

<211>53

<212>DNA

<213> Artificial sequence ()

<400>130

gttcagagtt ctacagtccg acgatcgagt aataggacag acaaatcacg aaa 53

<210>131

<211>53

<212>DNA

<213> Artificial sequence ()

<400>131

gttcagagtt ctacagtccg acgatcgcag tctaggacag acaaatcacg aaa 53

<210>132

<211>53

<212>DNA

<213> Artificial sequence ()

<400>132

gttcagagtt ctacagtccg acgatcgctc aataggacag acaaatcacg aaa 53

<210>133

<211>53

<212>DNA

<213> Artificial sequence ()

<400>133

gttcagagtt ctacagtccg acgatcggat attaggacag acaaatcacg aaa 53

<210>134

<211>53

<212>DNA

<213> Artificial sequence ()

<400>134

gttcagagtt ctacagtccg acgatcgtaa gataggacag acaaatcacg aaa 53

<210>135

<211>53

<212>DNA

<213> Artificial sequence ()

<400>135

gttcagagtt ctacagtccg acgatcgtat cttaggacag acaaatcacg aaa 53

<210>136

<211>53

<212>DNA

<213> Artificial sequence ()

<400>136

gttcagagtt ctacagtccg acgatcgtca tctaggacag acaaatcacg aaa 53

<210>137

<211>53

<212>DNA

<213> Artificial sequence ()

<400>137

gttcagagtt ctacagtccg acgatctaac gttaggacag acaaatcacg aaa 53

<210>138

<211>53

<212>DNA

<213> Artificial sequence ()

<400>138

gttcagagtt ctacagtccg acgatcttac tttaggacag acaaatcacg aaa 53

<210>139

<211>53

<212>DNA

<213> Artificial sequence ()

<400>139

gttcagagtt ctacagtccg acgatcttct gataggacag acaaatcacg aaa 53

<210>140

<211>53

<212>DNA

<213> Artificial sequence ()

<400>140

gttcagagtt ctacagtccg acgatctggt cctaggacag acaaatcacg aaa 53

<210>141

<211>53

<212>DNA

<213> Artificial sequence ()

<400>141

gttcagagtt ctacagtccg acgatcgtta agtaggacag acaaatcacg aaa 53

<210>142

<211>53

<212>DNA

<213> Artificial sequence ()

<400>142

gttcagagtt ctacagtccg acgatctcgc ggtaggacag acaaatcacg aaa 53

<210>143

<211>53

<212>DNA

<213> Artificial sequence ()

<400>143

gttcagagtt ctacagtccg acgatcaacc tctaggacag acaaatcacg aaa 53

<210>144

<211>53

<212>DNA

<213> Artificial sequence ()

<400>144

gttcagagtt ctacagtccg acgatcaacg gttaggacag acaaatcacg aaa 53

<210>145

<211>53

<212>DNA

<213> Artificial sequence ()

<400>145

gttcagagtt ctacagtccg acgatcacca gataggacag acaaatcacg aaa 53

<210>146

<211>53

<212>DNA

<213> Artificial sequence ()

<400>146

gttcagagtt ctacagtccg acgatcagcg gctaggacag acaaatcacg aaa 53

<210>147

<211>53

<212>DNA

<213> Artificial sequence ()

<400>147

aatgatacgg cgaccaccga gatctacacg ttcagagttc tacagtccga cga 53

<210>148

<211>63

<212>DNA

<213> Artificial sequence ()

<400>148

caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>149

<211>63

<212>DNA

<213> Artificial sequence ()

<400>149

caagcagaag acggcatacg agatacatcg gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>150

<211>63

<212>DNA

<213> Artificial sequence ()

<400>150

caagcagaag acggcatacg agatgcctaa gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>151

<211>63

<212>DNA

<213> Artificial sequence ()

<400>151

caagcagaag acggcatacg agattggtca gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>152

<211>63

<212>DNA

<213> Artificial sequence ()

<400>152

caagcagaag acggcatacg agatcactgt gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>153

<211>63

<212>DNA

<213> Artificial sequence ()

<400>153

caagcagaag acggcatacg agatattggc gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>154

<211>63

<212>DNA

<213> Artificial sequence ()

<400>154

caagcagaag acggcatacg agatgatctg gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>155

<211>63

<212>DNA

<213> Artificial sequence ()

<400>155

caagcagaag acggcatacg agattcaagt gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>156

<211>63

<212>DNA

<213> Artificial sequence ()

<400>156

caagcagaag acggcatacg agatctgatc gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>157

<211>63

<212>DNA

<213> Artificial sequence ()

<400>157

caagcagaag acggcatacg agataagcta gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>158

<211>63

<212>DNA

<213> Artificial sequence ()

<400>158

caagcagaag acggcatacg agatgtagcc gtgactggag ttccttggca cccgagaatt 60

cca 63

<210>159

<211>63

<212>DNA

<213> Artificial sequence ()

<400>159

caagcagaag acggcatacg agattacaag gtgactggag ttccttggca cccgagaatt 60

cca 63

Claims

1. A method for constructing a high-throughput single-cell small RNA library comprises the following steps:

in the process of carrying out the 3 'end connection reaction, the nucleotide sequence of the adopted 3' joint is shown as SEQ ID NO: 1 is shown in the specification;

in the process of carrying out the 5 'end connection reaction, the nucleotide sequence of the adopted 5' linker is shown as SEQ ID NO: 2, respectively.

2. The method of claim 1, wherein the cell lysis reaction is performed by adding cell lysate to the selected microwells, and then moving the chip to a PCR instrument for incubation and heating reaction;

preferably, the components of the cell lysate comprise a Triton x-100 lysate and a ribonuclease inhibitor;

preferably, the incubation temperature for cell lysis is 25 ℃ and the incubation time is 5 min; the heating reaction temperature is 75 ℃, and the heating time is 5 min.

3. The method according to claim 1, wherein the 3' ligation reaction is performed by adding a 3' ligation reaction solution to the selected microwells and performing a 3' ligation reaction procedure;

preferably, the components of the 3 'end connection reaction solution comprise a 3' joint, T4RNA ligase 2, T4RNA connection buffer and a ribonuclease inhibitor;

preferably, the 3' end connection reaction process comprises incubation for 6h at 25 ℃, then reaction for 8-10 h at 4 ℃ and finally heating for 20min at 65 ℃;

preferably, before the reaction for removing the free joint, the method further comprises the steps of adding a reverse transcription mixture into the selected micro-hole, then moving the chip into a PCR instrument, and carrying out heating reaction;

preferably, the components of the reverse transcription mixture comprise tagged reverse transcription primers and Lambda exonuclease reaction buffer;

the sequence of the tagged reverse transcription primer comprises the sequence set forth in SEQ ID NO: 3 to SEQ ID NO: 74;

preferably, the heating reaction is carried out at a temperature of 70 ℃ for a reaction time of 2 min.

4. The method of claim 1, wherein the step of performing the reaction for removing free linkers comprises adding the reaction solution for removing linkers into the selected microwells, and then transferring the chip into a PCR instrument to perform a reaction procedure for removing linkers;

preferably, the linker reaction solution is removed from the reaction mixture by a method comprising Lambda exonuclease, 5' adenylate dehydrogenase, and ribonuclease inhibitor;

preferably, the decapping reaction is performed by 30min incubation at 30 ℃, followed by 60min incubation at 37 ℃ and finally 10min heating at 75 ℃.

5. The method of claim 1, wherein the performing of the 5' ligation reaction comprises adding the 5' ligation reaction solution to the selected microwell, transferring the chip to a PCR instrument, and performing the 5' ligation reaction procedure;

preferably, the components of the 5 'end connection reaction solution comprise a 5' joint, T4RNA ligase 1, T4RNA connection buffer and a ribonuclease inhibitor;

preferably, the 5' end ligation reaction is performed by incubation at 37 ℃ for 1h followed by heating at 65 ℃ for 20 min.

6. The method according to claim 1, wherein the reverse transcription reaction is performed by adding a reverse transcription reaction solution to the selected microwell, then transferring the chip to a PCR instrument, and performing a reverse transcription reaction procedure;

preferably, the reverse transcription reaction solution comprises a strand synthesis buffer, DTT, dNTP, a ribonuclease inhibitor and Superscript III reverse transcriptase;

preferably, the reverse transcription reaction process is a reaction at 55 ℃ for 50min, and then heating at 70 ℃ for 15 min.

7. The method of claim 1, wherein the first PCR reaction is performed by adding a PCR-1 reaction solution to the selected microwell, and then moving the chip to a PCR instrument to perform a PCR-1 reaction procedure; collecting reaction liquid, purifying a PCR-1 product by using magnetic beads, and then screening and recovering fragments of the PCR-1 product;

preferably, the PCR-1 reaction solution comprises labeled PCR-1 primers, dNTPs, a PCR buffer solution and DNA polymerase;

the sequence of the tagged PCR-1 primer includes the sequence shown in SEQ ID NO: 75 to SEQ ID NO: 146;

preferably, the PCR-1 reaction process comprises the steps of reacting at 95 ℃ for 3min, then reacting at 95 ℃ for 20s in 12-14 cycles, then reacting at 65 ℃ for 20s, then reacting at 72 ℃ for 20s, and finally reacting at 72 ℃ for 5 min;

preferably, PCR-1 products were purified using Ampure XP magnetic beads and the product fragment size distribution was detected with an Agilent2100 bioanalyzer followed by quantification with the Qubit dsDNA HS detection kit.

8. The method according to claim 1, wherein the second PCR reaction is performed by preparing a PCR-2 reaction solution using the recovered PCR-1 product as a template, and performing a PCR-2 reaction procedure;

preferably, the PCR-2 reaction solution comprises an SCSR-PCR-1 primer, an SCSR-PCR-2 primer, dNTP, PCRbuffer and DNA polymerase;

the sequence of the SCSR-PCR-1 primer is shown as SEQ ID NO: 147, the sequence of the SCSR-PCR-2 primer includes the sequence shown in SEQ ID NO: 148 to SEQ ID NO: 159;

preferably, the PCR-1 reaction process comprises the steps of reacting at 95 ℃ for 3min, then reacting at 95 ℃ for 7-13 cycles for 20s, then reacting at 67 ℃ for 20s, then reacting at 72 ℃ for 20s, and finally reacting at 72 ℃ for 5 min;

preferably, the PCR-2 product is purified using Ampure XP magnetic beads and the product fragments are screened using Piplin Prep; the content of the library was determined with a Qubit high sensitivity kit, its size distribution was determined with an Agilent2100 bioanalyzer, and its quality was determined with a library quantification kit.

9. The method of claim 1, wherein the single cell operating system is ICELL 8;

preferably, the cells comprise a549 cells, human peripheral blood mononuclear cells, or mouse B16F10 cells.

10. The method of any one of claims 1 to 9, wherein the obtained high-throughput single-cell small RNA library is constructed.